Literature DB >> 28009256

Translation initiation by the hepatitis C virus IRES requires eIF1A and ribosomal complex remodeling.

Zane A Jaafar1, Akihiro Oguro2, Yoshikazu Nakamura2, Jeffrey S Kieft1,3.   

Abstract

Internal ribosome entry sites (IRESs) are important RNA-based translation initiation signals, critical for infection by many pathogenic viruses. The hepatitis C virus (HCV) IRES is the prototype for the type 3 IRESs and is also invaluable for exploring principles of eukaryotic translation initiation, in general. Current mechanistic models for the type 3 IRESs are useful but they also present paradoxes, including how they can function both with and without eukaryotic initiation factor (eIF) 2. We discovered that eIF1A is necessary for efficient activity where it stabilizes tRNA binding and inspects the codon-anticodon interaction, especially important in the IRES' eIF2-independent mode. These data support a model in which the IRES binds preassembled translation preinitiation complexes and remodels them to generate eukaryotic initiation complexes with bacterial-like features. This model explains previous data, reconciles eIF2-dependent and -independent pathways, and illustrates how RNA structure-based control can respond to changing cellular conditions.

Entities:  

Keywords:  Hepatitis C virus (HCV); biochemistry; eukaryotic initation factor 1A (eIF1A); eukaryotic initation factor 2 (eIF2); infectious disease; internal ribosome entry site (IRES); microbiology; translation initiation; virus

Mesh:

Substances:

Year:  2016        PMID: 28009256      PMCID: PMC5238962          DOI: 10.7554/eLife.21198

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Translation initiation requires a messenger RNA (mRNA) placed in the small ribosomal subunit’s decoding groove with the correct start codon paired to the anticodon of a charged initiator methionine tRNA (Met-tRNAiMet). In eukaryotes, the canonical process to accomplish this requires >12 eukaryotic translation initiation factor (eIF) proteins (Jackson et al., 2010). Briefly, after recognition of the N7-methylguanosine cap, a set of eIFs recruits the 43S complex that contains the 40S ribosomal subunit, the ternary complex (TC; this contains eIF2, GTP and Met-tRNAiMet) and several other eIFs. This is followed by eIF1- and eIF1A-dependent scanning of the mRNA, start codon identification, hydrolysis of GTP, release of many eIFs, and eIF5B-mediated 60S ribosomal subunit joining to form an 80S ribosome (Hinnebusch, 2011; Martin-Marcos et al., 2011; Pestova et al., 2000; Unbehaun et al., 2004). Translation initiation in eukaryotes can also occur by internal ribosome entry site (IRES) RNAs (Jackson, 2005). IRESs of viral origin use a subset or none of the eIFs and some bind directly to the ribosome (Filbin and Kieft, 2009; Thompson, 2012), thus positioning the start codon without a 5’ cap or scanning. IRESs are important in viral infection and are also key players in regulation of gene expression, but the full repertoire of strategies they use is not completely understood. Hepatitis C virus (HCV) contains one of the first discovered and characterized IRESs (Tsukiyama-Kohara et al., 1992) and is the prototype of the structurally similar type 3 viral IRESs, found in some Flaviviridae and Picornaviridae (Hellen and de Breyne, 2007). The HCV IRES forms an extended structure, containing two major structural domains (Figure 1—figure supplement 1A) (for review: Lukavsky, 2009; Fraser and Doudna, 2007). Domain III (dIII) is the largest and provides the affinity for direct binding to the 40S subunit and interactions with eIF3; it contains multiple stem-loop elements emerging from several junctions. Domain II (dII) is an extended stem-loop that docks on the 40S subunit in the vicinity of the E site. The various domains of the IRES work together to recruit the translation machinery and manipulate it to begin protein synthesis.
Figure 1—figure supplement 1.

HCV IRES structure and clash between HCV IRES domain II and eIF2.

(A) Secondary structure of the HCV IRES, with domains labeled. (B) Left: Cryo-EM reconstructions of human 40S subunit in complex with the HCV IRES (magenta, PDB: 5A2Q) Middle: yeast PIC in the open conformation (PDB: 3JAQ) with all factors but eIF2 (green) removed. Right: yeast PIC in closed conformation (PDB: 3JAP) and eIF2 (blue). (C) Steric clash between HCV IRES dII and eIF2.

DOI: http://dx.doi.org/10.7554/eLife.21198.003

Mechanistic models for HCV IRES-driven translation have been mostly developed using biochemical approaches with reconstituted systems (Ji et al., 2004; Nomoto et al., 1995; Otto et al., 2002; Pestova et al., 1998b; Sizova et al., 1998). These studies show that the HCV IRES RNA binds directly to the 40S subunit using several IRES structural domains (Kieft et al., 2001; Lytle et al., 2002, 2001), changing the subunit’s conformation (Spahn et al., 2001). The IRES also binds directly to eIF3 (Sizova et al., 1998), which along with the eIF2-containing TC have been described as capable of progressing the HCV IRES preinitiation complex (PIC) to an elongation-competent 80S ribosome (Pestova et al., 1998b). These and other studies have pointed to a mechanism in which a naked (unbound by factors) 40S subunit first binds directly to the IRES RNA through interactions with dIII (Ji et al., 2004; Otto and Puglisi, 2004), placing the start codon into the P site of the decoding groove, followed by recruitment of eIF3 by IRES subdomain IIIb (dIIIb) and association of the TC to position Met-tRNAiMet to form a 48S* complex (asterisk denotes noncanonical assembly and composition) (reviewed in: [Fraser and Doudna, 2007; Khawaja et al., 2015]). Although biochemical data suggest a step-wise recruitment of essential translation components, it has also been suggested that the first step in HCV IRES-driven translation could be binding to an assembled 43S PIC (40S pre-bound by other factors) (Berry et al., 2010; Hellen, 2009; Jackson et al., 2010). In both models, it is proposed that subsequent GTP hydrolysis by eIF2, directed by eIF5 and enhanced by IRES dII, induces factor release and subunit joining (Locker et al., 2007). Mutations to different parts of the HCV IRES inhibit specific steps in the pathway (Berry et al., 2010; Filbin and Kieft, 2011; Kieft et al., 2001; Sizova et al., 1998; Spahn et al., 2001) (reviewed in: [Khawaja et al., 2015; Lukavsky, 2009]), which is proposed to be similar in other type 3 IRESs (Kolupaeva et al., 2000; Pestova et al., 1998b; de Breyne et al., 2008). In addition, the HCV IRES can also initiate translation when eIF2 is inhibited by phosphorylation of its alpha subunit (Koev et al., 2002; Robert et al., 2006). Under these conditions, it is proposed that 40S subunit and eIF3 binding are followed by eIF2-independent delivery of Met-tRNAiMet facilitated by eIF5B (Terenin et al., 2008), or perhaps by less well-understood eIFs 2A or 2D (Dmitriev et al., 2010; Kim et al., 2011). These models for the HCV IRES mechanism provide important insight, but it is still not certain which of the two pathways outlined above is most valid, and several aspects of the mechanism remain unclear. First, although the 40S subunit, the eIF2-containing TC, and eIF3 have been deemed necessary and sufficient for IRES 48S* formation for some type 3 IRESs (under unstressed conditions), the inclusion of other eIFs in toeprinting experiments appears to affect the PIC formed on certain IRESs (Kolupaeva et al., 2000; Pestova et al., 1998b; de Breyne et al., 2008). Specifically, added eIF1 appeared to destabilize 48S PICs formed on the classical swine fever virus (CSFV) IRES (Pestova et al., 2008), and on the Simian picornavirus type 9 (SPV9) IRES this factor appears to alter the conformation of the PIC and destabilize tRNA binding (de Breyne et al., 2008). When eIF1A was added to reconstituted assembly reactions with the SPV9 IRES, it resulted in a toeprint consistent with 48S stabilization and stabilized binding of tRNA in the absence of eIF2 (de Breyne et al., 2008). However, the full mechanistic implications of these observations has not been fully explored. Next, recent cryo-EM structures of eukaryotic PICs (Llácer et al., 2015; Quade et al., 2015) show overlap between the binding site of eIF2 (within the TC) and HCV IRES dII on the 40S subunit (Figure 1—figure supplement 1B and C). This clash could be resolved by the fact that IRES dII can adopt other positions (Yamamoto et al., 2014), but still the position of the TC on the 40S subunit blocks access to the decoding groove. Thus, if the IRES bound a preassembled 43S complex it is not clear how the coding RNA would dock into the P site. There is also evidence that dII must be in position to help dock the coding RNA in position (Filbin and Kieft, 2011), but if the TC was bound, dII would be excluded from performing this role. These observations argue against a model in which the IRES recruits a 43S complex with the TC already bound. However, the alternate mechanism requires free 40S subunit and unbound eIF3, which is problematic because terminating ribosomes are quickly recycled to 43S complexes; 40S subunits and eIF3 may not exist in sufficient quantities to support this pathway (Asano et al., 2001). Finally, a recent cryo-EM structure of 40S subunit bound to eIF3 and part of a type 3 IRES (Classical Swine Fever Virus, CSFV) show eIF3 positioned in a different location compared to where it binds to the 40S subunit without this IRES (Hashem et al., 2013; des Georges et al., 2015; Simonetti et al., 2016). The interpretation of this observation depends in part on which of the two aforementioned models is correct. Does the IRES bind preassembled 43S complex and displace eIF3, or does it recruit free eIF3 in a noncanonical way? Finally, as mentioned above, the HCV IRES has the ability to operate when eIF2 is inactivated by phosphorylation of its alpha subunit, yet during infection HCV actively suppresses eIF2α phosphorylation (Garaigorta and Chisari, 2009; Vyas et al., 2003); why has the virus evolved an IRES capable of eIF2-independent initiation if that condition is suppressed during infection? And, which of the proposed eIF2-independent mechanisms is correct (eIF 5B-, 2A-, or 2D-dependent)? None of these questions invalidate previous studies, but they illustrate that our understanding of HCV IRES (and other type 3 IRES) function is incomplete. As these IRESs are found in medically and economically important pathogens, they raise possibilities as drug targets (Davis and Seth, 2010; Dibrov et al., 2012; Hermann, 2016) and are useful tools for exploring both IRES function and fundamental principles of translation initiation, so it is important that we fully understand how they work. Therefore, we re-examined the mechanism used by the HCV IRES with approaches designed to complement previous biochemical and structural studies. We discovered that in addition to previously reported factors, eIF1A is also needed for full HCV IRES activity. Our results suggest that eIF1A is in part responsible for the stability of Met-tRNAiMet binding to IRES-bound ribosomes and acts to recognize the docked HCV IRES AUG start codon. Integrating our results with published data, we present a revised and updated mechanistic model for HCV IRES-driven translation in which the IRES exploits and remodels a naturally occurring ‘pre-43S’ complex created during ribosome recycling, generating a PIC whose composition and function shares features with the bacterial mode of initiation. Our proposed model is consistent with previous studies, helps to answer some of the aforementioned questions, and reconciles competing mechanisms for HCV IRES function in both eIF2-dependent and -independent modes.

Results

Translation preinitiation complexes assembled on the HCV IRES contain eIF1A

As a first step, we re-examined the factors present in HCV IRES-assembled PICs using a pull-down approach with biotinylated and immobilized IRES RNA. Rather than reconstituting PIC assembly with purified components, we incubated the RNA in lysate from Huh 7.5 (human hepatoma) cells to replicate cellular conditions and then used antibodies to detect bound 43S complex components eIFs 3, 2, 1A, 1 and 40S subunit (protein rpS6) (Figure 1A). The factor-independent Cricket Paralysis Virus (CrPV) intergenic region (IGR) IRES served as a control (Wilson et al., 2000). Visual examination of the blot shows that as expected, the CrPV IGR IRES bound 40S subunit but not any initiation factors. The WT HCV IRES pulled down eIF2 and eIF3 as expected, and also eIF1A, but not eIF1. A control HCV IRES mutant lacking affinity for the 40S subunit (Kieft et al., 2001), and with severely diminished translation initiation activity (dIIId_GGG-CCC; Figure 1B and C), did not bind 40S subunit, eIF1A, or eIF2 and showed decreased binding of eIF3 (Figure 1A). These results thus establish the specificity and validity of our pull-down approach. We next examined the effect of mutating important HCV IRES subdomains on factor binding (Figure 1B–D). To augment visual examination, we quantitated blots from multiple experiments using bound rpS6 for normalization. Disruption of domain IIIb is known to decrease IRES affinity for eIF3 and translation initiation activity (Buratti et al., 1998; Sizova et al., 1998); as expected, mutant dIIIb_trunc decreases the amount of eIF3 pulled down. Removing dIIdII) or altering its apical loop (dIIb_ΔGCC) is known to affect PIC formation by changing 40S conformation, inhibiting the proper loading of coding RNA in the decoding groove and decreasing overall translation efficiency (Filbin and Kieft, 2011; Locker et al., 2007; Pestova et al., 2008); as expected they show little or no decrease in bound eIFs 2 and 3. Examining the effect of these mutations on eIF1A binding, both dIIIb_trunc and dIIb_ΔGCC had only a small decease in bound eIF1A, while ΔdII showed a greater decrease. Although both these mutants alter the conformation of the 40S subunit, they do so in different ways and have different functional effects (Spahn et al., 2001; Filbin et al., 2013); the difference in eIF1A binding to PICs formed on ΔdII compared to dIIb_ΔGCC may reflect this. Overall, these results show that the binding of eIFs depends on IRES binding to the 40S subunit and the effect of these mutations on the binding of eIFs 2 and 3 is consistent with published biochemical studies. Furthermore, these results also suggest that eIF1A is present on these complexes because it associates with the 40S subunit and that the IRES plays some role in its binding stability, suggesting it may be an important functional part of the HCV IRES-assembled PIC.
Figure 1.

Analysis of HCV IRES preinitiation complex composition, formed in lysate.

(A) Results of pull-down experiments. HCV IRES was 5’ biotinylated and immobilized on ’ streptavidin agarose beads. Factors and subunits that bound to the IRES after incubation in lysate were detected by western blot analysis. Lane 1: Input lysate. Lane 2: streptavidin beads only. Lane 3: CrPV IGR IRES RNA control. Lane 4: WT HCV IRES RNA. Lane 5: HCV IRES mutant dIIId_GGG-CCC. (B) Secondary structure cartoon of the HCV IRES RNA, with the location of mutations indicated. (C) Translation initiation activity of the HCV IRES, WT and mutants, with RNA transfections of Huh 7.5 cells. Error bars represent averages ±SEM of ≥3 independent experiments. (D) Pull-downs as in panel (A) with HCV IRES mutants shown in panel (B). Blots were quantitated by densitometry, and the intensity of each eIF band was normalized to the rpS6 band. Graph shows the average of three independent experiments with the amount of each eIF bound to WT set to 1. Error bars represent one standard error from the mean. (E) Pull-downs as in panel (A) with truncated HCV IRESs. Cartoon diagrams of these three truncations are shown, as is the portion of the IRES in which these truncations were made. Visual examination shows a similar qualitative pattern. (F) Pull-downs as in panel (A) with the IRESs from CSFV and SPV-1, along with corresponding secondary structure cartoons.

DOI: http://dx.doi.org/10.7554/eLife.21198.002

(A) Secondary structure of the HCV IRES, with domains labeled. (B) Left: Cryo-EM reconstructions of human 40S subunit in complex with the HCV IRES (magenta, PDB: 5A2Q) Middle: yeast PIC in the open conformation (PDB: 3JAQ) with all factors but eIF2 (green) removed. Right: yeast PIC in closed conformation (PDB: 3JAP) and eIF2 (blue). (C) Steric clash between HCV IRES dII and eIF2.

DOI: http://dx.doi.org/10.7554/eLife.21198.003

Analysis of HCV IRES preinitiation complex composition, formed in lysate.

(A) Results of pull-down experiments. HCV IRES was 5’ biotinylated and immobilized on ’ streptavidin agarose beads. Factors and subunits that bound to the IRES after incubation in lysate were detected by western blot analysis. Lane 1: Input lysate. Lane 2: streptavidin beads only. Lane 3: CrPV IGR IRES RNA control. Lane 4: WT HCV IRES RNA. Lane 5: HCV IRES mutant dIIId_GGG-CCC. (B) Secondary structure cartoon of the HCV IRES RNA, with the location of mutations indicated. (C) Translation initiation activity of the HCV IRES, WT and mutants, with RNA transfections of Huh 7.5 cells. Error bars represent averages ±SEM of ≥3 independent experiments. (D) Pull-downs as in panel (A) with HCV IRES mutants shown in panel (B). Blots were quantitated by densitometry, and the intensity of each eIF band was normalized to the rpS6 band. Graph shows the average of three independent experiments with the amount of each eIF bound to WT set to 1. Error bars represent one standard error from the mean. (E) Pull-downs as in panel (A) with truncated HCV IRESs. Cartoon diagrams of these three truncations are shown, as is the portion of the IRES in which these truncations were made. Visual examination shows a similar qualitative pattern. (F) Pull-downs as in panel (A) with the IRESs from CSFV and SPV-1, along with corresponding secondary structure cartoons. DOI: http://dx.doi.org/10.7554/eLife.21198.002

HCV IRES structure and clash between HCV IRES domain II and eIF2.

(A) Secondary structure of the HCV IRES, with domains labeled. (B) Left: Cryo-EM reconstructions of human 40S subunit in complex with the HCV IRES (magenta, PDB: 5A2Q) Middle: yeast PIC in the open conformation (PDB: 3JAQ) with all factors but eIF2 (green) removed. Right: yeast PIC in closed conformation (PDB: 3JAP) and eIF2 (blue). (C) Steric clash between HCV IRES dII and eIF2. DOI: http://dx.doi.org/10.7554/eLife.21198.003 During canonical eukaryotic scanning-dependent initiation, eIF1A is important in AUG start codon recognition, interacting with mRNA in the decoding groove. Therefore, we tested whether eIF1A’s association with HCV IRES PICs depends on the presence of RNA in the decoding groove (Figure 1E). 3’ truncations of the HCV IRES RNA to nucleotide (nt) 344 (3_344; ends after the ‘AUG’ in the P site), and to nt 330 (3_330; contains no RNA in decoding groove) did not qualitatively change the pattern of factor binding compared to an IRES with 10 codons downstream of the start AUG (3_372) based on a visual examination. This is consistent with eIF1A being recruited through 40S subunit binding to the IRES and not by the protein-coding portion of the IRES RNA. The presence of eIF1A in HCV IRES PICs led us to test two other type 3 IRESs for eIF1A binding: the aforementioned CSFV IRES and the simian picornavirus type-1 (SPV-1) IRES. eIF1A associates with these IRESs and as with HCV, there is no binding of eIF1 (Figure 1F). However, a visual inspection reveals interesting differences in the amount of eIF1A pulled down by these IRESs, hinting at differential use of this factor. These results further support the conclusions that eIF1A is recruited to these IRES PICs through the 40S subunit and that IRES RNAs modulate the stability of eIF1A binding.

IRES translation depends on the presence of eIF1A

Previous studies using reconstituted PIC assembly assays monitored by toeprinting revealed that eIF1A (in the presence of eIF2, 3, and/or 5B) may only moderately enhance the stability of, and is dispensable for, 48S or 80S complex assembly on type 3 IRESs; but, any stabilizing function of eIF1A is completely negated by concurrent addition of eIF1 (Fraser et al., 2009; de Breyne et al., 2008; Pestova et al., 2008). As a result, eIF1A has not been considered part of the set of factors necessary and sufficient for HCV IRES function (Fraser and Doudna, 2007). Indeed, one explanation for the presence of eIF1A on HCV IRES PICs is that it is associated with the 40S subunit as an artifact of ribosome recycling, perhaps associated with eIF3 (Pisarev et al., 2007), and thus has no functional role in HCV IRES initiation. We explored eIF1A’s functional importance using an RNA aptamer (α-eIF1A) that removes eIF1A from initiation complexes (Figure 2A), generated in a manner similar to an eIF4G-binding aptamer (Miyakawa et al., 2006). The aptamer was validated using surface plasmon resonance and RNA-protein binding experiments (Figure 2—figure supplement 1). To verify that the aptamer could deplete eIF1A from lysate, we performed a pull-down similar to that shown in Figure 1 using lysate pretreated with either an anti-sense (AS) negative control aptamer or with α-eIF1A. Visual examination of the blot shows that treatment with aptamer did not affect 40S subunit binding to the IRES but significantly reduced the amount of eIF1A bound (Figure 2B). This effect was specific, as binding of eIFs 2 and 3 were not affected, and eIF1 remained unbound (Figure 2B). Aptamer treatment also reduced eIF1A binding on the CSFV and SPV-1 IRESs, although in the latter case the amount of bound eIF1A is already low, as noted above (Figure 1F). There is also visible reduction in protein levels from both cap-driven (Rluc) and HCV IRES-driven (CAT) ORFs of a bicistronic reporter using rabbit reticulocyte lysate (RRL) treated with α-eIF1A compared to lysates treated with control RNAs (Figure 2C). This result preliminarily suggested that in this lysate the HCV IRES requires eIF1A for full function. To more fully test the functional importance of eIF1A, we used firefly luciferase (Fluc)-based monocistronic reporters (Figure 2D) in quantitative translation assays in both RRL and human cell (HeLa) lysate. Treatment of RRL (Figure 2E) or HeLa cell lysate (Figure 2F) with α-eIF1A decreased translation of a capped reporter compared to treatment with AS, while CrPV IRES-driven translation either did not change or increased with eIF1A depletion. The behavior of these controls is expected, as cap-dependent translation requires eIF1A, while the CrPV IRES is known to be eIF-independent. Examination of the effect of eIF1A depletion on HCV, CSFV, and SPV-1 IRESs revealed variation in the functional requirement for eIF1A in all three. In RRL, all three IRESs showed a decrease in translation with aptamer treatment, with the SPV-1 IRES showing the least and HCV showing the most (Figure 2G). In HeLa cell lysate, eIF1A depletion reduced translation initiation by the HCV and CSFV IRESs, but not the SPV-1 IRES (Figure 2H). It is noteworthy that in the case of the HeLa lysate, the dependence on eIF1A correlates with the amount of eIF1A pulled down (Figure 1F). Specifically, CSFV appears especially sensitive to eIF1A depletion, and it pulled down more eIF1A than did the SPV-1 IRES, which is more refractive to eIF1A depletion. Again, this hints at some mechanistic variability between these related IRESs.
Figure 2.

An RNA aptamer targeting eIF1A for inactivation negatively affects both cap- and IRES-driven translation in lysate.

(A) Sequence and predicted secondary structure of the α-eIF1A aptamer used in this study. (B) Top: Results of pull-down experiment with the HCV IRES (similar to Figure 1), showing substantial depletion of eIF1A with aptamer treatment compared to negative control antisense (AS) aptamer RNA. Bottom: Pull-down experiments with several IRES RNAs, with blotting to detect eIFs that should not be removed or depleted by the aptamer. (C) 35S-Met labeling of translation products in RRL using a dual-reporter mRNA template. The aptamer treatment reduces protein levels over time from IRES-driven (CAT) and cap-driven (Rluc) messages. The effect of apatamer (+ apt) addition is shown compared to the addition of no RNA or a randomized 40 nucleotide RNA (+ N40). (D) Diagram of monocistronic reporters used in the experiments of panels (E–H). (E) Results of translation assays in RRL using reporter RNAs. The level of each RNA in untreated lysate is set at 100% and the effect of aptamer treatment is reported as a percentage of that for each RNA. Capped (Cap) RNA is the positive control and the CrPV IRES is the negative control for a requirement for eIF1A. (F) Identical to panel (E) but assayed in HeLa cell extract. (G) Translation assays in RRL using reporter RNAs with the HCV, CSFV, and SPV-1 IRESs. Cap is included as a control. (H) Identical to panel (G) but assayed in HeLa cell extract. In panels (E–H), error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001.

DOI: http://dx.doi.org/10.7554/eLife.21198.004

(A) Binding profiles of the eIF1A aptamer using surface plasmon resonance. The aptamer RNA (apt) or the ‘N40’ random sequence RNA was immobilized on a sensor chip for Biacore2000 analysis. eIF1A solution was prepared and was injected at time 0 for 120 s. From the fitting of these sensorgrams by the instrument software BIAevaluation, the dissociation constant (Kd) of the aptamer-eIF1A interaction was estimated as 5.2 nM. (B) Pulldown assay of translation factors bound to eIF1A. The following samples were loaded on each lane: lane 1, 1 μl of HeLa cell extract; lane 2, coprecipitated sample by Ni-NTA agarose; lane 3, coprecipitated sample by Ni-NTA agarose with His-CAT; and lane 4, coprecipitated sample by Ni-NTA agarose with 6XHis-eIF1A. Separated and transferred proteins are detected by Western blotting using antibodies against eIF3 p66, eIF3 p110, rpS6, eIF2α and eIF2β (from upper to lower). These proteins bound with eIF1A specifically. (C) Pull-down assay from HeLa cell extracts using Ni-NTA agarose and 6XHis-eIF1A, with 0.3, 1, 3 or 10 μM N40 random RNA (N40) or 0.3, 1, 3 or 10 μM aptamer (labeled). Two components of eIF3, p66 and p110, plus rpS6, eIF2α and eIF2β bound to eIF1A. When aptamer was added to this pull-down reaction, the precipitation of eIF3 components and rpS6 was reduced, suggesting that the aptamer blocked the interaction of eIF1A with eIF3 and rpS6.

DOI: http://dx.doi.org/10.7554/eLife.21198.005

Figure 2—figure supplement 1.

Validation of α-eIF1A aptamer.

(A) Binding profiles of the eIF1A aptamer using surface plasmon resonance. The aptamer RNA (apt) or the ‘N40’ random sequence RNA was immobilized on a sensor chip for Biacore2000 analysis. eIF1A solution was prepared and was injected at time 0 for 120 s. From the fitting of these sensorgrams by the instrument software BIAevaluation, the dissociation constant (Kd) of the aptamer-eIF1A interaction was estimated as 5.2 nM. (B) Pulldown assay of translation factors bound to eIF1A. The following samples were loaded on each lane: lane 1, 1 μl of HeLa cell extract; lane 2, coprecipitated sample by Ni-NTA agarose; lane 3, coprecipitated sample by Ni-NTA agarose with His-CAT; and lane 4, coprecipitated sample by Ni-NTA agarose with 6XHis-eIF1A. Separated and transferred proteins are detected by Western blotting using antibodies against eIF3 p66, eIF3 p110, rpS6, eIF2α and eIF2β (from upper to lower). These proteins bound with eIF1A specifically. (C) Pull-down assay from HeLa cell extracts using Ni-NTA agarose and 6XHis-eIF1A, with 0.3, 1, 3 or 10 μM N40 random RNA (N40) or 0.3, 1, 3 or 10 μM aptamer (labeled). Two components of eIF3, p66 and p110, plus rpS6, eIF2α and eIF2β bound to eIF1A. When aptamer was added to this pull-down reaction, the precipitation of eIF3 components and rpS6 was reduced, suggesting that the aptamer blocked the interaction of eIF1A with eIF3 and rpS6.

DOI: http://dx.doi.org/10.7554/eLife.21198.005

An RNA aptamer targeting eIF1A for inactivation negatively affects both cap- and IRES-driven translation in lysate.

(A) Sequence and predicted secondary structure of the α-eIF1A aptamer used in this study. (B) Top: Results of pull-down experiment with the HCV IRES (similar to Figure 1), showing substantial depletion of eIF1A with aptamer treatment compared to negative control antisense (AS) aptamer RNA. Bottom: Pull-down experiments with several IRES RNAs, with blotting to detect eIFs that should not be removed or depleted by the aptamer. (C) 35S-Met labeling of translation products in RRL using a dual-reporter mRNA template. The aptamer treatment reduces protein levels over time from IRES-driven (CAT) and cap-driven (Rluc) messages. The effect of apatamer (+ apt) addition is shown compared to the addition of no RNA or a randomized 40 nucleotide RNA (+ N40). (D) Diagram of monocistronic reporters used in the experiments of panels (E–H). (E) Results of translation assays in RRL using reporter RNAs. The level of each RNA in untreated lysate is set at 100% and the effect of aptamer treatment is reported as a percentage of that for each RNA. Capped (Cap) RNA is the positive control and the CrPV IRES is the negative control for a requirement for eIF1A. (F) Identical to panel (E) but assayed in HeLa cell extract. (G) Translation assays in RRL using reporter RNAs with the HCV, CSFV, and SPV-1 IRESs. Cap is included as a control. (H) Identical to panel (G) but assayed in HeLa cell extract. In panels (E–H), error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. DOI: http://dx.doi.org/10.7554/eLife.21198.004

Validation of α-eIF1A aptamer.

(A) Binding profiles of the eIF1A aptamer using surface plasmon resonance. The aptamer RNA (apt) or the ‘N40’ random sequence RNA was immobilized on a sensor chip for Biacore2000 analysis. eIF1A solution was prepared and was injected at time 0 for 120 s. From the fitting of these sensorgrams by the instrument software BIAevaluation, the dissociation constant (Kd) of the aptamer-eIF1A interaction was estimated as 5.2 nM. (B) Pulldown assay of translation factors bound to eIF1A. The following samples were loaded on each lane: lane 1, 1 μl of HeLa cell extract; lane 2, coprecipitated sample by Ni-NTA agarose; lane 3, coprecipitated sample by Ni-NTA agarose with His-CAT; and lane 4, coprecipitated sample by Ni-NTA agarose with 6XHis-eIF1A. Separated and transferred proteins are detected by Western blotting using antibodies against eIF3 p66, eIF3 p110, rpS6, eIF2α and eIF2β (from upper to lower). These proteins bound with eIF1A specifically. (C) Pull-down assay from HeLa cell extracts using Ni-NTA agarose and 6XHis-eIF1A, with 0.3, 1, 3 or 10 μM N40 random RNA (N40) or 0.3, 1, 3 or 10 μM aptamer (labeled). Two components of eIF3, p66 and p110, plus rpS6, eIF2α and eIF2β bound to eIF1A. When aptamer was added to this pull-down reaction, the precipitation of eIF3 components and rpS6 was reduced, suggesting that the aptamer blocked the interaction of eIF1A with eIF3 and rpS6. DOI: http://dx.doi.org/10.7554/eLife.21198.005 eIF1A has N-terminal and C-terminal tails that perform important roles in start codon selection and TC delivery (Fekete et al., 2007; Saini et al., 2010; Acker et al., 2006; Maag et al., 2006). To explore the roles of these tails and to ensure that aptamer treatment was not affecting translation in ways unrelated to eIF1A, we developed a depletion and add-back experimental system using the α-eIF1A aptamer (Figure 2A), purified recombinant full-length and truncated eIF1A, and dual luciferase reporters (Figure 3A and Figure 3—figure supplement 1A). Cap-driven translation and the CrPV IRES controls showed dependence on eIF1A as with monocistronic reporters; adding recombinant full-length eIF1A to the α-eIF1A-treated RRL restored much of the cap-dependent translation activity and returned the CrPV IRES to untreated levels (Figure 3B). Addition of eIF1A lacking the unstructured N-terminal tail (ΔNTT) increased cap-dependent translation in the absence of aptamer treatment (Figure 3—figure supplement 1B), perhaps because some mutations to the NTT of eIF1A in yeast exhibit a ‘hyper-accurate’ phenotype that could support increased translation from a reporter mRNA like the one we use in these studies (Fekete et al., 2007). Addition of eIF1A with the C-terminal tail deleted (ΔCTT) virtually abolished translation for all initiation mechanisms tested (Figure 3—figure supplement 1C). This truncation is expected to enhance the eIF1A-40S subunit interaction (Maag et al., 2006; Fekete et al., 2007) and may inhibit translation by competing with WT eIF1A and preventing eIF5B-mediated release after subunit joining (Fringer et al., 2007; Acker et al., 2006). Overall, these results validate this eIF1A depletion and add-back system. Applying this approach to translation assays with different type 3 IRESs (Figure 3C), we observed that the diminished HCV IRES activity in eIF1A-depleted lysate was partially restored by add-back of full-length or ΔNTT eIF1A, similar to cap-driven translation. The CSFV IRES did not respond as well to the add-back of full-length eIF1A, but showed more recovery with added ΔNTT eIF1A. As noted above, the SPV-1 IRES was generally less sensitive to eIF1A depletion and consistent with this, add-back of eIF1A had a minimal effect. Interestingly, while addition of ΔNTT eIF1A fully restored translation on capped messages, it only partially restored activity with all the IRESs tested; the significance of this is not clear. The degree to which addition of eIF1A to depleted lysates restores translation roughly tracked with dependence on eIF1A.
Figure 3.

eIF1A depletion inhibits translation from the HCV IRES.

(A) Cartoon showing design of bicistronic dual-luciferase reporter constructs used in the experiments of panels (B–C). (B) Effect of depletion of eIF1A using the aptamer followed by add-back of WT full-length eIF1A (WT) or an N-terminally truncated mutant (ΔNTT) on translation from the reporter shown in panel (A). Experiments were done in RRL. This panel shows the effect on the Rluc (Cap) and a control CrPV IRES. (C) Same as panel (B) but with WT HCV, CSFV, and SPV-1 IRESs, plus two HCV IRES mutants shown in Figure 1B. For panels (B and C), activity in lysate treated with AS control aptamer was set at 100%. Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001.

DOI: http://dx.doi.org/10.7554/eLife.21198.006

(A) Recombinantly expressed and purified WT, N-terminally truncated (ΔNTT), and C-terminally truncated (ΔCTT) human eIF1A shown on a Coomassie-stained SDS-PAGE gel. (B) Translation assays in RRL using a cap-driven message (Figure 3A) with or without the addition of ΔNTT, without aptamer treatment. (C) Translation assays in RRL showing potent translation inhibition by adding ΔCTT. Monocistronic reporters with cap-, CrPV IRES-, or HCV IRES-driven translation are shown. Translation level is shown as raw light units from Fluc. Error bars represent averages ±SEM of ≥3 independent experiments.

DOI: http://dx.doi.org/10.7554/eLife.21198.007

Figure 3—figure supplement 1.

Purity of WT and mutant eIF1A and effects in untreated lysate.

(A) Recombinantly expressed and purified WT, N-terminally truncated (ΔNTT), and C-terminally truncated (ΔCTT) human eIF1A shown on a Coomassie-stained SDS-PAGE gel. (B) Translation assays in RRL using a cap-driven message (Figure 3A) with or without the addition of ΔNTT, without aptamer treatment. (C) Translation assays in RRL showing potent translation inhibition by adding ΔCTT. Monocistronic reporters with cap-, CrPV IRES-, or HCV IRES-driven translation are shown. Translation level is shown as raw light units from Fluc. Error bars represent averages ±SEM of ≥3 independent experiments.

DOI: http://dx.doi.org/10.7554/eLife.21198.007

eIF1A depletion inhibits translation from the HCV IRES.

(A) Cartoon showing design of bicistronic dual-luciferase reporter constructs used in the experiments of panels (B–C). (B) Effect of depletion of eIF1A using the aptamer followed by add-back of WT full-length eIF1A (WT) or an N-terminally truncated mutant (ΔNTT) on translation from the reporter shown in panel (A). Experiments were done in RRL. This panel shows the effect on the Rluc (Cap) and a control CrPV IRES. (C) Same as panel (B) but with WT HCV, CSFV, and SPV-1 IRESs, plus two HCV IRES mutants shown in Figure 1B. For panels (B and C), activity in lysate treated with AS control aptamer was set at 100%. Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. DOI: http://dx.doi.org/10.7554/eLife.21198.006

Purity of WT and mutant eIF1A and effects in untreated lysate.

(A) Recombinantly expressed and purified WT, N-terminally truncated (ΔNTT), and C-terminally truncated (ΔCTT) human eIF1A shown on a Coomassie-stained SDS-PAGE gel. (B) Translation assays in RRL using a cap-driven message (Figure 3A) with or without the addition of ΔNTT, without aptamer treatment. (C) Translation assays in RRL showing potent translation inhibition by adding ΔCTT. Monocistronic reporters with cap-, CrPV IRES-, or HCV IRES-driven translation are shown. Translation level is shown as raw light units from Fluc. Error bars represent averages ±SEM of ≥3 independent experiments. DOI: http://dx.doi.org/10.7554/eLife.21198.007 We tested two HCV IRES mutants previously shown to negatively affect translation to determine their sensitivity to eIF1A depletion and addition. The aforementioned dIIb_ ΔGCC mutant (activity is ~40% of WT, Figure 1C) is defective in docking coding RNA into the decoding groove (Filbin and Kieft, 2011); it showed some decreased activity with eIF1A depletion but was insensitive to the add-back of eIF1A. This preliminarily suggests that eIF1A’s role involves positioning or recognizing RNA in the decoding groove. We therefore tested a mutant with the start AUG mutated to a CUG (AUG-CUG). Start codon mutants are often quite deleterious to translation, but in type 3 IRESs most start codon changes are tolerated to a degree that they allow translation at ~30–50% of wild-type (Reynolds et al., 1995). Consistent with this, we observed a decrease to ~50% with mutant AUG-CUG (Figure 1C). Interestingly, this mutant’s activity was enhanced by the depletion of eIF1A but then decreased with add-back of either full-length eIF1A or the ΔNTT mutant (Figure 3C). Overall, these data suggest that eIF1A function on the HCV IRES (and other type 3 IRESs) involves recognition of RNA in the decoding groove, likely inspecting the AUG codon and its pairing with the anticodon of Met-tRNAiMet. These are similar duties to those performed by eIF1A during scanning-dependent start codon selection on canonical mRNAs.

HCV IRES RNA manipulates preassembled PICs and stabilizes eIF1A binding

The presence and importance of eIF1A on HCV IRES PICs and the fact that eIF1A binds through 40S subunit recruitment supports a mechanistic model in which the IRES binds to preassembled PICs. To explore this further, we developed an approach to recapitulate this type of recruitment event (Figure 4—figure supplement 1A). Briefly, we purified ‘native’ 40S subunit-containing PICs from lysate, incubated them with HCV IRES RNAs, and then these reactions were resolved by sucrose-gradient ultracentrifugation to separate the resultant HCV IRES PICs from factors released upon IRES binding. By examining both the bound and released factor pools, we detected changes in the PICs due to IRES RNA binding. In addition, to explore how stress conditions (and resultant eIF2α phosphorylation) affect these recruitment events, we conducted this experiment both with PICs purified from unstressed cells and from cells treated with DTT, a reductive stressor that leads to robust eIF2α phosphorylation (Figure 4—figure supplement 1B). PICs from unstressed 293F cells without added IRES contain eIFs 3, 2, and 1A but little or no 5B, as expected (Figure 4A, lane 1). There was some loss of all factors from the complex during the centrifugation analysis step (Figure 4A, lane 7), with eIF1 the most labile. PICs from stressed cells showed a similar pattern but with dramatic reduction in bound eIF2 (Figure 4B, lane 1). There was no phosphorylated eIF2α bound, as expected (Figure 4—figure supplement 1C). We verified that the use of these stressors and induced eIF2α had the expected effect on translation using luciferase reporter mRNAs with cap, eIF2-dependent and independent IRESs, observing the expected changes in translation activity (Figure 4—figure supplement 1D and E). These results suggest this approach was valid for examining the effect of HCV IRES binding to preassembled PICs. Quantification of western blot data from multiple experiments is contained in Figure 4—source data 1.
Figure 4—figure supplement 1.

Experimental protocol for analysis of HCV IRES remodeling of natively purified PICs.

(A) Diagram of the PIC preparation strategy and experiment to analyze bound and released factors. (B) Western blot showing effective phosphorylation of eIF2α (p-2α) with both thapsigargin and DTT treatments. (C) Western blot analysis showing the presence of eIF2 in the three PIC preparations presented in Figure 4A,B and D. Inactive, phosphorylated eIF2α did not co-purify with these complexes. (D) Diagram of bicistronic reporter construct and translation activity in Huh 7.5 cells from two control IRESs: The eIF2-independent cricket paralysis virus (CrPV) intergenic region (IGR) IRES, and the eIF2-dependent encephalomyocarditis virus (EMCV) IRES. Treatment of the cells with thapsigargin induced eIF2α phosphorylation and reduced EMCV IRES-dependent translation, while the CrPV IGR IRES retained activity. For each construct, unstressed cap (black) and unstressed IRES (grey) activities are normalized to 100%. Error bars represent averages ±SEM of ≥3 independent experiments. (E) Translation initiation activity of the HCV IRES (compared to cap-driven translation) in Huh 7.5 cells, comparing stress induced by thapsigargin and DTT. Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. (F) Natively purified PICs from unstressed HeLa cells, analyzed for the effect of HCV IRES binding, as in Figure 4A.

DOI: http://dx.doi.org/10.7554/eLife.21198.010

Figure 4.

HCV IRES binding alters natively purified PICs into complexes suited for IRES-driven translation.

(A, B, and D) Results of the experimental protocol shown in Figure 4—figure supplement 1. Natively purified 40S subunit-containing complexes were challenged with WT HCV IRES, then the composition of the complex (bound to 40S) and the factors released (released from 40S) were analyzed using western blot analysis. Panel (A): PICs from unstressed 293F cells. Panel (B): PICs from 293F cells stressed with dithiothreitol (DTT). Panel (D): PICs from unstressed cells incubated with non-hydrolyzable GTP analog GMP-PNP. (C) 80S ribosome formation on radiolabeled β-globin leader or HCV IRES in treated 293F lysate either untreated or treated with GMP-PNP. Reactions were fractionated by ultracentrifugation through a sucrose gradient. Total radioactivity per fraction is plotted. (E) Translation from bicistronic reporter mRNA (Figure 3A) containing WT or mutant HCV IRES, used to transfect Huh 7.5 cells that were left untreated (H2O control) or pretreated with DTT. Translation of Fluc is plotted relative to translation of WT HCV IRES reporter in unstressed cells (set to 100%). Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001.

DOI: http://dx.doi.org/10.7554/eLife.21198.008

Tables containing quantified band intensities from blots resulting from multiple biological replicates (n = 3). Blots were quantitated by densitometry, and the intensity of each eIF band was normalized to the rpS6 band. Graph shows the average of three independent experiments with the amount of each eIF bound to 40S subunit in the presence of WT HCV IRES set to 1. Errors represent one standard error from the mean. ND = not detectable.

DOI: http://dx.doi.org/10.7554/eLife.21198.009

(A) Diagram of the PIC preparation strategy and experiment to analyze bound and released factors. (B) Western blot showing effective phosphorylation of eIF2α (p-2α) with both thapsigargin and DTT treatments. (C) Western blot analysis showing the presence of eIF2 in the three PIC preparations presented in Figure 4A,B and D. Inactive, phosphorylated eIF2α did not co-purify with these complexes. (D) Diagram of bicistronic reporter construct and translation activity in Huh 7.5 cells from two control IRESs: The eIF2-independent cricket paralysis virus (CrPV) intergenic region (IGR) IRES, and the eIF2-dependent encephalomyocarditis virus (EMCV) IRES. Treatment of the cells with thapsigargin induced eIF2α phosphorylation and reduced EMCV IRES-dependent translation, while the CrPV IGR IRES retained activity. For each construct, unstressed cap (black) and unstressed IRES (grey) activities are normalized to 100%. Error bars represent averages ±SEM of ≥3 independent experiments. (E) Translation initiation activity of the HCV IRES (compared to cap-driven translation) in Huh 7.5 cells, comparing stress induced by thapsigargin and DTT. Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. (F) Natively purified PICs from unstressed HeLa cells, analyzed for the effect of HCV IRES binding, as in Figure 4A.

DOI: http://dx.doi.org/10.7554/eLife.21198.010

HCV IRES binding alters natively purified PICs into complexes suited for IRES-driven translation.

(A, B, and D) Results of the experimental protocol shown in Figure 4—figure supplement 1. Natively purified 40S subunit-containing complexes were challenged with WT HCV IRES, then the composition of the complex (bound to 40S) and the factors released (released from 40S) were analyzed using western blot analysis. Panel (A): PICs from unstressed 293F cells. Panel (B): PICs from 293F cells stressed with dithiothreitol (DTT). Panel (D): PICs from unstressed cells incubated with non-hydrolyzable GTP analog GMP-PNP. (C) 80S ribosome formation on radiolabeled β-globin leader or HCV IRES in treated 293F lysate either untreated or treated with GMP-PNP. Reactions were fractionated by ultracentrifugation through a sucrose gradient. Total radioactivity per fraction is plotted. (E) Translation from bicistronic reporter mRNA (Figure 3A) containing WT or mutant HCV IRES, used to transfect Huh 7.5 cells that were left untreated (H2O control) or pretreated with DTT. Translation of Fluc is plotted relative to translation of WT HCV IRES reporter in unstressed cells (set to 100%). Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. DOI: http://dx.doi.org/10.7554/eLife.21198.008

Quantified blot data supporting Figure 4A–D.

Tables containing quantified band intensities from blots resulting from multiple biological replicates (n = 3). Blots were quantitated by densitometry, and the intensity of each eIF band was normalized to the rpS6 band. Graph shows the average of three independent experiments with the amount of each eIF bound to 40S subunit in the presence of WT HCV IRES set to 1. Errors represent one standard error from the mean. ND = not detectable. DOI: http://dx.doi.org/10.7554/eLife.21198.009

Experimental protocol for analysis of HCV IRES remodeling of natively purified PICs.

(A) Diagram of the PIC preparation strategy and experiment to analyze bound and released factors. (B) Western blot showing effective phosphorylation of eIF2α (p-2α) with both thapsigargin and DTT treatments. (C) Western blot analysis showing the presence of eIF2 in the three PIC preparations presented in Figure 4A,B and D. Inactive, phosphorylated eIF2α did not co-purify with these complexes. (D) Diagram of bicistronic reporter construct and translation activity in Huh 7.5 cells from two control IRESs: The eIF2-independent cricket paralysis virus (CrPV) intergenic region (IGR) IRES, and the eIF2-dependent encephalomyocarditis virus (EMCV) IRES. Treatment of the cells with thapsigargin induced eIF2α phosphorylation and reduced EMCV IRES-dependent translation, while the CrPV IGR IRES retained activity. For each construct, unstressed cap (black) and unstressed IRES (grey) activities are normalized to 100%. Error bars represent averages ±SEM of ≥3 independent experiments. (E) Translation initiation activity of the HCV IRES (compared to cap-driven translation) in Huh 7.5 cells, comparing stress induced by thapsigargin and DTT. Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. (F) Natively purified PICs from unstressed HeLa cells, analyzed for the effect of HCV IRES binding, as in Figure 4A. DOI: http://dx.doi.org/10.7554/eLife.21198.010 Adding WT HCV IRES to the purified preassembled PICs had similar effects on PICs from both stressed and unstressed cells. Specifically, eIF2 was displaced, while eIF3 and eIF1A remained bound (Figure 4A and B, lanes 2 and 8). Both eIF1A and eIF5B showed increased binding or retention when the HCV IRES was present, more obviously with PICs from stressed cells. Interestingly, there was more eIF5B present overall in complexes from stressed cells. If we use eIF5B’s presence as a proxy for a 48S complex prepared to progress to 80S ribosomes, these results suggest: (1) addition of HCV IRES to pre-formed 43S complexes results in PICs capable of progressing to 80S ribosomes, and (2) under stress, the relevant HCV IRES complex can form without eIF2 but contains eIFs 3, 5B, and 1A. Experiments with PICs from unstressed HeLa cells produced similar results (Figure 4—figure supplement 1F). Because GTP hydrolysis by eIF2 is important for changes in canonical 48S PICs, we explored its importance in HCV IRES-driven events by treating the lysate with non-hydrolyzable analog Guanosine 5′-[β,γ-imido]triphosphate (GMP-PNP) before purifying PICs. GMP-PNP exchange was effective enough to prevent 80S ribosome formation on both capped β-globin mRNAs and HCV IRES RNAs (Figure 4C). Purified PICs from GMP-PNP-treated lysate contained eIFs 3, 2, and 1A but again no eIF1. Addition of HCV IRES resulted in retention of eIFs 3 and 1A, but there was little or no bound eIF5B on these HCV PICs, as expected (Figure 4D, lanes 2 and 8). eIF2 was again displaced from these PICs by the IRES. While the eIF2 release could be a hydrolysis-dependent event due to residual GTP bound to eIF2, the effectiveness of the GMP-PNP exchange suggests otherwise (Figure 4C). As outlined in the Discussion section, we do not propose that GTP hydrolysis-independent displacement of eIF2 is a necessary step in the HCV IRES mechanism; however, this result is consistent with the observation that dII and eIF2 occupy the same spot on the 40S subunit, and there may be some competition between the two that must be resolved. Overall, the results of the experiments presented above suggest the HCV IRES can bind and partially alter pre-formed PICs to achieve a complex capable of 80S ribosome formation using eIF1A, with or without eIF2. The removal of some eIFs could be triggered by IRES binding, or the factors could stochastically dissociate during the incubation and then the IRES could prevent stable re-binding. By either pathway, the end result is a PIC altered by its interaction with the HCV IRES. We used mutants to understand the role of different HCV IRES structural domains in these events and to correlate this with activity in both stressed and unstressed cells. Altering dIIIb (dIIIb_trunc) had a small effect on eIF3 in the complex despite the fact that mutation of this domain dramatically reduces direct eIF3 binding to the HCV and CSFV IRESs (Figure 4A,B and D, lanes 3 and 9) (Kieft et al., 2001; Sizova et al., 1998), again consistent with a mechanism in which eIF3 is recruited by interactions with the 40S subunit. However, a PIC with dIIIb_trunc did not contain eIF5B, which would inhibit progression to 80S ribosomes. This effect is mirrored by the decrease in translation efficiency (Figure 4E). Removal of dIIdII) slightly decreased 40S-bound eIF1A but increased retained eIF2 (Figure 4A, lanes 4 and 10), again consistent with a potential clash between dII and eIF2 (Figure 1—figure supplement 1B and C). Interestingly, retention of eIF1A on PICs from unstressed HeLa cells was less effected by ΔdII, perhaps reflecting some subtle difference in the makeup or configuration of the PICs from different sources (Figure 4—figure supplement 1F). With PICs from stressed cells with this mutant, there is no eIF2 binding (as expected) and eIF1A is less well retained (Figure 4B, lanes 4 and 10), while in GMP-PNP-containing complexes eIF1A is not well retained (Figure 4D, lanes 4 and 10). Hence, IRES dII may somewhat compete for eIF2 binding (in a position docked in the E site), but it helps keep eIF1A bound. An interesting consequence of dII deletion is that the mutant does not recover activity when cells are stressed (Figure 4E), perhaps due to the decreased binding of eIF1A. In summary, both domains II and IIIb contribute to the ability of the HCV IRES to affect the makeup of a recruited preassembled PIC. We assessed the contribution of HCV IRES elements located in the decoding groove to changing PIC composition by using the dIIb_ΔGCC and AUG-CUG mutants. With PICs from unstressed cells, dIIb_ΔGCC did not cause as much dissociation of eIF2 (Figure 4A, lanes 5 and 11), consistent with cryo-EM reconstructions of this mutant which show an altered location of dII (Filbin et al., 2013). eIF1A was largely retained. With PICs from stressed cells and dIIb_ΔGCC, there is no eIF1 or eIF2 bound, but eIF1A is present similar to WT (Figure 4B, lanes 5 and 11). This correlates with a dramatic increase in activity with stress: dIIb_ΔGCC has inhibited translation initiation in unstressed cells, but more than recovered activity in stressed cells (Figure 4E). With AUG-CUG, eIF1A was bound under all conditions, and eIF1 was retained with PICs from unstressed cells and to a certain degree on GMP-PNP-treated PICs (Figure 4A and D, lanes 6 and 12). Interestingly, AUG-CUG induces only a 50% decrease in activity in unstressed cells, but strikingly its activity is decreased dramatically when the cells are stressed, dropping to levels similar to the negative control mutant dIIId_GGG-CCC (Figure 4E). Thus, the HCV IRES’s AUG start codon is much more important for function when eIF2 is depleted. However, the makeup of the complex formed by AUG-CUG with PICs from stressed cells is very similar to that formed with WT (Figure 4B, compare lanes 2 and 8 with lanes 6 and 12). The similarities include the presence of eIF5B, suggesting that some unknown step such as tRNA delivery is disrupted by this mutant. Overall, eIF5B binding to PICs from DTT-treated cells is higher when eIFs 2 and 1 are absent and 1A and 3 are present.

eIF1A affects tRNAi binding to HCV IRES-bound PICs

Our results thus far show that 40S subunit-bound eIF1A is important for HCV IRES-driven translation. In canonical cap-dependent translation initiation, eIF1A performs roles both during and after scanning. Interestingly, when first discovered, eIF1A was referred to as eIF4C and its first described activity was stimulating tRNA binding to ribosomes (Schreier et al., 1977; Trachsel et al., 1977). As the HCV IRES does not induce scanning, we hypothesized that eIF1A could be important for ‘post-scanning’ functions during HCV IRES-driven translation, including stabilizing tRNAi binding and stimulating subunit joining with eIF5B (Acker et al., 2006; Goumans et al., 1980). These functions are accomplished cooperatively by the N- and C-terminal tails as mentioned above. We showed that the eIF1A-ΔCTT truncation mutant potently inhibits IRES-dependent translation (Figure 3—figure supplement 1C), strongly suggesting that it is important for subunit joining during HCV IRES initiation. To explore if eIF1A is also performing its role of inspecting and stabilizing tRNAi on these complexes, especially in the absence of eIF2, we combined the approach of purifying and analyzing ‘native PICs’ from cell lysate with the ability to deplete eIF1A using the α-eIF1A aptamer (Figure 5—figure supplement 1A). First, using PICs purified from both unstressed and DTT-stressed cells, we verified that aptamer treatment does not positively or negatively affect binding of eIF2 (Figure 5A). The results indicate that any observed effects on tRNAi levels upon aptamer treatment are independent of eIF2. We then established a baseline for tRNAi binding to PICs from both stressed and unstressed cells (Figure 5B). In the absence of aptamer or IRES, eIF2-bound PICs contain more tRNAi (assessed relative to 18S rRNA) than do PICs from DTT-treated cells, although the latter retain tRNAi above background levels, indicating some stably bound tRNAi to these purified PICs without eIF2.
Figure 5—figure supplement 1.

PIC preparation strategy for northern blotting quantification.

(A) Diagram of the PIC preparation strategy and experiment to analyze the amount of tRNAi bound to natively purified PICs. Example of Western and Northern blots used for analysis shown. (B) Quantification of tRNAi bound to PICs from unstressed cells (eIF2-bound PICs). In the presence of eIF2, eIF1A depletion had negligible effects on tRNAiMet from WT and start mutant (AUG-CUG) HCV IRESs. Error bars represent averages ±SEM of ≥3 independent experiments.

DOI: http://dx.doi.org/10.7554/eLife.21198.012

Figure 5.

eIF1A stabilizes tRNAiMet binding and inspects the start codon on HCV IRES-bound PICs.

(A) Western analysis of eIF2 bound to natively purified PICs treated with α-eIF1A aptamer. α-eIF1A aptamer treatment has no effect on eIF2 binding in unstressed or DTT-stressed PICs bound with WT HCV IRES. Input PIC shown for comparison. (B) Quantified data from Northern blots measuring the amount of tRNAi bound to PICs from unstressed (grey) or DTT-stressed (orange) cells. PICs were not treated with aptamer or IRES. tRNAi signal presented as a ratio to internal control 18S rRNA signal. Experimental protocol shown in Figure 5—figure supplement 1. (C) Identical to panel (B), but measuring tRNAi binding to PICs treated with AS (orange) or α-eIF1A (cyan) aptamers and bound to WT HCV IRES or the AUG-CUG mutant (CUG). Ratio is expressed as tRNAi compared to 18S rRNA signal, and the signal from untreated, HCV IRES-bound PICs set to 1.0. Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. (D) Analysis of factors bound to PICs from DTT-stressed cells, depleted of eIF1A. Western blots to various factors are shown. These are the same samples analyzed in panel (C).

DOI: http://dx.doi.org/10.7554/eLife.21198.011

(A) Diagram of the PIC preparation strategy and experiment to analyze the amount of tRNAi bound to natively purified PICs. Example of Western and Northern blots used for analysis shown. (B) Quantification of tRNAi bound to PICs from unstressed cells (eIF2-bound PICs). In the presence of eIF2, eIF1A depletion had negligible effects on tRNAiMet from WT and start mutant (AUG-CUG) HCV IRESs. Error bars represent averages ±SEM of ≥3 independent experiments.

DOI: http://dx.doi.org/10.7554/eLife.21198.012

(A) Analysis of siRNA-induced knockdown of eIF2A and eIF2D and double knockdown in Huh 7.5 cells with β-actin as a loading control. [siRNA] = 20 mM. (B) Activity of WT HCV IRES in eIF2A- and eIF2D-depleted cells, treated with thapsigargin. ‘Ctrl’ is from cells treated with non-targeting siRNA. Error bars represent averages ±SEM of ≥3 independent experiments. (C) Analysis of siRNA-induced double knockdown of eIF2A and eIF2D in Huh 7.5 cells. eIF1A knockdown is included as a control. [siRNA] = 10 mM, as higher concentrations resulted in knockdown of eIF1A that caused cell death. (D) Activity of WT HCV IRES in doubly eIF2A- and eIF2D-depleted cells and in cells depleted of eIF1A. Cells were treated with either thapsigargin or DTT. ‘Ctrl’ is from cells treated with non-targeting siRNA. Error bars represent averages ±SEM of ≥3 independent experiments. Lowering eIF1A concentrations results in decreased HCV IRES activity, but depletion of eIF2A+D has no effect.

DOI: http://dx.doi.org/10.7554/eLife.21198.013

eIF1A stabilizes tRNAiMet binding and inspects the start codon on HCV IRES-bound PICs.

(A) Western analysis of eIF2 bound to natively purified PICs treated with α-eIF1A aptamer. α-eIF1A aptamer treatment has no effect on eIF2 binding in unstressed or DTT-stressed PICs bound with WT HCV IRES. Input PIC shown for comparison. (B) Quantified data from Northern blots measuring the amount of tRNAi bound to PICs from unstressed (grey) or DTT-stressed (orange) cells. PICs were not treated with aptamer or IRES. tRNAi signal presented as a ratio to internal control 18S rRNA signal. Experimental protocol shown in Figure 5—figure supplement 1. (C) Identical to panel (B), but measuring tRNAi binding to PICs treated with AS (orange) or α-eIF1A (cyan) aptamers and bound to WT HCV IRES or the AUG-CUG mutant (CUG). Ratio is expressed as tRNAi compared to 18S rRNA signal, and the signal from untreated, HCV IRES-bound PICs set to 1.0. Error bars represent averages ±SEM of ≥3 independent experiments. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. (D) Analysis of factors bound to PICs from DTT-stressed cells, depleted of eIF1A. Western blots to various factors are shown. These are the same samples analyzed in panel (C). DOI: http://dx.doi.org/10.7554/eLife.21198.011

PIC preparation strategy for northern blotting quantification.

(A) Diagram of the PIC preparation strategy and experiment to analyze the amount of tRNAi bound to natively purified PICs. Example of Western and Northern blots used for analysis shown. (B) Quantification of tRNAi bound to PICs from unstressed cells (eIF2-bound PICs). In the presence of eIF2, eIF1A depletion had negligible effects on tRNAiMet from WT and start mutant (AUG-CUG) HCV IRESs. Error bars represent averages ±SEM of ≥3 independent experiments. DOI: http://dx.doi.org/10.7554/eLife.21198.012

Presence of alternate eIFs 2A and 2D in PICs, and effect of knockdowns.

(A) Analysis of siRNA-induced knockdown of eIF2A and eIF2D and double knockdown in Huh 7.5 cells with β-actin as a loading control. [siRNA] = 20 mM. (B) Activity of WT HCV IRES in eIF2A- and eIF2D-depleted cells, treated with thapsigargin. ‘Ctrl’ is from cells treated with non-targeting siRNA. Error bars represent averages ±SEM of ≥3 independent experiments. (C) Analysis of siRNA-induced double knockdown of eIF2A and eIF2D in Huh 7.5 cells. eIF1A knockdown is included as a control. [siRNA] = 10 mM, as higher concentrations resulted in knockdown of eIF1A that caused cell death. (D) Activity of WT HCV IRES in doubly eIF2A- and eIF2D-depleted cells and in cells depleted of eIF1A. Cells were treated with either thapsigargin or DTT. ‘Ctrl’ is from cells treated with non-targeting siRNA. Error bars represent averages ±SEM of ≥3 independent experiments. Lowering eIF1A concentrations results in decreased HCV IRES activity, but depletion of eIF2A+D has no effect. DOI: http://dx.doi.org/10.7554/eLife.21198.013 Using these purified complexes, we examined the effect of depleting eIF1A on tRNAi association with PICs bound to HCV IRES. Under conditions of eIF2 abundance, treatment with the α-eIF1A aptamer and IRES binding induced no reproducibly statistically significant change in tRNAi binding (Figure 5—figure supplement 1B). However, when we repeated this analysis with PICs from stressed cells, treatment with α-eIF1A aptamer reduced the amount of tRNAi bound to WT HCV IRES-containing PICs (Figure 5C). Binding of the AUG-CUG mutant to PICs from stressed cells also decreased tRNAi binding, but depletion of eIF1A increased tRNAi binding. Taken together, these data suggest that in the context of HCV IRES translation, eIF1A is performing roles analogous to its canonical roles: it contributes to stable tRNAi binding but is also involved in discriminating against non-AUG start codons, and this role is particularly important during stress conditions. Furthermore, eIF1A depletion and resultant tRNAi binding does not correlate with the presence of eIF5B on complexes (Figure 5D, compare to Figure 4). Hence, eIF5B and eIF1A are very likely acting as partners in post-tRNAi binding subunit association, and while eIF5B is playing an important role in tRNAi binding and subunit joining, it is not likely acting as a direct tRNAi delivery agent when eIF2 is depleted. Finally, as eIF2A and eIF2D have been proposed as possible tRNA delivery agents in the absence of eIF2 (Dmitriev et al., 2010; Kim et al., 2011; Skabkin et al., 2010), we assessed their role. We knocked down either eIF2A and/or eIF2D in Huh 7.5 cells and assessed the effect of HCV IRES translation with and without thapsigargin stress, replicating previously reported conditions (Kim et al., 2011). Knockdown of these factors did not affect HCV IRES function under stress (Figure 5—figure supplement 1A and B). Based on this result, we tested the effect of eIF1A knockdown in order to verify that a knockdown of a factor important for HCV IRES activity would affect translation by this assay, and also tested the effect of a second stressor, DTT (Figure 5—figure supplement 2C and D). Partial knockdown of eIF1A resulted in a modest but reproducible decrease in HCV IRES-mediated translation in unstressed cells and cells stressed with either thapsigargen or DTT, while depletion of eIF2A and eIF2D together had no effect. Note that we achieved complete knockdown of eIF2A and eIF2D during 20 nM siRNA treatment (Figure 5—figure supplement 2A) but only achieved partial knockdown of the same factors at 10 nM siRNA concentration (Figure 5—figure supplement 2C). We used lower siRNA concentrations when testing eIF1A knockdown because higher concentration siRNA-targeting eIF1A was toxic to cells. Overall, we conclude that eIF2A and eIF2D are not substituting for eIF2, and this experiment also confirmed the importance of eIF1A in a cell-based translation assay.
Figure 5—figure supplement 2.

Presence of alternate eIFs 2A and 2D in PICs, and effect of knockdowns.

(A) Analysis of siRNA-induced knockdown of eIF2A and eIF2D and double knockdown in Huh 7.5 cells with β-actin as a loading control. [siRNA] = 20 mM. (B) Activity of WT HCV IRES in eIF2A- and eIF2D-depleted cells, treated with thapsigargin. ‘Ctrl’ is from cells treated with non-targeting siRNA. Error bars represent averages ±SEM of ≥3 independent experiments. (C) Analysis of siRNA-induced double knockdown of eIF2A and eIF2D in Huh 7.5 cells. eIF1A knockdown is included as a control. [siRNA] = 10 mM, as higher concentrations resulted in knockdown of eIF1A that caused cell death. (D) Activity of WT HCV IRES in doubly eIF2A- and eIF2D-depleted cells and in cells depleted of eIF1A. Cells were treated with either thapsigargin or DTT. ‘Ctrl’ is from cells treated with non-targeting siRNA. Error bars represent averages ±SEM of ≥3 independent experiments. Lowering eIF1A concentrations results in decreased HCV IRES activity, but depletion of eIF2A+D has no effect.

DOI: http://dx.doi.org/10.7554/eLife.21198.013

Discussion

The type 3 IRESs are found in medically and economically important pathogens and they are important models to explore fundamental tenets of eukaryotic translation initiation. Key questions, paradoxes, and unknowns remain regarding their mechanisms of action, including some debate about how the 40S subunit and initiation factors are recruited to the IRES RNA. This motivated us to explore the mechanism of these IRESs with approaches designed to address key remaining questions. We have discovered important specific roles for eIF1A in type 3 IRES translation initiation, which mirror its roles in canonical cap- and scanning-dependent initiation. First, it stabilizes tRNAi binding to HCV IRES PICs. This role makes sense, as eIF1A was initially referred to as eIF4C and its first described activity was stimulating tRNA binding to ribosomes (Schreier et al., 1977; Trachsel et al., 1977), consistent with a post-scanning role of eIF1A in facilitating tRNAi stability on proper start codons. A second function mirrors eIF1A’s role in discriminating against improper AUG codons and codon-anticodon pairing (Maag et al., 2006). As in scanning, this role depends on eIF1A’s NTT (Fekete et al., 2007), which also promotes scanning along with eIF1 (Maag and Lorsch, 2003; Pestova et al., 1998a). However, as eIF1 is not present on the HCV IRES-bound PICs, the scanning role of the NTT is likely unnecessary. Third, eIF1A’s CTT almost certainly plays a critical role in stimulating eIF5B-bound GTP hydrolysis in subunit joining during HCV IRES-driven initiation (Acker et al., 2006). eIF1A’s role in HCV IRES translation initiation is consistent with the interplay of eIF1 and eIF1A with the 40S subunit and other factors during canonical initiation (Nanda et al., 2013). Briefly, start codon recognition and GTP hydrolysis on eIF2 result in departure of eIF2 and eIF1 and movement of the 40S subunit into a ‘closed’ conformation in which eIF1A binding is further stabilized. As previously noted, a ‘closed’ conformation is reminiscent of that seen when the HCV IRES is bound (Filbin et al., 2013; Fraser et al., 2009; Llácer et al., 2015; Spahn et al., 2001), a conformation that depends on IRES domain dII. These links between ribosome conformation, eIF1A stability, and dII suggest an explanation for the reduced occupancy of eIF1A on IRES complexes lacking dII. HCV IRES binding to the PIC may promote a ‘closed-like’ post-scanning conformation that stabilizes eIF1A binding, promotes tRNAi binding, and facilitates progression to 80S ribosomes with eIF5B. dII may functionally mimic post-scanning duties of eIF1 and work cooperatively with eIF1A to inspect the AUG. Our observed increase in AUG-CUG mutant translation during eIF1A depletion is consistent with this. Although our data strongly support a role for eIF1A in type 3 IRES initiation, it is important to consider reports that may initially appear to suggest otherwise. First, it has been reported that addition of eIF1/1A to HCV and CSFV IRES-bound ribosomes destabilizes the ribosome-IRES complex (Pestova et al., 2008). One possible explanation is that PICs generated from purified components and subsequently challenged with eIF1A differ from an IRES recruited to a natively assembled PIC containing eIFs 1, 1A, and 3. Consistent with this, stable eIF1A binding depends on other PIC components (Maag and Lorsch, 2003), and a natively preassembled PIC may more readily assume post-scanning conformations that promote stable eIF1A binding. In fact, eIF1A alone does not seem to destabilize 48S* PICs on the CSFV IRES in vitro when added with eIFs 3 and 5B (Pestova et al., 2008). Second, it has been reported that eIFs 2 and 3 are deemed necessary and sufficient for SPV9 IRES 48S complex formation (de Breyne et al., 2008). There may be differences in the need for eIF1A among different type 3 IRESs, consistent with our observations with the SPV-1 IRES. However, toeprinting studies that monitored reconstituted PIC assembly on this IRES indicated an effect induced by including eIF1A, although this did not lead to a conclusion regarding a functional role. Hence, rather than contradicting these studies, our results build on these findings and expand understanding. The fact that we find eIF1A bound in a functionally important role requires that we consider how it is recruited to the HCV IRES PIC, in turn helping to discriminate between different HCV IRES mechanistic models. As mentioned above, evidence suggests that ribosome recycling occurs immediately after termination, when eIFs 3, 1, and 1A load on the 40S subunit. In fact, eIF3j (subunit of eIF3) contacts eIFs 1 and 1A along the decoding groove of the ribosome in a coupled binding reaction on yeast ribosomes (Aylett et al., 2015), and manipulation of ribosomes to expel eIF3j is a necessary step in IRES binding (Fraser et al., 2009), supporting a mechanism of IRES binding to a factor-loaded 43S complex. In our hands, natively purified 40S subunit-containing PICs have a number of eIFs preloaded, including 1A. Thus, we assert that the weight of evidence is consistent with a model in which the HCV IRES binds and manipulates a factor-loaded PIC within a cell, rather than finding and binding free 40S subunit, eIF3, and eIF1A (Figure 6).
Figure 6.

Revised mechanism for HCV IRES-driven initiation.

This model is described in the main text. Briefly, we propose that the HCV IRES (and probably other type 3 IRESs) recruits a pre-assembled ‘TC-deficient’ PIC containing eIF1, 1A, and 3 (grey oval), which is an intermediate in the normal 40S recycling process. IRES binding to this PIC partially remodels it to include displacing eIF3 (yellow, ‘3*’) and either passively or actively releasing eIF1. This remodeled PIC is used under both eIF2 active and inactive conditions (grey shaded box). When active eIF2 is abundant, delivery of tRNA through the TC presumably requires movement of IRES domain II to an alternate position (Yamamoto et al., 2014) to resolve a steric clash (Figure 1—figure supplement 1B and C). If eIF2 is inhibited, this would have the effect of increasing the amount of available ‘TC-deficient’ PICs and perhaps free tRNAi. While we cannot prove that an ‘alternate’ factor is not used to deliver tRNAi under these conditions, we assert that available evidence supports a mode of tRNAi recruitment using eIF1A and eIF5B..

DOI: http://dx.doi.org/10.7554/eLife.21198.014

Revised mechanism for HCV IRES-driven initiation.

This model is described in the main text. Briefly, we propose that the HCV IRES (and probably other type 3 IRESs) recruits a pre-assembled ‘TC-deficient’ PIC containing eIF1, 1A, and 3 (grey oval), which is an intermediate in the normal 40S recycling process. IRES binding to this PIC partially remodels it to include displacing eIF3 (yellow, ‘3*’) and either passively or actively releasing eIF1. This remodeled PIC is used under both eIF2 active and inactive conditions (grey shaded box). When active eIF2 is abundant, delivery of tRNA through the TC presumably requires movement of IRES domain II to an alternate position (Yamamoto et al., 2014) to resolve a steric clash (Figure 1—figure supplement 1B and C). If eIF2 is inhibited, this would have the effect of increasing the amount of available ‘TC-deficient’ PICs and perhaps free tRNAi. While we cannot prove that an ‘alternate’ factor is not used to deliver tRNAi under these conditions, we assert that available evidence supports a mode of tRNAi recruitment using eIF1A and eIF5B.. DOI: http://dx.doi.org/10.7554/eLife.21198.014 We favor a model for HCV IRES function that combines aspects of previous models, growing knowledge of eukaryotic translation initiation, and our new data (Figure 6). In this model, we propose that the IRES RNA first binds an assembled PIC that is normally generated as a necessary intermediate in the ribosome recycling process (Pisarev et al., 2007). This PIC contains eIFs 1, 1A, and 3 but is awaiting binding of the eIF2-containing TC. As binding of the TC is proposed to be a relatively slow step (Majumdar et al., 2003), this ‘TC-deficient’ PIC should exist in sufficient amounts to support HCV IRES translation. Because eIF2 is not present, there is no steric hindrance on the PIC for IRES dII to dock into position and change the 40S subunit conformation and no block for placement of the start codon in the decoding groove. Although purely speculative, it is tempting to wonder if a role of dII is to help the IRES select PICs that do not have the TC bound and hence have an open and available decoding groove. Binding of the IRES dIIIb could then interact with bound eIF3, moving it to a ‘displaced position’ as seen in recent cryo-EM structures (Hashem et al., 2013). We propose that labile eIF1 also departs or is displaced by HCV IRES binding. This altered PIC now has a composition and conformation that facilitates Met-tRNAiMet binding by one of two modes. If eIF2 is abundant, then the TC can bind, an event that would require IRES dII to move to an alternate position. Although the structure of such a complex has not been solved, this position could be similar to that observed in recent cryo-EM reconstructions of the HCV IRES bound to 80S ribosomes with tRNA (Yamamoto et al., 2014). This would be followed by GTP hydrolysis by eIF2 and departure of the factor. Under conditions of eIF2 inhibition, we propose that Met-tRNAiMet binding occurs directly, without a dedicated delivery factor, and is stabilized by eIF1A and eIF5B. In both modes of tRNAi delivery, eIF1A and eIF5B then work together for the final stages of codon-anticodon verification and subunit joining. We assert that this model is consistent with published results, clarifies discrepancies between existing models, presents new similarities between canonical and IRES-driven initiation, and helps to link eIF2-dependent and -independent modes of IRES initiation; features, implications, and challenges of this mechanism are discussed below. First, this model provides a purpose for displacing eIF3 from the 40S subunit even though eIF3 is needed for full IRES activity. eIF3 helps recruit eIF1A and 1, and thus may be important for creating the PIC that we propose is the substrate for the HCV IRES. However, partially displacing eIF3 could allow conformational and compositional remodeling of the PIC to include removal of eIF1 but still maintain some key eIF3 functions. Second, the idea that the IRES binds selectively to a PIC that contains eIFs 3, 1, and 1A is appealing because it takes advantage of a known intermediate in the normal 40S recycling process that contains factors necessary for IRES activity. By binding this PIC and remodeling it, the IRES creates a complex that can be used in either the eIF2-dependent or -independent modes, and in fact the eIF2-independent pathway could operate in both stressed and unstressed conditions. Although HCV has ways to prevent eIF2α phosphorylation, being able to operate under a broad set of conditions could confer an advantage to the virus. Third, IRES binding to this preassembled PIC can explain why we observe increases in HCV IRES activity with eIF2α phosphorylation. Specifically, as levels of this TC-deficient PIC increase in response to eIF2 inactivation there would be more available for the IRES to bind. Simultaneously, this would increase the pools of free Met-tRNAiMet for direct binding to the HCV IRES PIC with assistance from eIFs 1A and 5B. Indeed, mammalian stress granules contain TC-deficient PICs (Kedersha et al., 2002), and many viruses (including HCV) modify or co-opt stress granules during infection (White and Lloyd, 2012), suggesting that co-opting eIF2-deficient PICs is a mechanism used by HCV during infection. One question that has been somewhat unresolved is the mechanism by which Met-tRNAiMet is delivered to the HCV IRES PIC under conditions of eIF2 depletion. One possibility proposed in the literature is that ‘alternate’ initiation factors eIFs 2A or 2D substitute for eIF2. However, in our hands effective knockdown of these factors did not affect HCV IRES function in stressed cells. Another mechanism proposed that eIF5B is responsible for either delivering Met-tRNAiMet or stabilizing Met-tRNAiMet binding to HCV IRES PICs (Terenin et al., 2008). We observed Met-tRNAi binding to HCV IRES-containing PICs that did not correlate closely with bound eIF5B and thus eIF5B may not be the sole responsible factor. Terenin et al. did not identify a role for eIF1A, but it is possible that eIF1A was present in the lysate used for some of their experiments and could be working in conjunction with eIF5B. We assert that a reasonable mechanistic hypothesis for Met-tRNAiMet recruitment is that eIF1A works with eIF5B to select the Met-tRNAiMet and stabilize its binding in the absence of a dedicated delivery factor replacement for eIF2. Indeed, while not fully proven, several lines of evidence support the idea of direct Met-tRNAiMet recruitment to HCV IRES (and by extension, at least some other type 3 IRES) PICs. First, such a mechanism has been observed in vitro with reconstituted studies of the SPV9 IRES, which show that Met-tRNAiMet can bind to PICs on that IRES independently of eIFs and may be further stabilized by eIF1A (de Breyne et al., 2008). Thus, other type 3 IRESs could do the same in cells under conditions of high abundance of free Met-tRNAiMet. As eIF2α phosphorylation results in reduced affinity for Met-tRNAiMet (Kapp and Lorsch, 2004), such conditions could readily exist in stressed cells. Indeed, we observe an increase in IRES translation activity under these conditions. Also, we observe that under conditions of eIF2 inhibition, the HCV IRES is far more sensitive to mutation of the start codon than under conditions of eIF2 abundance. One explanation for this observation is that direct Met-tRNAiMet binding is more dependent on the codon-anticodon interaction when there is no dedicated delivery factor and eIF1A and 5B alone are inspecting and stabilizing the interaction. This could also help explain the AUG start codon conservation in this group of IRES RNAs despite the fact that they appear to tolerate other codons in conditions of abundant eIF2. Finally, direct Met-tRNAiMet binding to ribosomes is accepted in bacterial initiation, thus there is no clear biological reason why it should not occur elsewhere under the right conditions. Indeed, it has already been proposed by Terenin et al. that translation directed by the HCV IRES can operate in a bacterial-like mode using eIF5B to facilitate tRNA binding in a way that mimics its bacterial counterpart, IF2 (Terenin et al., 2008). Our data now allow us to extend this analogy by including eIF1A, the functional homolog of bacterial IF1. Although IF1 lacks the CTT and NTT of eIF1A, similar functions have been reported for both factors. Specifically, both occupy similar positions on the ribosome, stabilize tRNAi binding, and communicate with eIF5B (or IF2) (Boileau et al., 1983; Choi et al., 2000; Laursen et al., 2005). Our model does not include a homolog of IF3. However, one major function attributed to IF3 is prevention of premature subunit association (Grunberg-Manago et al., 1975), a function ascribed to eIF3 (Goumans et al., 1980; Siridechadilok et al., 2005). Hence, the combination of eIF1A, 5B, and 3 with the 40S subunit could comprise a set of factors that parallel IFs 1, 2, and 3 working with the 30S subunit. Combining this observation with the ability of the IRES to bind directly to the ribosome with an AUG placed in the P site, a strategy described as ‘prokaryotic-like’ (Berry et al., 2010; Pestova et al., 1998b), the process of translation initiation by the HCV IRES in the absence of eIF2 shares many characteristics with bacterial translation initiation. This has interesting consequences for considering the evolutionary link between bacterial and eukaryotic initiation mechanisms and the role of IRESs in that evolution.

Materials and methods

IRES, protein, and plasmid sequences

Hepatitis C virus subtype 1b internal ribosome entry site (HCV IRES) (AB691953) nt 40–372. Classical Swine Fever Virus strain HCLV internal ribosome entry site (CSFV IRES) (AF531433) nt 70–402. Simian sapelovirus 1 strain 2382 internal ribosome entry site (SPV-1 IRES) (AY064708) nt 327–772. Cricket paralysis virus isolate CrPV-3 internal ribosome entry site (CRPV IRES) (KP974707) nt 6025–6246. Homo sapiens beta-globin mRNA 5’ untranslated region (AF007546) nt 1–79. Homo sapiens translation initiation factor 1A X-linked (eIF1A) (AAH00793) coding sequence.

pDBS

The pDBS vector was assembled using the firefly luciferase gene and backbone from the pGL3-control (Promega, Madison, WI) reporter vector with the upstream Renilla luciferase (Rluc) gene cloned from the pRL-CMV (Promega) cloned between the HindIII and XbaI restriction sites. IRES sequences cloned into the resulting bicistronic reporter vector were cloned between the EcoRI and NcoI sites and placed in frame with the downstream firefly luciferase (Fluc) coding sequence.

pUC19

Standard pUC19 (Invitrogen, Carlsbad, CA) was purchased and constructs containing IRES sequence alone or IRES sequences in frame with the Fluc reporter gene were amplified from parent vectors using forward IRES primers with an additional 5’ T7 sequence and a reverse primer corresponding to the 3’ end of the IRES or the cut site of BamHI in the pDBS vector.

Primer and oligonucleotide sequences

Primer name Sequence 5’−3’ HCV F CTCCCCTGTGAGGAACTACTGTCTT CSFV F CACCCCTCCAGCGACGGCCGAAC SPV-1 F GTGGTAAGTGATGTTAGTCATTG CrPV F AGCAAAAATGTGATCTTGCTTGTA CSFV R GGTATAAAAGTTCAAAGTGATTCAACTC SPV-1 R CTCCGAGGAGTCATCCTCATAGATTGCCATCTTAGAGAATGTCTT eIF1A_WT F ATGCCCAAGAATAAAGGTAAAGGAG eIF1A_WT R TTATCATGCGGCCGCAAGCTTGATGATGTC eIF1ANTT F TCTGAAAAAAGAGAACTGGTATTC eIF1A_ΔCTT R TTATCAAGTTTCATTGATTTTAGCATGC CSFVdII F ACTAGCCGTAGTGGCGAG HCV_ ΔdII F ACCCCCCCTCCCGCCGGGAGAG SPV-1_ ΔdII F ACACGACCGTACACGAAAG α-eIF1A aptamer GGGACACAAUGGACGAUGAGUUAGCAUCCGUGUCCAAGCUCAUGUCGUUUAGAACUAACGGCCGACAUGAGAG AS-eIF1A aptamer CUCUCAUGUCGGCCGUUAGUUCUAAACGACAUGAGCUUGGACACGGAUGCUAACUCAUCGUCCAUUGUGUCCC 18S northern probe CCATCCAATCGGTAGTAGCG tRNAMeti Northern probe TAGCAGAGGATGGTTTCGATCCATCGACCTCTGGGTTATGGGCC tRNAMete Northern probe TGCCCCGTGTGAGGCTCGAACTCACGACCTTCAGATTATGAGACTG 5’ T7 extension TAATACGACTCACTATAGGG DBS BamHI R CCCTAACTGACACACATTCCACAGC

Cell lines and cell culture conditions

Huh 7.5 cells were maintained in Dulbecco’s modification of Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES, and 1X non-essential amino acids (NEAA). Cells were routinely passaged every 48–72 hr and split 1:5. Freestyle 293-F cells were grown in suspension in FreeStyle Expression Medium (Invitrogen). Cells were harvested at ~3.0×106 cells/mL and washed once in PBS before pelleting. Cells were routinely passaged every 48–72 hr and split 1:10. HeLa: Cells were maintained in DMEM supplemented with 10% FBS. Cells were passaged every 48–72 hr and split 1:5. Other cell lines were obtained from other laboratories; the identities of the Huh 7.5, HEK293, and HeLa cells were authenticated by STR profiling. Cells were negative for mycoplasma contamination as tested by PCR.

Reporter mRNA and IRES RNA transcription

Mono- and bicistronic reporter mRNAs were transcribed using the T7 mMessage mMachine or MegaScript kit (capped vs. uncapped) (Invitrogen) from linearized vector or PCR-generated templates, then treated with the Poly(A)-tailing kit (Invitrogen). IRES RNA constructs were PCR-amplified, then in vitro transcribed using T7 polymerase.

mRNA transfection and chemical treatment

Huh 7.5 cells were grown in 24-well plates to ~80% confluence, then pretreated with DTT (2 mM) or mock treated for 1 hr. Pretreated cells were transfected with 1 µg bicistronic reporter RNA for 2 hr before being analyzed for luciferase activity. Relative luciferase activity is the percent of WT IRES activity in unstressed cells. Error bars on all translation data represent the average activity ±SEM of at least three independent experiments.

IRES RNA biotinylation and ribosome pull-down

Wild-type or mutant IRES RNAs were 5’ end labeled with biotin using the 5’-EndTag kit (Vector Labs, Burlingame, CA). Huh 7.5 cells were pelleted from 15 cm plates either untreated or pretreated for 3 hr with 2 mM DTT, lysed by syringe and needle, then clarified and stored at 4°C. Ten micrograms of biotinylated IRES was bound to 50 µL streptavidin-agarose bead slurry, washed, then incubated with cell lysate for 30 min at 37°C. After incubation, beads were washed and used for SDS-PAGE and western blotting.

Antibodies

Antibodies to initiation components were used at the following dilutions according to manufacturer’s protocols: eIF1 (1:1000, Cell Signaling Technologies, Danvers, MA), eIF1A (1:500, Santa Cruz Biotechnology, Dallas, TX), eIF2α (1:500, Santa Cruz Biotechnology), p-eIF2α (1:1000, Cell Signaling Technologies), eIF2A (1:1000, ProteinTech, Rosemont, IL), eIF2D (1:1000, ProteinTech), eIF3B (1:500, Santa Cruz Biotechnology), eIF5B (1:5000, Assay Biotech, Sunnyvale, CA), and rpS6 (1:5000, Cell Signaling Technologies).

Anti-eIF1A aptamer generation and validation by SELEX

We generated RNA aptamers to eIF1A by SELEX (Systematic Evolution of Ligands by EXponential enrichment) (Ellington and Szostak, 1990; Tuerk and Gold, 1990) from RNA pools randomized over 40 nucleotides (nt). Surface plasmon resonance (SPR) was used to measure binding to eIF1A. The effect of the aptamer in RRL for both cap-dependent and HCV IRES-dependent translation was assessed using HeLa lysate or RRL and luciferase reporters, and the effect of the aptamer on factor association with eIF1A was analyzed by pull-downs and western blots.

Anti-eIF1A aptamer transcription and eIF1A depletion

DNA encoding the α-eIF1A aptamer sequence and the anti-sense control aptamer (AS) were generated using overlapping DNA oligonucleotides. RNA was generated by T7 transcription and folded in the presence of 2 mM Mg(OAc)2. Aptamer at 3 µM final concentration was used in translation lysates and at 4 μM in PIC treatment. Samples were incubated for 15 min at either 30 or 37°C.

Recombinant human eIF1A expression and purification

Human eIF1A was expressed from pET28-b in BL21 Star (DE3) E. coli (Invitrogen) and purified by Ni-NTA resin and gel filtration. Mutants of eIF1A contained: WT aa1-143, ΔNTT aa21-143, and ΔCTT aa1-117.

Aptamer-depleted in vitro translation assays

RRL translation mixture contained 80% lysate (thawed on ice) supplemented with 5% 1 mM amino acid mixture, 10% 45 µM RNA aptamer (negative control or α-eIF1A aptamer) and 5% water. This mixture was incubated at 30°C for 15 min. The resulting aptamer-treated lysate mix was then added 2:1 to 18 µM eIF1A WT, ΔNTT, ΔCTT, or a buffer-only control. Depleted lysate with added-back eIF1A was then used to translate bicistronic reporter mRNA for 15 min at 30°C. Samples were analyzed for luciferase activity. Raw luciferase values were reported as ratios of α-eIF1A aptamer-treated translation to negative control aptamer-treated translation.

Native PIC purification

293F cells were grown in suspension and left untreated or pretreated with 2 mM DTT before pelleting. Pellets were resuspended in 1X Ribo A (20 mM HEPES-KOH (pH 7.4), 100 mM KOAc (pH 7.6), 2.5 mM Mg(OAc)2) and lysed by 3X freeze/thaw and passed through a 26G needle, then clarified by centrifugation. Lysate was left untreated on ice or incubated with 1.5 mM GMP-PNP. Ribosomes were pelleted by a 40,000 rpm spin in a Ti 50.2 rotor for 4 hr, resuspended in buffer A (20 mM Tris-HCl (pH 7.5), 50 mM KCl, 4 mM MgCl2, 2 mM DTT), then ultracentrifuged through a 10–40% sucrose gradient in buffer B (20 mM Tris-HCl (pH 7.5), 25 mM KCl, 3 mM MgCl2, 2 mM DTT) for 4 hr at 36,000 rpm in a SW41 rotor. 40S-containing fractions were collected, concentrated and stored at −80°C in buffer C (20 mM Tris-HCl (pH 7.5), 25 mM KCl, 3 mM MgCl2, 2 mM DTT, 0.1 mM EDTA, 0.25 M sucrose).

IRES:43S complex formation and sucrose density centrifugation

Purified native PICs were thawed on ice, incubated with WT or mutant IRES for 15 min at 37°C, then resolved by sucrose gradient ultracentrifugation. Gradients were fractionated, and then fractions containing 40S-bound or unbound peaks were collected separately, concentrated, and used in western or northern blotting. See Figure 4—figure supplement 1 and Figure 5—figure supplement 1.

Northern dot-blotting and analysis

Sucrose gradient analysis on remodeled 43S complexes was performed similarly as above except complexes were pretreated for 10 min at 37°C with aptamer. Ribosome-associated fractions were pooled and total RNA was fixed onto a nylon membrane. Crosslinked blots were first equilibrated, then hybridized in hyb buffer with 100,000–400,000 cpm 5’ radiolabeled DNA oligos at 60°C overnight. Blots were washed with hyb buffer, exposed to a phosphorscreen, and analyzed using ImageQuant software.

Statistics

Statistics for translation data and northern blotting were calculated in GraphPad Prism software. Data were represented as the average of n ≥ 3 ± SEM. Statistical validation was done using two-way analysis of variance (ANOVA) followed by a post-test using the Bonferroni method. Statistical significance shown by: *p<0.05, **p<0.01, ***p<0.001. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Bacterial-like translation initiation by the hepatitis C virus IRES requires eIF1A and ribosomal complex remodeling" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by James Manley as the Senior Editor. The reviewers have opted to remain anonymous. The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. This is an interesting manuscript by Jaafar and colleagues who re-examine the models of translation by the HCV IRES with a lysate-based system, finding that the factor eIF1A (homolog of bacterial IF1) is surprisingly required for efficient translation by type 3 IRESs. They additionally argue that other factors suggested to impact this IRES-mediated reaction, eIF2A and eIF2D, play no critical role in this process, and that tRNA can be loaded independently of eIF2A in a fashion that in some ways reflects a more "bacterial" event. They also argue that the IRES remodels PICs rather than binding the naked 40S subunit in the first step of initiation. Overall, the three reviewers were broadly enthusiastic, though as a group, it was felt that certain critical controls and quantification were lacking, and that conclusions in a number of places needed to be more cautious. The main issues had first to do with the possibility that additional components (eIF2A, eIF3 or tRNA) were removed by the aptamer during the depletion experiments, and whether that explains the fact that activity was not fully restored when eIF1A was added back. Other concerns related to the absence of quantification of western blots throughout and to over-simplifications of more complex data (e.g. reviewer 2’s second comment concerning the impact of eIF1A on three different viruses HCV, CSFV and SPV-1). Finally, while several reviewers appreciated the comparison of the IRES system to that of bacteria (in its reliance on eIF1A and an eIF2A-independent tRNA loading step), reviewer 3 felt that this parallel was overstated given the lack of a role for eIF1 and the contributions of eIF3. As such, this story line should be eliminated or minimally more carefully states. Finally, reviewer 3 had substantial concerns about DTT vs. thapsigargin stress and the lack of a positive control for these stress conditions. In closing, the manuscript is of sufficient interest for publication in eLife if the critical concerns of the reviewers (summarized above and detailed in the individual reviews) are adequately addressed. Reviewer #1: This manuscript describes an unanticipated role for eIF1A in IRES dependent translation of the hepatitis C virus, in the presence and absence of stress-induced phosphorylation (and thus inactivation) of eIF2α. Using a biotinylated HCV IRES pull down assay (in extracts), the authors show that eIF1A is bound to the IRES along with eIF2α. To study the function of bound eIF1A, they developed an aptamer that binds eIF1A and thus can deplete this factor from extracts or from the IRES. With an IRES-driven luciferase reporter, the authors were then able to detect a significant decrease in the efficiency of translation upon aptamer treatment. When purified eIF1A was then added back to lysates previously treated with the aptamer, translation was largely (though not completely) restored. Furthermore, under stress conditions in which eIF2α was phosphorylated and thus not functional in initiation, IRES-mediated translation was increased. The authors argue that this reflected an increase in overall free initiation factors in the cell and the ability of the HCV IRES to bypass eIF2α function via increased reliance on eIF1A. These data together are reminiscent of a bacterial model for translation initiation that lacks an eIF2α homolog, and is thought instead to directly load initiator tRNA into the P site with the guidance of IF1. While the proposed mechanism of bacteria-like eIF1A-driven initiation gives potential insight into a novel role for eIF1A for certain viral IRES's as well as helping to reconcile conflicting models about how the IRES and the ribosome engage one another in the cell (factors first or IRES first), more evidence is needed to fully support the authors' claims. In particular, controls should be done to ensure off target effects are not responsible for certain results and the western blot data should be looked at or explained more carefully when analyzing results. Major points: 1) eIF2α appears to be pulled down with eIF1A-aptamer complex, in addition to eIF1A (Figure 2—figure supplement 1C). This prompts the question of whether the results shown with the aptamer are the result of the depletion of eIF1A or eIF2α from IRES or various extracts, or both. Shown in Figure 2B is a depletion of eIF1A from IRESs through an IRES pull-down experiment, mediated by the aptamer. A similar experiment probing for eIF2α would be sufficient to prove the aptamer results reflected the consequence of eIF1A depletion but not that of eIF2α depletion. 2) The authors state in paragraph two “HCV IRES RNA manipulates preassembled PICs and stabilizes eIF1A binding” that the addition of WT IRES caused a displacement of eIF2α in stressed and unstressed cells, while eIF3 and eIF1A remained bound. However, 1A seems to be displaced to the same extent that eIF2α was displaced in both conditions. Thus, when eIF2α was not present, eIF1A was also not present (Figure 4B lanes 1, 2, 7, 8); as such, these data are not supportive of an eIF1A-driven, eIF2α-independent IRES initiation model, as proposed. Reviewer #2: The manuscript entitled "Bacterial-like translation initiation by the hepatitis C virus IRES requires eIF1A and ribosomal complex remodeling" by Jaafar et al., (2016) reports on the investigation of the molecular mechanism of HCV IRES-driven translation initiation. In this work, the authors used a variety of in vitro approaches to identify the eukaryotic initiation factor (eIF) composition of pre-initiation complexes (PICs) assembled on the HCV IRES and to determine the functional significance of a subset of these factors using mRNA reporter-based activity assays. The authors demonstrate that eIF1A is a component of the HCV IRES-based PIC and, importantly, that this factor is required for efficient HCV IRES-driven translation initiation. In addition, the authors demonstrate that eIF1A plays a role in stabilizing the binding of the initiator tRNA (Met-tRNAi) at a canonical AUG start codon. Finally, the authors demonstrate that the knockdown of eIF2D and eIF2A, two factors previously implicated in Met-tRNAi delivery under stress conditions, has no effect on the translation of a luciferase reporter driven by the HCV IRES. Based on their findings, the authors propose a model for HCV-IRES mediated translation initiation under normal and stress conditions. In this model, the HCV IRES binds and remodels native, pre-assembled PICs. The design of the experiments in this study is appropriate and with a few exceptions described below, the data, the data analysis, and the conclusions that are drawn from this data are acceptable. Overall, the results are novel and expand our understanding of how viral IRES elements co-opt the translational machinery to drive translation of viral RNAs. Assuming that the authors can appropriately address the major comments below and revise the manuscript accordingly, I highly recommend this manuscript for publication in eLife. Major Comments 1) Throughout the manuscript, the analysis of the western blot data are described and presented qualitatively. The authors should provide a more quantitative analysis by measuring band intensities, normalizing to the loading control (rpS6) and reporting fold changes. 2) The authors write: "Examination of the effect of eIF1A depletion on HCV, CSFV, and SPV-1 IRESs revealed a functional requirement for eIF1A in all three." However, Figure 2H clearly shows that there is no effect of depleting eIF1A on SPV-1 driven luciferase translation in HeLa cells. The authors should clarify their sentence and comment on this discrepancy. 3) In several instances in the manuscript the authors state that deletion of the N-terminal tail of eIF1A lowers stringency followed by a reference for Fekete et al. (2007). However, in Fekete et al.,the authors demonstrate that point mutations in the CTT of eIF1A reduce the stringency of start codon selection (Sui- phenotype) and thus result in increased initiation at a UUG codon. In addition, they showed that mutations in the NTT of eIF1A suppressed the Sui- phenotype (Ssu- phenotype) suggesting that NTT mutants of eIF1A reduce initiation at UUG codons. Thus, rather than supporting the authors' results and conclusions, this previously published article seems to contradict them. The authors should revise the appropriate sections of the manuscript. 4) Regarding the data in Figure 3, the authors indicate that the activity of the IRESs seems to depend on the presence of the NTT to a greater extent than does cap-dependent translation. This statement does not appear to be justified by the data. 5) The authors propose a model in which the HCV IRES binds a pre-assembled PIC and alters its composition so as to favor 80S ribosome formation. However, it is also possible that the IRES simply binds to those PICs from which factors that are not present in the final HCV IRES-PIC have stochastically dissociated during incubation with the IRES RNA. The authors should acknowledge this possibility. 6) Regarding the data in Figure 4 with the (Δ)dII HCV IRES: In unstressed 293F cells PIC assembly with the (Δ)dII HCV IRES results in less eIF1A retained. However, this is not true of eIF1A in unstressed HeLa cells. Could the authors comment on this discrepancy? 7) eIF5 is an important component of the 43S IC that functions as a GTPase activating protein for eIF2, and also interacts with eIF3 and eIF1A during canonical translation initiation. Is there a reason why the authors did not probe for eIF5 in their PICs? Reviewer #3: The HCV IRES is a model type 3 IRES that uses a subset of canonical eukaryotic translation initiation factors (eIFs) and can operate under normal conditions and under stress, when eIF2 has been inactivated by phosphorylation of the α subunit. Several previous studies have defined HCV IRES eIF requirements to include eIF2, eIF3, eIF5, and eIF5B under normal condition, while there are conflicting reports about factor requirement in the absence of eIF2. Jaafar and colleagues re-examine the models of translation by the HCV IRES with a lysate-based system, finding that the factor eIF1A (homolog of bacterial IF1) is surprisingly also required for efficient translation by type 3 IRESs. Using RNAi-mediated knockdowns they further show that factors previously suggested to substitute for eIF2 under stress don't contribute to efficient translation, and argue that tRNA recruitment occurs without a specific factor, as is the case in bacteria. They conclude that HCV IRES translation is thus bacterial-like and requires remodeling of a pre-assembled canonical pre-initiation complex (PIC). This article’s work around eIF1A is quite convincing in showing the unexpected role of the factor in translation by the HCV IRES. eIF1A is not just a component of the HCV IRES PIC, but it removal reduces translation activity in lysate, and restoring the factor with purified protein appears to restore this loss. However, it is worth noting that in many cases the factor add-back is incomplete (Figure 2B-C) suggesting that the anti-eIF1A aptamer might remove additional factors and/or tRNA that are important for IRES function. It would be important to clarify this, by blotting against the aptamer what the aptamer depleted, possibly with a pull down experiment. Prime candidates would be eIF3 (which binds eIF1A and could be pulled down alongside) and tRNAi which might interact with the aptamer (which has an AUG in a stem loop). In the former case, eIF3 itself may bind the aptamer, due to its intrinsic RNA binding activity, and be depleted. In the latter case, it'd be important to control for tRNA loss given the result presented in Figure 5—figure supplement 1, where the aptamer appears to reduce the ratio of tRNA:18S rRNA. Moreover, several blots (Figures 4 and 5) appear to be underexposed and lack important positive controls that would ensure that the experiment would be detecting protein if present. In their assessment of the role of eIF2A and eIF2D, I am concerned about the use of thapsigargin as the stressor and the lack of a positive control for inactivating the IRES under stress (Figure 5—figure supplement 2). The authors also use DTT as a stressor in separate experiments, and don't explain why thapsigargin was used in these experiments. To make these experiments conclusive, it would be important to demonstrate that eIF2α is phosphorylated under these conditions and the inclusion of a knockdown that actually reduces luciferase activity in Figure 5—figure supplement 2C. Given that thapsigargin raises intracellular Ca2+ levels, this chemical might allow for a completely factor-independent mode of IRES translation, as seen with high Ca2+ or Mg2+ (Lancaster et al. 2006). The authors make the case that the IRES remodels PICs rather than binding the naked 40S subunit in the first step of initiation. While this is certainly plausible, and it is possible that eIF1A stays bound following IRES binding, their data does not show that the IRES actively remove eIF3 to position it at a new location (eIF3 could simply disassociate and rebind, since their experiments are not done under dilute conditions). Given that this conclusion is featured prominently in their title, Abstract, Discussion, and Figure 6, it is important that the authors either provide data in support of this conclusion or clarify that it is only speculation. Contrary to what the authors have stated (Discussion paragraph seven) the IRES does not have much similarity in contacts with eIF3 and does eIF4G, as the former interacts with the IRESs predominantly through the subunit a and c, while the latter interacts with subunits c, d, and e (per their references). This comparison has been made previously by other (Siridechadilok et al. 2005) and is clearly incompatible based on current structural models. Finally, while aspects of the IRES translation might be considered "bacterial-like" this comparison is generally out of place, especially given the lack of a SD sequence, the absence of eIF1 function (IF3 analog), and the utilization of eIF3, which is nowhere in bacteria. Although the eIF1A data is fairly convincing, this article needs serious revisions to guarantee that the conclusions are not beyond the scope of their experiments. Provided that the reviewers can agree on a short list of experiments, this article could eventually be published in eLife provided the necessary changes are made. This is an interesting manuscript by Jaafar and colleagues who re-examine the models of translation by the HCV IRES with a lysate-based system, finding that the factor eIF1A (homolog of bacterial IF1) is surprisingly required for efficient translation by type 3 IRESs. They additionally argue that other factors suggested to impact this IRES-mediated reaction, eIF2A and eIF2D, play no critical role in this process, and that tRNA can be loaded independently of eIF2A in a fashion that in some ways reflects a more "bacterial" event. They also argue that the IRES remodels PICs rather than binding the naked 40S subunit in the first step of initiation. Overall, the three reviewers were broadly enthusiastic, though as a group, it was felt that certain critical controls and quantification were lacking, and that conclusions in a number of places needed to be more cautious. The main issues had to do first with the possibility that additional components (eIF2A, eIF3 or tRNA) were removed by the aptamer during the depletion experiments, and whether that explains the fact that activity was not fully restored when eIF1A was added back. We agree that this is an important control for eIF2 and eIF3. However, checking for direct aptamer interaction with tRNAi is confounded by the fact that we expect tRNAi to no longer bind to the PIC if eIF1A is depleted. This is the conclusion we make from the data presented in Figure 5 and Figure 5—figure supplement 1. In other words, tRNAi loss is not a control, it is an experimental result that supports our model. We have added this control to Figure 2B. The results show that the occupancy of other needed factors (eIF2, eIF3) is not affected by the aptamer. Other concerns related to the absence of quantification of western blots throughout and to over-simplifications of more complex data (e.g. reviewer 2’s second comment concerning the impact of eIF1A on three different viruses HCV, CSFV and SPV-1). We were hesitant to include quantitative data, as these experiments were designed to be qualitative in nature. Quantitation between experiments is tricky, even when the trends are clear. However, we agree that this is helpful in supporting our data in key places, and have added quantitation where appropriate. We include quantitated and normalized data from multiple blots in a graph form in Figure 1D. To avoid complicating Figure 4, we have included quantitated data in tabular form in Figure 4—figure supplement 2. As described in more detail in the responses to the individual reviewers, we have added discussion in several places in the manuscript to clarify and avoid oversimplification. Finally, while several reviewers appreciated the comparison of the IRES system to that of bacteria (in its reliance on eIF1A and an eIF2A-independent tRNA loading step), reviewer 3 felt that this parallel was overstated given the lack of a role for eIF1 and the contributions of eIF3. As such, this story line should be eliminated or minimally more carefully states. We point out that the absence of a role for eIF1 is, in fact, fully consistent with bacterial initiation in that eIF1’s homolog, IF3, is not universally present in all bacterial species. Also, the role of eIF3 is still poorly defined; it is possible that eIF3 is needed only to prepare the PIC during recycling and not for subsequent HCV IRES-specific steps. Nonetheless, we agree that this conclusion could be tempered. We have adjusted the manuscript to not overstate this point, to include altering the title. Finally, reviewer 3 had substantial concerns about DTT vs. thapsigargin stress and the lack of a positive control for these stress conditions. We agree, there were a few important controls that were conducted but not included in the original manuscript. We have added these. We have added additional experiments with DTT to parallel the thapsigargin treatment; these are included in Figure 5—figure supplement 2C&D. Controls in the form of detection of eIF2-α phosphorylation and translation of eIF2-dependent or eIF2-independent messages are in Figure 4—figure supplement 1B, D&E. Reviewer #1: […]Major points: 1) eIF2α appears to be pulled down with eIF1A-aptamer complex, in addition to eIF1A ( We agree that this is an important control. We have added this control to Figure 2B. The results show that the occupancy of other needed factors (eIF2, eIF3) is not affected by the aptamer at the stated concentration. 2) The authors state in paragraph two “HCV IRES RNA manipulates preassembled PICs and stabilizes eIF1A binding”, that the addition of WT IRES caused a displacement of eIF2α in stressed and unstressed cells, while eIF3 and eIF1A remained bound. However, 1A seems to be displaced to the same extent that eIF2α was displaced in both conditions. Thus, when eIF2α was not present, eIF1A was also not present ( We disagree with the reviewer on this point. In the stressed cells (Figure 4B), eIF2α is undetected in all lanes, but eIF1A is clearly still bound to similar levels both in the presence and absence of HCV IRES. In the absence of stress, eIF2α is present but its occupancy is decreased when the IRES binds, but eIF1A remains bound. Hence, the blots show independence of these two factors. We have not made specific changes, as we feel the observations are correct as reported. Reviewer #2: […] Major Comments 1) Throughout the manuscript, the analysis of the western blot data are described and presented qualitatively. The authors should provide a more quantitative analysis by measuring band intensities, normalizing to the loading control (rpS6) and reporting fold changes. We were hesitant to include quantitative data; these experiments were designed to be qualitative in nature. Quantitation between experiments is tricky, even when the trends are clear. However, we agree that this is helpful in supporting our data in key places, and have added quantitation where appropriate. We include quantitated and normalized data from multiple blots in a graph form in Figure 1D. To avoid complicating Figure 4, we have included quantitated data in tabular form in Figure 4—figure supplement 2. 2) The authors write: "Examination of the effect of eIF1A depletion on HCV, CSFV, and SPV-1 IRESs revealed a functional requirement for eIF1A in all three." However, We agree this this sentence oversimplified the result. The SPV-1 IRES shows some decrease in activity in RRL, but not to the degree that HCV and CSFV do. It shows little or no decrease in HeLa lysate. Interestingly, the SPV-1 IRES pulls down less eIF1A (Figure 1F). While we lack the data to present a detailed mechanistic explanation for these results, the data we do have speak to the idea that different type 3 IRESs have mechanistic variation. We have added a clearer description and explanation. 3) In several instances in the manuscript the authors state that deletion of the N-terminal tail of eIF1A lowers stringency followed by a reference for Fekete et al. (2007). However, in Fekete et al., the authors demonstrate that point mutations in the CTT of eIF1A reduce the stringency of start codon selection (Sui- phenotype) and thus result in increased initiation at a UUG codon. In addition, they showed that mutations in the NTT of eIF1A suppressed the Sui- phenotype (Ssu- phenotype) suggesting that NTT mutants of eIF1A reduce initiation at UUG codons. Thus, rather than supporting the authors' results and conclusions, this previously published article seems to contradict them. The authors should revise the appropriate sections of the manuscript. The roles for the N and C terminal tails of eIF1A are many and complex, and we agree that we did a poor job of explaining this and how it supports our data. We point out that while Fekete et al. (2007) do report a “hyperaccurate” phenotype when they mutate parts of the NTT, it is not clear that complete deletion of the tail would have the same effect, especially without other mutations also present. We have altered the language to be clearer about the possible interpretations of our results in light of the existing data on the tails of eIF1A 4) Regarding the data in This statement was based on the observation that while addition of △NNT-eIF1A to lysate depleted of eIF1A led to a full restoration of cap-dependent translation, it did not fully restore IRES-driven translation. However, we agree that there is some variability in the effect, and in some cases the add-back of △NNT-eIF1A and WT-eIF1A give similar effects. Overall, we agree that our statement may lead to some confusion; certainly it is not essential for the conclusions. We have removed this statement. 5) The authors propose a model in which the HCV IRES binds a pre-assembled PIC and alters its composition so as to favor 80S ribosome formation. However, it is also possible that the IRES simply binds to those PICs from which factors that are not present in the final HCV IRES-PIC have stochastically dissociated during incubation with the IRES RNA. The authors should acknowledge this possibility. We agree that we cannot completely exclude this possibility. However, the inclusion of a no-RNA control helps to address this. If factors tend to stochastically dissociate, they likely would not be present on the no-RNA control PICs, which were subjected to the same incubation and centrifugation as those with IRES. Any effects we see are due to the IRES, so even if factors do stochastically dissociate during incubation, the IRES would have to act to block their re-binding; essentially this is a form of remodeling to alter the composition of the PIC, albeit perhaps by a subtly different pathway. We have added a statement to address this possibility. 6) Regarding the data in We agree that the data indicate that △dII, with PICs from HeLa cells, does not show the same effect as with unstressed 293 cells. The reason is unclear, but could be due to subtle differences in the makeup or configuration of the PIC from these cells. Without deeper analysis, we are hesitant to ascribe a reason or significance to this, but we agree that it should be noted. We have added text noting and commenting on this observation. 7) eIF5 is an important component of the 43S IC that functions as a GTPase activating protein for eIF2, and also interacts with eIF3 and eIF1A during canonical translation initiation. Is there a reason why the authors did not probe for eIF5 in their PICs? The referee’s point is well taken as eIF5 is indeed a component of the 43S PIC. Though eIF5 is known to interact with multiple components of the PIC and the multifactor complex, its only known functions are to direct recruitment and GTPase activation of eIF2. We have examined the occupancy of eIF2 in our data; we feel the presence of eIF2 is sufficient to determine whether eIF5 could be functionally relevant. Further, Western blotting we have performed regarding the presence of eIF5 on IRES pull-down experiments do not detect eIF5 on the complexes pulled out of lysate. We have chosen not to include that information in order to avoid complicating Figures 1, 4, and 4—figure supplement 1 with negative data. Reviewer #3: […] This article’s work around eIF1A is quite convincing in showing the unexpected role of the factor in translation by the HCV IRES. eIF1A is not just a component of the HCV IRES PIC, but it removal reduces translation activity in lysate, and restoring the factor with purified protein appears to restore this loss. However, it is worth noting that in many cases the factor add-back is incomplete ( We agree that checking for an aptamer-induced loss of eIFs 2 and 3 is an important control. However, checking for direct aptamer interaction with tRNAi is confounded by the fact that we expect tRNAi to no longer bind to the PIC if eIF1A is depleted. This is the conclusion we make from the data presented in Figure 5 and Figure 5—figure supplement 1. In other words, tRNAi loss is not a control, it is an experimental result that supports our model. We have added a control to Figure 2B. The results show that the occupancy of other needed factors (eIF2, eIF3) is not affected by the aptamer. Moreover, several blots ( In fact, these blots were exposed to a degree that even residual protein would be seen. Every protein that we blot for is detected on one of the two panels, which represent a single experiment. In their assessment of the role of eIF2A and eIF2D, I am concerned about the use of thapsigargin as the stressor and the lack of a positive control for inactivating the IRES under stress ( Our choice of thapsigargin was made to exactly replicate previously published results exploring eIF2A and 2D (Kim et al., 2011). However, to better explore this, we repeated the experiment with DTT. With these experiments, we also included eIF1A knockdown as a positive control for HCV IRES inhibition under stress. We have added the results of these experiments to Figure 5—figure supplement 2 To make these experiments conclusive, it would be important to demonstrate that eIF2α is phosphorylated under these conditions and the inclusion of a knockdown that actually reduces luciferase activity in These are good controls, and we agree that we should have included them. The treatment with thapsigargin is unlikely to switch the IRES into this mode, given the very special conditions needed to achieve 80S formation on the IRES with no factors in vitro. However, the eIF1A control now accounts for this, showing that under stress, the IRES still requires this factor. We have included a blot showing induced eIF2α phosphorylation induced by different stressors in Figure 4—figure supplement 1B, as well as controls for the effect on cap-dependent translation and two other IRESs known to be eiF2-dependent or eIF2-independent in Figure 4—figure supplement 1. Also, as mentioned above, Figure 5—figure supplement 2 contains the results of an eIF1A knockdown under stress. The authors make the case that the IRES remodels PICs rather than binding the naked 40S subunit in the first step of initiation. While this is certainly plausible, and it is possible that eIF1A stays bound following IRES binding, their data does not show that the IRES actively remove eIF3 to position it at a new location (eIF3 could simply disassociate and rebind, since their experiments are not done under dilute conditions). Given that this conclusion is featured prominently in their title, Abstract, Discussion, and This matches the point of Reviewer 2, point 5, above. As stated above, we agree that we cannot completely exclude this possibility. However, by comparing the No RNA and WT IRES lanes, it is clear that the effects we see are due to the IRES. If the IRES actively dissociates eIF3 during incubation then the factor rebinds in a new way; we would say that this is still a form of remodeling, albeit perhaps by a subtly different pathway. We have added a statement to address this possibility. Contrary to what the authors have stated (Discussion paragraph seven) the IRES does not have much similarity in contacts with eIF3 and does eIF4G, as the former interacts with the IRESs predominantly through the subunit a and c, while the latter interacts with subunits c, d, and e (per their references). This comparison has been made previously by other (Siridechadilok et al. 2005) and is clearly incompatible based on current structural models. We agree that this may be over-reaching a bit. We have removed this statement. Finally, while aspects of the IRES translation might be considered "bacterial-like" this comparison is generally out of place, especially given the lack of a SD sequence, the absence of eIF1 function (IF3 analog), and the utilization of eIF3, which is nowhere in bacteria. We point out that the absence of a role for eIF1 is, in fact, fully consistent with bacterial initiation in that eIF1’s homolog, IF3, is not universally present in all bacterial species. Also, the role of eIF3 is still poorly defined; it is possible that eIF3 is needed only to prepare the PIC during recycling and not for subsequent HCV IRES-specific steps. We do not claim that IRES recruitment of the small subunit is bacterial-like (although this analogy has been made by others), but that tRNA binding has aspects similar to that in bacteria. Nonetheless, we agree that this conclusion could be tempered. We have adjusted the manuscript to not overstate this point, to include altering the title.

Primer name

Sequence 5’−3’

HCV F

CTCCCCTGTGAGGAACTACTGTCTT

CSFV F

CACCCCTCCAGCGACGGCCGAAC

SPV-1 F

GTGGTAAGTGATGTTAGTCATTG

CrPV F

AGCAAAAATGTGATCTTGCTTGTA

CSFV R

GGTATAAAAGTTCAAAGTGATTCAACTC

SPV-1 R

CTCCGAGGAGTCATCCTCATAGATTGCCATCTTAGAGAATGTCTT

eIF1A_WT F

ATGCCCAAGAATAAAGGTAAAGGAG

eIF1A_WT R

TTATCATGCGGCCGCAAGCTTGATGATGTC

eIF1A_ΔNTT F

TCTGAAAAAAGAGAACTGGTATTC

eIF1A_ΔCTT R

TTATCAAGTTTCATTGATTTTAGCATGC

CSFV_ΔdII F

ACTAGCCGTAGTGGCGAG

HCV_ ΔdII F

ACCCCCCCTCCCGCCGGGAGAG

SPV-1_ ΔdII F

ACACGACCGTACACGAAAG

α-eIF1A aptamer

GGGACACAAUGGACGAUGAGUUAGCAUCCGUGUCCAAGCUCAUGUCGUUUAGAACUAACGGCCGACAUGAGAG

AS-eIF1A aptamer

CUCUCAUGUCGGCCGUUAGUUCUAAACGACAUGAGCUUGGACACGGAUGCUAACUCAUCGUCCAUUGUGUCCC

18S northern probe

CCATCCAATCGGTAGTAGCG

tRNAMeti Northern probe

TAGCAGAGGATGGTTTCGATCCATCGACCTCTGGGTTATGGGCC

tRNAMete Northern probe

TGCCCCGTGTGAGGCTCGAACTCACGACCTTCAGATTATGAGACTG

5’ T7 extension

TAATACGACTCACTATAGGG

DBS BamHI R

CCCTAACTGACACACATTCCACAGC

  78 in total

1.  GTP-dependent recognition of the methionine moiety on initiator tRNA by translation factor eIF2.

Authors:  Lee D Kapp; Jon R Lorsch
Journal:  J Mol Biol       Date:  2004-01-23       Impact factor: 5.469

2.  Ribosomal proteins mediate the hepatitis C virus IRES-HeLa 40S interaction.

Authors:  Geoff A Otto; Peter J Lukavsky; Alissa M Lancaster; Peter Sarnow; Joseph D Puglisi
Journal:  RNA       Date:  2002-07       Impact factor: 4.942

3.  eIF2-dependent and eIF2-independent modes of initiation on the CSFV IRES: a common role of domain II.

Authors:  Tatyana V Pestova; Sylvain de Breyne; Andrey V Pisarev; Irina S Abaeva; Christopher U T Hellen
Journal:  EMBO J       Date:  2008-03-13       Impact factor: 11.598

4.  Regulatory elements in eIF1A control the fidelity of start codon selection by modulating tRNA(i)(Met) binding to the ribosome.

Authors:  Adesh K Saini; Jagpreet S Nanda; Jon R Lorsch; Alan G Hinnebusch
Journal:  Genes Dev       Date:  2010-01-01       Impact factor: 11.361

5.  Structure of a yeast 40S-eIF1-eIF1A-eIF3-eIF3j initiation complex.

Authors:  Christopher H S Aylett; Daniel Boehringer; Jan P Erzberger; Tanja Schaefer; Nenad Ban
Journal:  Nat Struct Mol Biol       Date:  2015-02-09       Impact factor: 15.369

6.  The role of eIF-4C in protein synthesis initiation complex formation.

Authors:  H Goumans; A Thomas; A Verhoeven; H O Voorma; R Benne
Journal:  Biochim Biophys Acta       Date:  1980-06-27

7.  Initiation of protein synthesis by hepatitis C virus is refractory to reduced eIF2.GTP.Met-tRNA(i)(Met) ternary complex availability.

Authors:  Francis Robert; Lee D Kapp; Shakila N Khan; Michael G Acker; Sarah Kolitz; Shirin Kazemi; Randal J Kaufman; William C Merrick; Antonis E Koromilas; Jon R Lorsch; Jerry Pelletier
Journal:  Mol Biol Cell       Date:  2006-08-23       Impact factor: 4.138

Review 8.  Tricks an IRES uses to enslave ribosomes.

Authors:  Sunnie R Thompson
Journal:  Trends Microbiol       Date:  2012-08-31       Impact factor: 17.079

Review 9.  Regulation of stress granules in virus systems.

Authors:  James P White; Richard E Lloyd
Journal:  Trends Microbiol       Date:  2012-03-07       Impact factor: 17.079

10.  Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

Authors:  Nick Quade; Daniel Boehringer; Marc Leibundgut; Joop van den Heuvel; Nenad Ban
Journal:  Nat Commun       Date:  2015-07-08       Impact factor: 14.919

View more
  20 in total

1.  Ribosomal Protein L13 Promotes IRES-Driven Translation of Foot-and-Mouth Disease Virus in a Helicase DDX3-Dependent Manner.

Authors:  Shichong Han; Shiqi Sun; Pinghua Li; Qun Liu; Zhihui Zhang; Hu Dong; Mengmeng Sun; Wenxue Wu; Xiaojia Wang; Huichen Guo
Journal:  J Virol       Date:  2020-01-06       Impact factor: 5.103

Review 2.  Noncanonical Translation Initiation in Eukaryotes.

Authors:  Thaddaeus Kwan; Sunnie R Thompson
Journal:  Cold Spring Harb Perspect Biol       Date:  2019-04-01       Impact factor: 10.005

3.  A Unique ISR Program Determines Cellular Responses to Chronic Stress.

Authors:  Bo-Jhih Guan; Vincent van Hoef; Raul Jobava; Orna Elroy-Stein; Leos S Valasek; Marie Cargnello; Xing-Huang Gao; Dawid Krokowski; William C Merrick; Scot R Kimball; Anton A Komar; Antonis E Koromilas; Anthony Wynshaw-Boris; Ivan Topisirovic; Ola Larsson; Maria Hatzoglou
Journal:  Mol Cell       Date:  2017-12-07       Impact factor: 17.970

4.  Molecular architecture of 40S translation initiation complexes on the hepatitis C virus IRES.

Authors:  Zuben P Brown; Irina S Abaeva; Swastik De; Christopher U T Hellen; Tatyana V Pestova; Joachim Frank
Journal:  EMBO J       Date:  2022-07-13       Impact factor: 14.012

5.  Targeting of Hematologic Malignancies with PTC299, A Novel Potent Inhibitor of Dihydroorotate Dehydrogenase with Favorable Pharmaceutical Properties.

Authors:  Liangxian Cao; Marla Weetall; Christopher Trotta; Katherine Cintron; Jiyuan Ma; Min Jung Kim; Bansri Furia; Charles Romfo; Jason D Graci; Wencheng Li; Joshua Du; Josephine Sheedy; Jean Hedrick; Nicole Risher; Shirley Yeh; Hongyan Qi; Tamil Arasu; Seongwoo Hwang; William Lennox; Ronald Kong; Janet Petruska; Young-Choon Moon; John Babiak; Thomas W Davis; Allan Jacobson; Neil G Almstead; Art Branstrom; Joseph M Colacino; Stuart W Peltz
Journal:  Mol Cancer Ther       Date:  2018-10-23       Impact factor: 6.261

6.  Fluorescently-tagged human eIF3 for single-molecule spectroscopy.

Authors:  Alex G Johnson; Alexey N Petrov; Gabriele Fuchs; Karim Majzoub; Rosslyn Grosely; Junhong Choi; Joseph D Puglisi
Journal:  Nucleic Acids Res       Date:  2018-01-25       Impact factor: 16.971

Review 7.  The 5BSL3.2 Functional RNA Domain Connects Distant Regions in the Hepatitis C Virus Genome.

Authors:  Cristina Romero-López; Alfredo Berzal-Herranz
Journal:  Front Microbiol       Date:  2017-10-31       Impact factor: 5.640

Review 8.  The tale of two flaviviruses: subversion of host pathways by RNA shapes in dengue and hepatitis C viral RNA genomes.

Authors:  Shwetha Shivaprasad; Peter Sarnow
Journal:  Curr Opin Microbiol       Date:  2020-10-16       Impact factor: 7.934

9.  Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

Authors:  Margaret M Willcocks; Salmah Zaini; Nathalie Chamond; Nathalie Ulryck; Delphine Allouche; Noemie Rajagopalan; Nana A Davids; Ulrik Fahnøe; Johanne Hadsbjerg; Thomas Bruun Rasmussen; Lisa O Roberts; Bruno Sargueil; Graham J Belsham; Nicolas Locker
Journal:  Nucleic Acids Res       Date:  2017-12-15       Impact factor: 16.971

10.  The Initiation Factors eIF2, eIF2A, eIF2D, eIF4A, and eIF4G Are Not Involved in Translation Driven by Hepatitis C Virus IRES in Human Cells.

Authors:  Esther González-Almela; Hugh Williams; Miguel A Sanz; Luis Carrasco
Journal:  Front Microbiol       Date:  2018-02-13       Impact factor: 5.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.