Literature DB >> 28191309

Co-existence of blaOXA-23 and blaNDM-1 genes of Acinetobacter baumannii isolated from Nepal: antimicrobial resistance and clinical significance.

Prabhu Raj Joshi1, Mahesh Acharya1, Trishna Kakshapati2, Udomluk Leungtongkam3, Rapee Thummeepak3, Sutthirat Sitthisak3,4.   

Abstract

BACKGROUND: Molecular analysis of carbapenem-resistant genes in Acinetobacter baumannii, an emerging pathogen, is less commonly reported from Nepal. In this study we determined the antibiotic susceptibility profile and genetic mechanism of carbapenem resistance in clinical isolates of A. baumannii.
METHODS: A. baumannii were isolated from various clinical specimens and identified based on Gram staining, biochemical tests, and PCR amplification of organism specific 16S rRNA and blaOXA-51 genes. The antibiotic susceptibility testing was performed using disc diffusion and E-test method. Multiplex PCR assays were used to detect the following β-lactamase genes: four class D carbapenem hydrolyzing oxacillinases (blaOXA-51, blaOXA-23, blaOXA-24 and blaOXA-58). Uniplex PCRs were used to detect three class B metallo-β-lactamases genes (blaIMP, blaVIM and blaNDM-1), class C cephalosporin resistance genes (blaADC), aminoglycoside resistance gene (aphA6), and ISAba1 of all isolates. Insertion sequence ISAba125 among NDM-1 positive strains was detected. Clonal relatedness of all isolates were analyzed using repetitive sequence-based PCR (rep-PCR).
RESULTS: Of total 44 analyzed isolates, 97.7% (n = 43) were carbapenem-resistant A. baumannii (CR-AB) and 97.7% (n = 43) were multidrug resistant A. baumannii (MDR-AB). One isolate was detected to be extremely drug resistant A. baumannii (XDR-AB). All the isolates were fully susceptible to colistin (MICs < 2 μg/ml). The blaOXA-23 gene was detected in all isolates, while blaNDM-1 was detected in 6 isolates (13.6%). Insertion sequence, ISAba1 was detected in all of blaOXA-23 positive isolates. ISAba125 was detected in all blaNDM-1 positive strains. The blaADC and aphA6 genes were detected in 90.1 and 40.1%, respectively. The rep-PCR of all isolates represented 7 different genotypes.
CONCLUSION: We found high prevalence of CR-AB and MDR-AB with blaOXA-23 gene in a tertiary care hospital in Nepal. Systemic network surveillance should be established for monitoring and controlling the spread of these resistant strains.

Entities:  

Keywords:  Acinetobacter baumannii; Carbapenem resistance; blaOXA-23 and blaNDM-1 carbapenemase genes

Year:  2017        PMID: 28191309      PMCID: PMC5297125          DOI: 10.1186/s13756-017-0180-5

Source DB:  PubMed          Journal:  Antimicrob Resist Infect Control        ISSN: 2047-2994            Impact factor:   4.887


Background

Acinetobacter baumannii, an emerging pathogen of healthcare centers, shows intrinsic as well as acquired drug-resistance mechanisms [1]. Multidrug-resistant A. baumannii can be resistant to all of the currently available antibiotics, and in its deadliest form these are only susceptible to potentially toxic polymyxins and colistins, leaving limited options for treatment [2]. Infections with carbapenem- and colistin-resistant A. baumannii are emerging globally [3]. Carbapenem resistance in A. baumannii encompasses production of class B, C and class D carbapenemase, decreased membrane permeability, altered penicillin-binding proteins, and overexpression of efflux pumps [4, 5]. Most commonly, Acinetobacter spp. develop carbapenem resistance by production of OXA-type carbapenemase and metallo-β-lactamases (MBLs) [6, 7]; bla OXA-23-like, bla OXA-40-like, bla OXA-58-like and bla OXA-51-like carbapenemases are broadly reported, where bla OXA-51-like β-lactamases, intrinsic to A. baumannii, is used for species identification [8-10]. Among multiple MBL genes, bla IMP and bla VIM types (chromosomal or plasmid encoded) encode carbapenemase in A. baumannii [9]. A. baumannii harboring plasmid encoded New Delhi metallo-β-lactamase-1 (NDM-1), a novel carbapenemase gene, is reported from many countries [11, 12]. In addition, detection of class C β-lactamase genes (bla ADC) which mediated cephalosporin resistances and aminoglycoside resistant genes (aphA6) has increased in recent years in A. baumannii clinical isolates [13, 14]. A. baumannii remains a critical problem in many healthcare settings throughout the world despite the implementation of infection control practices. There are limited data on carbapenem-resistant A. baumannii in Nepal. The objective of this study was to determine antibiotic susceptibility profile, antibiotic resistance genes and genetic mechanism of carbapenem resistance of A. baumannii in clinical isolates at a tertiary care hospital, Nepal.

Methods

Bacterial isolation and identification

A. baumannii isolates were collected from inpatient units of a tertiary hospital, Nepal. Forty-four non-duplicate isolates were collected (24 male and 20 female; age range between 24 to 80 years) over 9 months periods (October 2014 to June 2015). All isolates were identified by classical biochemical methods and confirmed by PCR method for detecting 16S rRNA gene and bla OXA-51 gene [15, 16]. Isolates were identified as A. baumannii by PCR result of positive for both PCRs.

Antibiotic susceptibility testing

The antibiotic susceptibility of amikacin (30), cefotaxime (30), ceftazidime (30), ceftriaxone (30), cefepime (30), ciprofloxacin (5), gentamicin (10), imipenem (10), meropenem (10), trimethoprim/sulfamethoxazole (1.25/23.75), tetracycline (30), and piperacillin/tazobactam (100/10) (Oxoid) was determined on Mueller Hinton Agar (High Media, India) according to the antibiotic disk diffusion method [17]. The plates were incubated at 37 °C for 24 h. The zones of inhibition were determined whether the microorganism was susceptible, intermediately resistant, or resistant to each antibiotic according to Clinical and Laboratory Standards Institute (CLSI) guidelines. E-test was performed to determine the Minimum inhibitory concentration (MIC) of ceftazidime, imipenem, tigecycline and colistin (High Media, India) according to manufacturer instructions and interpreted as per CLSI guidelines except for tigecycline. Multidrung-resistant A. baumannii (MDR-AB) was defined when A. baumannii resistant to multiple antibiotics, often defined as three or more antibiotic classes. Extensively drug resistant A. baumannii (XDR-AB) was defined when A. baumannii was resistant to all antimicrobial agents except polymyxins (colistin) [18].

PCR amplification of antibiotic resistance genes

PCR assays to detect bla OXA-23, bla OXA-24, bla OXA-51, bla OXA-58, bla IMP, bla VIM bla NDM, bla ADC and ahpA6 genes were performed using primers as describe previously (Table 1). The amplification reaction was performed using A. baumannii cell lysate as DNA template. Each PCR was performed in triplicate in a thermocycler with a PCR condition as described previously [14, 16, 19–21]. All PCR assays used 16S rRNA or bla OXA-51 genes as the internal control. The ISAba1 of bla OXA-23 gene was detected using combination of primers ISAba1-F/ISAba1-R and ISAba1-F/bla OXA-23-R (Table 1) [22]. The ISAba125 of bla NDM-1 gene were determined in all bla NDM-1 positive strains using combination of primers ISA125-F/ISA125-R and ISA125-F/bla NDM-R (Table 1). PCR products of the bla NDM-1 genes were purified and sequenced. BLAST was used to compare the sequences of bla NDM-1 genes against the GenBank Database. PCR products were analyzed by electrophoresis in 1% agarose gel containing 0.5 μg/ml ethidium bromides.
Table 1

List of primer for detection of genes used in this study

Target genesPrimer nameSequence 5’-3’Size/ Annealing temp.References
16S rRNA16S rRNA-FAGAGTTTGATCCTGGCTCAG1500/58[15]
16S rRNA-RACGGCTACCTTGTTACGACTT
bla OXA-23 bla OXA-23-FGATCGGATTGGAGAACCAGA501/52[16]
bla OXA-23-RATTTCTGACCGCATTTCCAT
bla OXA-51 bla OXA-51-FTAATGCTTTGATCGGCCTTG353/52[16]
bla OXA-51-RTGGATTGCACTTCATCTTGG
bla OXA-24 bla OXA-24-FGGTTAGTTGGCCCCCTTAAA246/52[16]
bla OXA-24-RAGTTGAGCGAAAAGGGGATT
bla OXA-58 bla OXA-58-FAAGTATTGGGGCTTGTGCTG599/52[16]
bla OXA-58-RCCCCTCTGCGCTCTACATAC
bla IMP bla IMP –FGGAATAGAGTGGCTTAAYTCTC232/52[20]
bla IMP –RGGTTTAAYAAAACAACCACC
bla VIM bla VIM –FGATGGTGTTTGGTCGCATA390/52[20]
bla VIM –RCGAATGCGCAGCACCAG
bla NDM bla NDM–FGGTTTGGCGATCTGGTTTTC621/52[21]
bla NDM–RCGGAATGGCTCATCACGATC
bla ADC bla ADC-FTAAACACCACATATGTTCCG663/56[19]
bla ADC-FACTTACTTCAACTCGCGACG
aphA6 aphA6-FATGGAATTGCCCAATATTATTC736/55[14]
aphA6-RTCAATTCAATTCATCAAGTTTTA
ISAba1 ISAba1-FCATTGGCATTAAACTGAGGAGAAA451/52[22]
ISAba1-RTTGGAAATGGGGAAAACGAA
ISAba125 ISA125-FTGTTGAAGCGATCCGTTGTT755/57This study
ISA125-RGTGCGACAGTTTCAAAAGCCA
Rep-PCRERIC-2AAGTAAGTGACTGGGGTGAGCGvariable length/45[24]
List of primer for detection of genes used in this study

IPM-EDTA combined disk test

All bla NDM-1 positive strains were tested for MBL production by IPM-EDTA combined disk test. The test was performed as previously described [23]. After 24 h incubation, the difference of inhibition zone diameter between IPM-EDTA disk and IPM disk alone (≥7 mm) was considered the positive criteria for the presence of MBL.

Repetitive element PCR-mediated DNA fingerprinting (rep-PCR)

Genomic DNA of each isolates was extracted from the overnight cultures using GF-1 bacterial DNA extraction kit (Vivantis, Malaysia). Rep-PCR was performed by using genomic DNA as a template for PCR amplification with the ERIC-2 primer (Table 1) using condition as describe previously [24, 25]. PCR-banding patterns and rep-PCR types were analyzed and interpreted as previously described [25].

Results

Demographic characteristic of patients

Demographic characteristics of the inpatients with A. baumannii infection were analyzed; 24 (54.5%) were male and 20 (45.5%) were female. Most of the specimens were from ICU wards (n = 27, 61.4%) (Fig. 1). Isolates were collected from sputum (n = 26, 59.1%), tracheal aspirates (n = 9, 20.4%), catheter tip, (n = 4, 9.1%), pus (n = 4, 9.1%) and urine (n = 1, 2.3%) (Fig. 1).
Fig. 1

Distribution of A. baumannii carrying carbapenemase genes in different specimen types a and wards b

Distribution of A. baumannii carrying carbapenemase genes in different specimen types a and wards b

Antibiotic susceptibility

Of the 44 isolates, resistance was found against ciprofloxacin (n = 43, 97.7%), cefotaxime (n = 43, 97.7%), ceftazidime (n = 42, 95.4%), ceftriaxone (n = 41, 93.2%), cefepime (n = 39, 88.6%), amikacin (n = 19, 43.2%), gentamicin (n = 23, 52.3%), trimethoprim/sulfamethoxazole (n = 41, 93.2%), tetracycline (n = 21, 47.7%) and piperacillin/tazobactam (n = 43, 97.7%). Only one isolate of A.baumannii was susceptible to all tested antibiotics. Most isolates (97.7%, n = 43) were carbapenem resistant A. baumannii (CR-AB); all CR-AB were MDR-AB. One isolate was detected to be XDR-AB. All the isolates were fully susceptible to colistin (MICs < 2 μg/ml) and MIC of tigecycline was determined to be <2.5 μg/ml (Table 2).
Table 2

The carbapenemases gene patterns, rep-PCR types and MIC determination of A. baumannii isolated from difference wards

Sitesβ-lactamase gene patternsNo. of isolatesRep-PCRTypes (n)MIC (μg/ml) range
CAZIMPTGCL
Intensive care unit bla OXA-51/ OXA-23 25A (2), B (6), C (8), D (6), E (2), F (1)4– > 2561– > 321.6–3.90.13–2
bla OXA-51/ OXA-23/ NDM-1 2B (1), C (1)>256>321.7–3.20.61–0.79
General ward bla OXA-51/ OXA-23 9A (1), B (1), C (1), D (5), G (1)>256>24–>322–3.40.32–0.88
Post-operative ward bla OXA-51/ OXA-23 4A (1), B (1), C (2)>256>322.3–3.30.54–0.78
bla OXA-51/ OXA-23/ NDM-1 4A (1), C (2) D (1)>256>322.1–3.20.23–0.51

Abbreviations: CAZ ceftazidime, IPM imipenem, TG tigecycline, CL colistin

The carbapenemases gene patterns, rep-PCR types and MIC determination of A. baumannii isolated from difference wards Abbreviations: CAZ ceftazidime, IPM imipenem, TG tigecycline, CL colistin

Antibiotic resistance genes and IS element in A. baumannii

Aminoglycoside resistance gene, aphA6 and cephalosporin resistance genes, bla ADC were detected in 40.1% (18/44) and 90.1% (40/44), respectively. The bla OXA-23 was present in all isolates. Other class D β-lactamase genes, including bla OXA-24 and bla OXA-58, markers of carbapenem resistance in A. baumannii, were not detected in analyzed isolates. ISAba1 was detected in all of bla OXA-23 positive isolates (100%). Of total analyzed isolates, 6 (13.6%) also harbored bla NDM-1 gene in addition to bla OXA-23 and bla OXA-51. All NDM-1 positive strains exhibited insertion sequence ISAba125 detecting with primers ISA125-F/ISA125-R. All isolates also detected a band of 1.6 kb in a PCR using ISA125-F/bla NDM-R primers. Metallo-β-lactamase (MBL) genes, including bla VIM and bla IMP, were not detected in all isolates. The sequences of the bla NDM-1 gene yielded 99-100% sequence identity to the bla NDM-1 gene from Acinetobacter lwoffii strain WJ10621 plasmid pNDM-BJ01 (Accession: JQ001791) obtained from the GenBank Database.

MBL production

Six A. baumannii isolates harbored bla NDM-1 gene were detected for MBL production. All of bla NDM-1 positive strains were positive for MBL production. MBL positive strains showed resistance to fluoroquinolones and β-lactam.

Epidemiological typing

Clonal relationship among isolates were studied using rep-PCR typing. The fingerprinting represented 7 different DNA patterns consisting of 2 to 5 DNA fragment sizes. The amplicons size for ERIC-2 PCR was 500–4000 bp. The genotype was named A-G as shown in Fig. 2. The high prevalence genotype was type C (n = 14; 31.8%) and D (n = 12; 27.3%). Genotype A, B, C and D were disseminated in all isolated ward (ICU, general ward and post-operative ward). Among 44 isolates, one isolate of type F (2.3%) and G (2.3%) was found. Type F was obtained from a catheter tip specimen from the ICU ward. Type G was obtained from sputum of a patient from a general ward. All NDM-1 positive strains exhibited genotype A (n = 1), B (n = 1), C (n = 3) and D (n = 1).
Fig. 2

Rep-PCR-based DNA fingerprint patterns of A. baumannii isolates. The lanes marked M contain molecular markers. Each lane represents genotype patterns of A–G

Rep-PCR-based DNA fingerprint patterns of A. baumannii isolates. The lanes marked M contain molecular markers. Each lane represents genotype patterns of A–G

Discussions

A. baumannii harboring bla OXA-51-like gene has been identified as a marker for species identification. An intrinsic bla OXA-51-like gene detected in all isolates in this study supports the use of this gene as a surrogate marker of A. baumannii identification [8-10]. High prevalence of cephalosporin resistance genes, bla ADC (90.1%) was found in this study. In addition, we found a high rate of cepharosporin resistant antibiotics (cefotaxime, ceftazidime, ceftriaxone) using the disk diffusion method. These data indicated that cephalosporins no longer work to treat A. baumannii isolated from Nepal. Carbapenem resistance in A. baumannii is a major concern and is most often associated with class D β-lactamases and MBLs. The full susceptibility of all CR-AB to colistin in this study indicates that colistin is still an option of drug for the treatment of infections caused by A. baumannii in Nepal hospital. OXA-type carbapenemases are predominant in A. baumannii [6, 7]. In agreement with this finding, high prevalence of bla OXA-23 carrying A. baumannii strains has been reported in Nepalese patients [26]. The acquired bla OXA-23 is the dominant genetic determinant in Asia. The bla OXA-23 gene located on plasmid can be transferred between A. baumannii through conjugation. Thus, antibiotic resistant bacteria have been rapidly increasing worldwide [27]. The bla OXA-24 and bla OXA-58 were not detected in any isolates from this study. The bla OXA-24/40 and bla OXA-58 genes were common in A. baumannii isolated from Europe [2, 28]. Recently, bla OXA-143 and bla OXA-235, which are novel class D β-lactamase genes in A. baumannii have been identified. To date, these determinants were detected only in Brazil, Mexico and the USA [29, 30]. ISAba1 was detected in widespread clones of A. baumannii worldwide. Our study found ISAba1 upstream of bla OXA-23 in all A. baumannii isolates. A correlation between A. baumannii clusters carrying the ISAba1/bla OXA-23 gene and increased minimal inhibitory concentrations for carbapenems was reported [31]. One isolate (AB-13) that was recovered from catheter tips of long-stay hospital patients showed an extreme drug resistance pattern (Additional file 1: Table S1). This isolate represented bla OXA-23, bla ADC and aphA6 genes. Further molecular study to detect other antibiotic resistance genes is needed to explain what factors correlated with extreme drug resistance. We also found one isolate (AB-25) harboring bla OXA-23, bla ADC and aphA6 genes was sensitive to all tested drugs (Additional file 1: Table S1). This may be due to the lack of promoter or mutation of ISAba1 or bla OXA-23 gene. Further study is needed to warrant the conclusion. The bla NDM-1 carrying A. baumannii has recently been emerged in many countries, including Germany, Spain, Israel, Egypt, Switzerland, Libya, India, Pakistan and Nepal [11, 26, 32, 33]. The bla NDM-1 gene has been identified as a chimeric gene constructed by the fusion of the aminoglycoside-resistance gene aphA6 with a mannose-binding lectin gene. This event most likely occurs in Acinetobacter spp., indicating that these bacteria are likely the origin of this gene [34]. In this study, we identified 13.6% of A. baumannii carrying bla NDM-1 gene. Previous study has identified high prevalence (24.6%) of the A. baumannii harbored the bla NDM-1 gene in Nepal in 2013–2014 [26]. Taking into consideration the relationship between India, China and Nepal, the spread of bla NDM-1 is likely to occur rapidly, mostly through A. baumannii rather than Enterobacteriaceae. A. baumannii able to transfer the bla NDM-1 gene via conjugation to the recipients and Tn125 appears to be the main vehicle for dissemination of the bla NDM-1 genes in A. baumannii [35]. Poirel et al. reported that the bla NDM-1 gene was located within the composite transposon Tn125 bracketed by two copies of a strong promoter of bla NDM-1 gene called ISAba125 [11]. This report was correlated with our finding that found ISAba125 in 100% of NDM-1 producing A. baumannii. The previous study reported that the most of A. baumannii isolates harboring bla NDM-1 belonged to ST85 and ST25 [35-37]. In Libyan hospital, Libya, the main clone of imipenem-resistant NDM-1-producing A. baumannii belonged to ST2 [33]. We used rep-PCR typing to determine the clonal relationship in NDM-1 producing A. baumannii. Our study highlighted that most of NDM-1-producing A. baumannii isolates belonged to 4 genotypes using rep-PCR. Rep-PCR is a method that generates DNA fingerprints to discriminate between bacterial strains, and has been used to characterize A. baumannii isolates from hospitalized patients [38]. Our rep-PCR typing represented a high genetic diversity (A-G) among A. baumannii isolates from Nepal. Some clonally related groups (A, B, C and D) were observed in the all wards represented the disseminated of these clones in the hospital. Four genotypes (A, B, C, and D) of co-existence of bla OXA-23 and bla NDM-1 A. baumannii isolates were found. In addition, dissemination of these four genotypes into different wards also confirms as a major epidemic. Since rep-PCR is less discriminatory for molecular typing of bacterial strains, further study using multi-locus sequence typing could be useful for epidemiological investigations.

Conclusion

Antibiotic resistance in A. baumannii is considered to be a major future challenge in Nepal. Beyond OXA-type carbapenemase, there is no doubt the emergence and spreads of NDM-1 encoding A. baumannii–a superbug–will further limit chemotherapeutic options and threaten the public health of Nepal. The mechanism of hospital adaptiveness beyond antibiotic resistance will be more demanded in order to fully understand and combat MDR and XDR A. baumannii.
  37 in total

1.  blaNDM-1 is a chimera likely constructed in Acinetobacter baumannii.

Authors:  M A Toleman; J Spencer; L Jones; T R Walsh
Journal:  Antimicrob Agents Chemother       Date:  2012-02-06       Impact factor: 5.191

2.  Characterization of blaOXA-143 variants in Acinetobacter baumannii and Acinetobacter pittii.

Authors:  Esther Zander; Rémy A Bonnin; Harald Seifert; Paul G Higgins
Journal:  Antimicrob Agents Chemother       Date:  2014-02-24       Impact factor: 5.191

3.  Interspecies dissemination of a novel class 1 integron carrying blaIMP-19 among Acinetobacter species in Japan.

Authors:  Masaki Yamamoto; Miki Nagao; Yasufumi Matsumura; Aki Matsushima; Yutaka Ito; Shunji Takakura; Satoshi Ichiyama
Journal:  J Antimicrob Chemother       Date:  2011-08-22       Impact factor: 5.790

4.  Elevated prevalence of multidrug-resistant Acinetobacter baumannii with extensive genetic diversity in the largest burn centre of northeast Iran.

Authors:  Nazanin Sarhaddi; Saman Soleimanpour; Hadi Farsiani; Arman Mosavat; Samaneh Dolatabadi; Himen Salimizand; Saeid Amel Jamehdar
Journal:  J Glob Antimicrob Resist       Date:  2016-12-21       Impact factor: 4.035

5.  Co-occurrence of blaNDM-1 with blaOXA-23 or blaOXA-58 in clinical multidrug-resistant Acinetobacter baumannii isolates in Algeria.

Authors:  Abir Ramoul; Lotfi Loucif; Sofiane Bakour; Sabrina Amiri; Mazouz Dekhil; Jean-Marc Rolain
Journal:  J Glob Antimicrob Resist       Date:  2016-06-11       Impact factor: 4.035

6.  Genomic species identification of Acinetobacter of clinical isolates by 16S rDNA sequencing.

Authors:  S Misbah; H Hassan; M Y Yusof; Y A Hanifah; S AbuBakar
Journal:  Singapore Med J       Date:  2005-09       Impact factor: 1.858

7.  Multicenter study using standardized protocols and reagents for evaluation of reproducibility of PCR-based fingerprinting of Acinetobacter spp.

Authors:  H J Grundmann; K J Towner; L Dijkshoorn; P Gerner-Smidt; M Maher; H Seifert; M Vaneechoutte
Journal:  J Clin Microbiol       Date:  1997-12       Impact factor: 5.948

8.  Characterization and PCR-based replicon typing of resistance plasmids in Acinetobacter baumannii.

Authors:  Alessia Bertini; Laurent Poirel; Pauline D Mugnier; Laura Villa; Patrice Nordmann; Alessandra Carattoli
Journal:  Antimicrob Agents Chemother       Date:  2010-07-26       Impact factor: 5.191

9.  Early detection of metallo-β-lactamase NDM-1- and OXA-23 carbapenemase-producing Acinetobacter baumannii in Libyan hospitals.

Authors:  Najla Mathlouthi; Allaaeddin Ali El Salabi; Mariem Ben Jomàa-Jemili; Sofiane Bakour; Charbel Al-Bayssari; Abdulaziz A Zorgani; Abdulmajeed Kraiema; Omar Elahmer; Liliane Okdah; Jean-Marc Rolain; Chedly Chouchani
Journal:  Int J Antimicrob Agents       Date:  2016-04-25       Impact factor: 5.283

10.  VIM-1 metallo-beta-lactamase in Acinetobacter baumannii.

Authors:  Athanassios Tsakris; Alexandros Ikonomidis; Spyros Pournaras; Leonidas S Tzouvelekis; Danai Sofianou; Nicholas J Legakis; Antonios N Maniatis
Journal:  Emerg Infect Dis       Date:  2006-06       Impact factor: 6.883

View more
  21 in total

1.  Genotyping and molecular characterization of clinical Acinetobacter baumannii isolates from a single hospital in Southwestern Iran.

Authors:  Ahmad Farajzadeh Sheikh; Mohammad Savari; Effat Abbasi Montazeri; Saeed Khoshnood
Journal:  Pathog Glob Health       Date:  2020-06-19       Impact factor: 2.894

Review 2.  Metallo-β-Lactamases: Structure, Function, Epidemiology, Treatment Options, and the Development Pipeline.

Authors:  Sara E Boyd; David M Livermore; David C Hooper; William W Hope
Journal:  Antimicrob Agents Chemother       Date:  2020-09-21       Impact factor: 5.191

3.  High antibiotic resistance and mortality with Acinetobacter species in a tertiary hospital, Nepal.

Authors:  M Mahto; M Chaudhary; A Shah; K L Show; F L Moses; A G Stewart
Journal:  Public Health Action       Date:  2021-11-01

4.  Insights into mobile genetic elements and the role of conjugative plasmid in transferring aminoglycoside resistance in extensively drug-resistant Acinetobacter baumannii AB329.

Authors:  Supat Khongfak; Rapee Thummeepak; Udomluk Leungtongkam; Kannipa Tasanapak; Aunchalee Thanwisai; Sutthirat Sitthisak
Journal:  PeerJ       Date:  2022-07-13       Impact factor: 3.061

Review 5.  Structure, Genetics and Worldwide Spread of New Delhi Metallo-β-lactamase (NDM): a threat to public health.

Authors:  Asad U Khan; Lubna Maryam; Raffaele Zarrilli
Journal:  BMC Microbiol       Date:  2017-04-27       Impact factor: 3.605

6.  Frequency of 16S rRNA Methylase and Aminoglycoside-Modifying Enzyme Genes among Clinical Isolates of Acinetobacter baumannii in Iran.

Authors:  Mehrdad Gholami; Mohammadreza Haghshenas; Mona Moshiri; Shabnam Razavi; Abazar Pournajaf; Gholamreza Irajian; Mohsen Heidary
Journal:  Iran J Pathol       Date:  2017-10-01

7.  Molecular Study of Quinolone Resistance Determining Regions of gyrA Gene and parC Genes in Clinical Isolates of Acintobacter baumannii Resistant to Fluoroquinolone.

Authors:  Maysaa El Sayed Zaki; Nermen Abou ElKheir; Mohamed Mofreh
Journal:  Open Microbiol J       Date:  2018-04-30

8.  Molecular Detection of Carbapenemase-Encoding Genes in Multidrug-Resistant Acinetobacter baumannii Clinical Isolates in South Africa.

Authors:  Yaw Adjei Anane; Teke Apalata; Sandeep Vasaikar; Grace Emily Okuthe; Sandile Songca
Journal:  Int J Microbiol       Date:  2020-06-13

9.  Molecular Epidemiology of Extensively-Drug Resistant Acinetobacter baumannii Sequence Type 2 Co-Harboring bla NDM and bla OXA From Clinical Origin.

Authors:  Hasan Ejaz; Mahtab Ahmad; Sonia Younas; Kashaf Junaid; Khalid Omer Abdalla Abosalif; Abualgasim Elgaili Abdalla; Ayman Ali Mohammed Alameen; Mohammed Yagoub Mohammed Elamir; Syed Nasir Abbas Bukhari; Naveed Ahmad; Muhammad Usman Qamar
Journal:  Infect Drug Resist       Date:  2021-05-25       Impact factor: 4.003

10.  Overproduction of efflux pumps caused reduced susceptibility to carbapenem under consecutive imipenem-selected stress in Acinetobacter baumannii.

Authors:  Yanpeng Zhang; Zhuocheng Li; Xiaolong He; Fanglin Ding; Weiqing Wu; Yong Luo; Bing Fan; Hong Cao
Journal:  Infect Drug Resist       Date:  2018-03-29       Impact factor: 4.003

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.