Literature DB >> 27681377

Investigation of Streptococcus salivarius-mediated inhibition of pneumococcal adherence to pharyngeal epithelial cells.

Jayne Manning1,2, Eileen M Dunne1, Philip A Wescombe3, John D F Hale3, E Kim Mulholland1,4, John R Tagg3,5, Roy M Robins-Browne6,2, Catherine Satzke7,8,9.   

Abstract

BACKGROUND: Pneumococcal adherence to the nasopharyngeal epithelium is a critical step in colonisation and disease. The probiotic bacterium, Streptococcus salivarius, can inhibit pneumococcal adherence to epithelial cells in vitro. We investigated the mechanism(s) of inhibition using a human pharyngeal epithelial cell line (Detroit 562) following pre-administration of two different strains of S. salivarius.
RESULTS: Whilst the bacteriocin-encoding megaplasmids of S. salivarius strains K12 and M18 were essential to prevent pneumococcal growth on solid media, they were not required to inhibit pneumococcal adherence. Experiments testing S. salivarius K12 and two pneumococcal isolates (serotypes 19F and 6A) showed that inhibition of 19F may involve S. salivarius-mediated blocking of pneumococcal binding sites: a negative correlation was observed between adherence of K12 and 19F, and no inhibition occurred when K12 was prevented from contacting epithelial cells. K12-mediated inhibition of adherence by 6A may involve additional mechanisms, since no correlation was observed between adherence of K12 and 6A, and K12 could inhibit 6A adherence in the absence of cell contact.
CONCLUSIONS: These results suggest that S. salivarius employs several mechanisms, including blocking pneumococcal binding sites, to reduce pneumococcal adherence to pharyngeal epithelial cells. These findings extend our understanding of how probiotics may inhibit pneumococcal adherence and could assist with the development of novel strategies to prevent pneumococcal colonisation in the future.

Entities:  

Keywords:  Adherence; Colonisation; Pneumococcus; Probiotic mechanisms; Probiotics; Respiratory tract; Streptococcus pneumoniae; Streptococcus salivarius

Year:  2016        PMID: 27681377      PMCID: PMC5041332          DOI: 10.1186/s12866-016-0843-z

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Streptococcus pneumoniae (the pneumococcus) commonly colonises the nasopharynx of healthy humans, especially young children. Carriage is considered a prerequisite for pneumococcal disease and facilitates the transmission of pneumococci throughout communities [1]. Dissemination of pneumococci from the nasopharynx to other body sites can give rise to diseases such as meningitis, sepsis, pneumonia, and otitis media. An estimated 800,000 children under the age of five die from pneumococcal infections each year, with most deaths occurring in low-income countries where carriage rates are especially high [2]. Strategies targeting the reduction of pneumococcal colonisation could potentially reduce this burden of disease. Current pneumococcal conjugate vaccines (PCVs) induce protection against 10–13 of the most common disease-causing serotypes via the induction of anti-capsular antibodies. Although PCVs have successfully reduced carriage and disease caused by vaccine serotypes, they are expensive to produce and have led to an increase in colonisation by non-vaccine serotypes (serotype replacement) [3]. In recent years, there has been increased interest in the use of probiotics, which are defined as live microorganisms that can confer a health benefit to the host, to reduce pathogen colonisation and respiratory tract infections [4]. Proposed mechanisms of probiotic action include inhibition of pathogen colonisation via competition for binding, direct inhibition due to the activity of secreted antimicrobial molecules and the induction of immunomodulatory effects in the host [5-9]. Streptococcus salivarius is a member of the respiratory tract microbiota and has been commercially available as an oral probiotic for more than a decade [10]. Small clinical trials have shown that administration of S. salivarius strains K12 and M18 can reduce the occurrence of tonsillitis and otitis media [11] and reduce dental plaque levels in children [12], as well as treat halitosis in adults [13]. Several in vitro studies have found that S. salivarius can prevent the growth of a range of respiratory pathogens, including the pneumococcus, through production of megaplasmid-encoded bacteriocins and bacteriocin-like inhibitory substances (BLIS) [7, 14–16]. However, the mechanisms by which they inhibit pathogen adherence in vivo are unknown. We have previously shown that S. salivarius K12 can inhibit pneumococcal adherence to a human epithelial cell line (CCL-23) [17]. Here, we demonstrate that the same phenomenon is observed in Detroit 562 pharyngeal epithelial cells and investigate the inhibitory mechanisms involved, including the role of the S. salivarius megaplasmid. Our results suggest that S. salivarius K12 inhibits pneumococcal adherence by blocking pneumococcal binding sites, although other mechanisms such as direct interference through the action of secreted molecules may also contribute.

Methods

Bacterial strains, cell lines and culture conditions

Bacterial isolates are described in Tables 1 and 2. Pneumococcal isolates were selected to represent a range of serotypes and based on their ability to adhere to human epithelial cells. S. salivarius isolates were sourced from Blis Technologies Ltd, New Zealand. All isolates were cultured at 37 °C in 5 % CO2 on horse blood agar (HBA; Thermo Fisher Scientific) plates, in Todd-Hewitt broth (THB; Oxoid), or THB supplemented with 0.5 % (w/v) yeast extract (THY; Becton Dickinson). Deferred antagonism testing was carried out on BaCa (Columbia agar base; Life Technologies Ltd.) plates supplemented with human blood (5 %, v/v) and CaCO3 (0.1 %, w/v) except where noted.
Table 1

Streptococcus salivarius isolates used in this study

S. salivarius isolateKnown bacteriocins
K12SalA, SalB
K12 mp−
M18SalA, Sal9, SalM
M18 mp−
A234SalA
NRSalB
T18ASalA, SalB
T30AUnknown
Min5SalA, SalB
20P3SalA

SalA: salivaricin A [36]; SalB: salivaricin B [23]; Sal9: salivaricin 9 [37]; SalM: salivaricin M [24]; mp: megaplasmid

Table 2

Pneumococcal isolates used in this study

Pneumococcal isolateSerotypeOrigin
PMP10811Australia
PMP2783Fiji
PMP2414South Africa
PMP8125Bangladesh
PMP6 (ATCC® 6305™)5Germany
PMP10436AUSA
PMP176AFiji
PMP4346BFiji
PMP4376CFiji
PMP10867FAustralia
PMP2969VFiji
PMP13014Fiji
PMP22218CSouth Africa
PMP84319FUSA
PMP29219AFiji
PMP28322FUnknown
Streptococcus salivarius isolates used in this study SalA: salivaricin A [36]; SalB: salivaricin B [23]; Sal9: salivaricin 9 [37]; SalM: salivaricin M [24]; mp: megaplasmid Pneumococcal isolates used in this study The Detroit 562 pharyngeal epithelial carcinoma cell line (ATCC CCL-138) was maintained in RPMI 1640 (Sigma-Aldrich) supplemented with 10 % (v/v) foetal bovine serum (FBS, Thermo Fisher Scientific). Monolayers were released by incubation with 0.25 % trypsin/EDTA (0.25 % (w/v) trypsin, 0.1 mM EDTA, Life Technologies) for 10 min at 37 °C in 5 % CO2 and seeded into 24-well trays at a concentration of 1.5 × 105 cells/well in RPMI supplemented with 5 % FBS for use in adherence assays.

Deferred antagonism testing

Testing for deferred antagonism was performed as described previously [18]. Briefly, overnight THB cultures of S. salivarius (producer strain) were used to inoculate a 1-cm-wide line down the middle of a human blood agar plate (as described above). Plates were incubated for 18 h at 37 °C in 5 % CO2, S. salivarius growth was removed, and the plate inverted over a chloroform-soaked cloth for 30 min to kill any remaining bacteria. Residual chloroform was then evaporated by exposure of the agar surface to air for 30 min. Overnight THB cultures of pneumococcal indicator strains were then streaked at right angles to the previously grown S. salivarius and incubated for a further 12–16 h. Plates were examined for growth where S. salivarius had previously grown, and prevention of pneumococcal growth recorded as + (observed) or – (not observed).

Adherence assays

Adherence assays were performed as described previously [17] with several modifications. D562 cells seeded into 24-well trays were washed twice with Hanks buffered salt solution (HBSS; Gibco®, Life Technologies) before the addition of 500 μl/well RPMI without serum. Bacteria were grown to log phase in THY (S. salivarius: 1.5 h, pneumococci: 3 h) and resuspended in 0.85 % (w/v) NaCl (Merck) to ~1.5 × 109 CFU/ml. A 10-fold dilution series of S. salivarius was prepared in 0.85 % NaCl and 10 μl aliquots of high (~1.5 × 107 CFU/well), medium (~1.5 × 106 CFU/well), and low (~1.5 × 105 CFU/well) concentrations of bacteria were administered to duplicate wells before centrifugation at 114 × g for 3 min to promote bacterial adherence to the cell monolayer. Plates were incubated at 37 °C in 5 % CO2 for 1 h. Pneumococci were prepared as above and added to all wells at a concentration of ~1.5 × 106 CFU/well (MOI of 10 pneumococci: 1 D562 cell) 1 h after S. salivarius. Centrifugation was performed as above and plates were incubated for a further 1 h. Cells (and adherent bacteria) were then washed three times with HBSS and harvested after the addition of 200 μl 0.25 % trypsin/EDTA to each well, incubation for 10 min at 37 °C in 5 % CO2, and addition of 800 μl of THY to each well with mechanical disruption. Lysates were stored at −20 °C until tested. Pneumococcal adherence (genome copies/well) was determined by quantitative real-time PCR (qPCR) targeting lytA (see below). The effect of bacterial infection on D562 cells was monitored microscopically and no significant cytopathic effects were observed during the adherence assay conditions. The effect of S. salivarius on pneumococcal adherence was calculated by normalising all treatments against wells containing pneumococci alone. The ability of the pneumococcal isolates to invade cells was measured by incubating cells with media containing 10 μg/ml penicillin and 200 μg/ml gentamicin for 15 min after incubation with pneumococci for 1 h (Additional file 1), confirming the validity of this model to investigate adherence. The adherence of S. salivarius to D562 cells at the time of pneumococcal administration was calculated following incubation of ~1.5 × 106 CFU/well bacteria for 1 h at 37 °C in 5 % CO2. Cells were washed three times with HBSS to remove non-adherent bacteria and harvested as above. CFU/well was determined by viable count on HBA plates and expressed as mean % adherence ± standard deviation compared to the inoculum added. We performed preliminary experiments to determine whether heparin, which can inhibit pneumococcal adherence to epithelial cells in vitro by competitively binding to glycosylaminoglycans [19], could also inhibit S. salivarius adherence to D562 cells. Cells were incubated with 100 U/well of heparin (Pfizer) for 1 h before the addition of S. salivarius as above and results expressed as % adherence compared to S. salivarius without heparin. S. salivarius adherence to D562 cells over time was measured by qPCR targeting dex (see below). We also investigated whether non-adherent S. salivarius had an effect on pneumococcal adherence. To do this, adherence assays were performed as described above, except that wells were washed three times with HBSS to remove unbound S. salivarius and fresh medium was added after S. salivarius pre-administration and before the addition of pneumococci. To determine the inhibitory effect of S. salivarius in the absence of cell contact, S. salivarius was pre-administered to D562 cells via permeable transwell inserts with a pore size of 0.4 μm (Corning, In vitro Technologies). To further investigate the mechanisms involved in the inhibition of pneumococcal adherence, preparations of K12 were: a) heat-killed by incubating at 70 °C for 30 min with their lack of viability confirmed by the absence of growth on HBA; b) enzymatically treated to remove outer surface proteins and carbohydrates of S. salivarius K12 by (i) resuspending K12 inocula in a final concentration of 5 mg/ml pronase E [20], or (ii) by the addition of 5 μl of 1 mg/ml sodium periodate [21] to K12 inocula prepared in 0.85 % NaCl for 15 min at 37 °C in 5 % CO2, and c) reducing K12 protein synthesis by resuspending K12 inocula in 2 mg/ml spectinomycin and incubating for 30 min at 37 °C in 5 % CO2. Following all treatments, K12 inocula were washed twice in 0.85 % NaCl prior to use in adherence assays.

qPCR

DNA extraction and pneumococcal qPCR assays were performed as described previously [17]. Primers (Sigma Aldrich) and dual-labelled probes (Eurogentec) were designed to detect chromosomal (dextranase gene, dex) and megaplasmid (mp) target sequences in S. salivarius. Primer/probe sequences and final concentrations were as follows: dexF2: TGAAGCAGATAACTTGGTGGTG (300 nM); dexR2: CTCTCTGCTGGCACAGCTT (300 nM); dex probe2: HEX-AGAAGTAGGTCCATCATCTGCC-3′-BHQ-1 (75 nM); mpF: AAGCCTTGTGCATCGACTCT (200nM); mpR: AACCAAGACGCGACTGTTGA (200 nM); mp probe: FAM-TGACCCTTTTTGTTGGTCGT-3′-BHQ-1 (300 nM). Specificity of both assays was confirmed by sequencing the amplified product and testing against a panel of closely related streptococcal species (Additional file 2: Table S1). qPCR reactions were carried out in duplicate using Agilent Brilliant III master mix (Agilent Technologies, Integrated Sciences), containing 1 μl of template DNA in 25 μl final volume using a Stratagene Mx3005P qPCR machine (Agilent Technologies). The cycling conditions were: 1 × 3 min at 95 °C, 40 × 20 s at 95 °C followed by 20 s at 60 °C. Pneumococcal and S. salivarius DNA was quantified using standard curves of reference strain isolates (ATCC 6305 and K12, respectively) and bacterial loads were calculated as described previously [22], based on 1 pg of genomic DNA being equivalent to 447.4 pneumococcal cells and 422.1 S. salivarius cells (assuming one genome per cell, and one copy of the target gene per genome).

Statistical analysis

Data were analysed using Prism 6.0d (GraphPad Software, Inc.) and Excel (Microsoft). Student’s t-test was used to compare pneumococcal adherence in all treatment groups. Spearman’s rank test was used to correlate pneumococcal and S. salivarius K12 adherence in adherence assays. A p value of < 0.05 was considered statistically significant for all assays. For all experiments n ≥ 3 unless otherwise stated.

Results

S. salivarius reduces pneumococcal adherence to pharyngeal epithelial cells

Previous studies in our laboratory demonstrated that S. salivarius K12 inhibits pneumococcal adherence to CCL-23 human epithelial cells in vitro, with the strongest effect seen when K12 was added before pneumococci (pre-administration). In this study, we investigated the mechanisms underlying this inhibition using a cell line more relevant to the pneumococcal ecological niche of the nasopharynx, Detroit 562 human pharyngeal epithelial cells (D562), and two isolates representing serotypes that commonly colonise (6A [PMP1043] and 19F [PMP843]). Pneumococcal adherence was measured following pre-administration of commercial probiotic S. salivarius strains K12 or M18 at high, medium and low doses. All doses of K12 significantly inhibited 6A and 19F adherence (p < 0.001, Fig. 1). All doses of M18 inhibited 6A adherence (high: p < 0.001, medium: p < 0.001, low: p = 0.023, Fig. 1a), but only the high dose inhibited 19F adherence (p < 0.001, Fig. 1b). K12 adherence to D562 cells was higher than that of M18 (532.3 ± 86.49 % vs. 12.5 ± 8.14 %, p < 0.001). Heparin, which is known to inhibit pneumococcal adherence to epithelial cells by competing for binding to cell surface glycosylaminoglycans [19], did not affect S. salivarius K12 adherence to D562 cells (115.8 ± 27.81 %, p = 0.380, Student's t-test).
Fig. 1

Pneumococcal adherence of serotypes 6A (a) and 19F (b) to pharyngeal epithelial cells following pre-administration of S. salivarius. Approximately 1.4 × 106 CFU pneumococci were added to D562 monolayers at an MOI of 11:1. Pneumococcal adherence was determined when incubated with pneumococci alone (Pnc, normalised to 100 %), or pre-incubated for 1 h with S. salivarius K12 or M18 at high (~1.6 × 107 CFU), medium (~1.6 × 106 CFU), or low (~1.6 × 105 CFU) doses. Data are mean + SD; n ≥ 3. * indicates p < 0.05, ** indicates p < 0.001 when compared to Pnc alone (Student’s t-test)

Pneumococcal adherence of serotypes 6A (a) and 19F (b) to pharyngeal epithelial cells following pre-administration of S. salivarius. Approximately 1.4 × 106 CFU pneumococci were added to D562 monolayers at an MOI of 11:1. Pneumococcal adherence was determined when incubated with pneumococci alone (Pnc, normalised to 100 %), or pre-incubated for 1 h with S. salivarius K12 or M18 at high (~1.6 × 107 CFU), medium (~1.6 × 106 CFU), or low (~1.6 × 105 CFU) doses. Data are mean + SD; n ≥ 3. * indicates p < 0.05, ** indicates p < 0.001 when compared to Pnc alone (Student’s t-test) K12 adherence showed significant negative correlation with 19F adherence but not with 6A adherence (19F: r = −0.68, p = 0.002; 6A: r = −0.12, p = 0.66; Fig. 2). Significant inhibition of pneumococcal adherence was also observed following removal of non-adherent K12 by washing prior to the addition of pneumococci (Direct + wash, Table 3: all doses p < 0.001).
Fig. 2

Correlation of adherence of S. salivarius K12 and pneumococcal serotype 6A (a) and 19F (b) adherence to pharyngeal epithelial cells. Adherence of S. salivarius and pneumococci to D562 monolayers was determined following pre-incubation for 1 h with high (~1.6 × 107 CFU), medium (~1.6 × 106 CFU), or low (~1.6 × 105 CFU) doses of S. salivarius K12 and subsequent incubation with ~1.4 × 106 CFU pneumococci for 1 h. r = Spearman rank correlation coefficient

Table 3

Pneumococcal adherence to pharyngeal epithelial cells following pre-administration of S. salivarius K12 by various methods

Pneumococcal adherencea
DirectTranswellDirect + wash
Pneumococcal serotypeK12 Dosec % (95 % CI) p valueb % (95 % CI) p valueb % (95 % CI) p valueb
6AHigh16.6 (6.8, 26.5)<0.00190.5 (23.9, 157.1)0.69825 (12.5, 37.4)<0.001
Medium19.6 (14.7, 24.4)<0.00161.5 (18.4, 104.5)0.04945.2 (21.9, 68.5)<0.001
Low35.4 (12.3, 58.5)<0.00144.1 (22.8, 65.5)<0.00145.1 (29.1, 61.1)<0.001
19FHigh10.4 (2.5, 18.4)<0.00184.7 (33.6, 135.7)0.33841.8 (17.6, 66.4)<0.001
Medium21.8 (1.7, 41.8)<0.001121.3 (16.5, 226.2)0.58131.4 (13.2, 49.6)<0.001
Low50.7 (33.8, 67.5)<0.001102.2 (33.7, 170.5)0.93345.3 (16.7, 74.0)<0.001

aDirect: pre-administration of K12 directly onto D562 monolayer; Transwells: pre-administration of K12 via transwell inserts; Direct + wash: pre-administration of K12 directly onto D562 monolayers followed by a washing step to remove non-adherent K12

b p values calculated from pneumococcal adherence alone compared to pneumococcal adherence following different methods of K12 pre-administration (Student’s t test, *p < 0.05)

cHigh: ~1.5 × 107 CFU/ml; Medium: ~1.5 × 106 CFU/ml and Low: ~1.5 × 105 CFU/ml

Correlation of adherence of S. salivarius K12 and pneumococcal serotype 6A (a) and 19F (b) adherence to pharyngeal epithelial cells. Adherence of S. salivarius and pneumococci to D562 monolayers was determined following pre-incubation for 1 h with high (~1.6 × 107 CFU), medium (~1.6 × 106 CFU), or low (~1.6 × 105 CFU) doses of S. salivarius K12 and subsequent incubation with ~1.4 × 106 CFU pneumococci for 1 h. r = Spearman rank correlation coefficient Pneumococcal adherence to pharyngeal epithelial cells following pre-administration of S. salivarius K12 by various methods aDirect: pre-administration of K12 directly onto D562 monolayer; Transwells: pre-administration of K12 via transwell inserts; Direct + wash: pre-administration of K12 directly onto D562 monolayers followed by a washing step to remove non-adherent K12 b p values calculated from pneumococcal adherence alone compared to pneumococcal adherence following different methods of K12 pre-administration (Student’s t test, *p < 0.05) cHigh: ~1.5 × 107 CFU/ml; Medium: ~1.5 × 106 CFU/ml and Low: ~1.5 × 105 CFU/ml

The K12 megaplasmid is essential to prevent pneumococcal growth but not adherence

The megaplasmids of S. salivarius K12 and M18 encode bacteriocins that prevent the growth of a range of bacterial species on solid media [14, 16, 23, 24], but their roles in inhibition of pneumococcal growth or adherence are unknown. We compared the ability of K12, M18, their megaplasmid-negative derivatives, and a panel of S. salivarius strains to inhibit the growth of 15 pneumococcal isolates by deferred antagonism. S. salivarius strains K12, M18, A234, NR, T18A and Min5 inhibited all of the pneumococcal isolates tested (Table 4). Neither megaplasmid-negative strain (K12mp− or M18mp−) or strain T30A prevented the growth of any of the pneumococcal isolates tested (Table 4).
Table 4

Deferred antagonism of S. salivarius strains against a panel of pneumococcal isolates

S. salivarius producer strain
Pneumococcal test strainSerotypeK12K12 mp− M18M18 mp− A234NRT18AT30AMin520P3
PMP10811+++++++
PMP2783+++++++
PMP2414++++++
PMP8125+++++++
PMP10436A++++++
PMP176A+++++++
PMP4346B+++++++
PMP4376C+++++++
PMP10867F+++++++
PMP2969V+++++++
PMP13014++++++
PMP22218C+++++++
PMP29219A++++++
PMP843a 19F++NTNTNTNTNTNT
PMP28322F+++++++

“+” indicates inhibition of pneumococcal growth and “−" indicates no inhibition, n = 2

NT not tested

aperformed on horse blood agar plates

Deferred antagonism of S. salivarius strains against a panel of pneumococcal isolates “+” indicates inhibition of pneumococcal growth and “−" indicates no inhibition, n = 2 NT not tested aperformed on horse blood agar plates Since the S. salivarius megaplasmids were essential to prevent the growth of pneumococci, and K12 caused a greater reduction in pneumococcal adherence than M18 (Fig. 1), we next compared the ability of K12 and K12 mp− strains to inhibit pneumococcal adherence to D562 cells. Although the exact copy number of the megaplasmid is unknown, preliminary qPCR analysis confirmed that the ratio of K12 chromosomal DNA to megaplasmid DNA remained stable during bacterial growth (1.43, n = 1) and throughout assay conditions (1.17 and 1.20 after 1 and 2 h incubation with D562 monolayer, respectively, n = 1). All doses of K12 mp− significantly inhibited 6A adherence (high: p < 0.001, medium: p < 0.001, low: p = 0.016, Fig. 3a). When compared to K12, there was some evidence that the K12 mp− strain resulted in less inhibition than the K12 strain, but this difference was only statistically significant at the high dose (p = 0.044, Fig. 3a). For the 19F strain, only the high and medium doses of K12 mp− significantly inhibited pneumococcal adherence. We found no differences in the ability of K12 and K12 mp− to adhere to D562 cells (532 ± 86.49 % vs. 511 ± 6.92 %, p = 0.695) or in their adherence to D562 cells over time (Fig. 4, p > 0.05 for all time points).
Fig. 3

Adherence of pneumococcal serotypes 6A (a) and 19F (b) to pharyngeal epithelial cells following pre-administration of megaplasmid positive (K12) and negative (K12 mp−) S. salivarius K12 strains. Approximately 1.5 × 106 CFU pneumococci were added to D562 monolayers at an MOI of 10:1. Pneumococcal adherence was determined when incubated with pneumococci alone (Pnc, normalised to 100 %), or pre-incubated for 1 h with S. salivarius K12 or S. salivarius K12mp - at high (~2 × 107 CFU); medium (~2 × 106 CFU, med); or low (~2 × 105 CFU) doses. Data are mean + SD; n ≥ 6. * indicates p < 0.05, ** indicates p < 0.001 when compared to Pnc alone (Student’s t test)

Fig. 4

Time course of S. salivarius adherence to D562 cells. Cells were inoculated with either ~1.1 × 105 CFU of S. salivarius K12 or ~1.9 × 105 CFU of S. salivarius K12mp- and the number of adherent bacteria measured over three hours. Median ± IQR for both S. salivarius isolates are depicted (n ≥ 2)

Adherence of pneumococcal serotypes 6A (a) and 19F (b) to pharyngeal epithelial cells following pre-administration of megaplasmid positive (K12) and negative (K12 mp−) S. salivarius K12 strains. Approximately 1.5 × 106 CFU pneumococci were added to D562 monolayers at an MOI of 10:1. Pneumococcal adherence was determined when incubated with pneumococci alone (Pnc, normalised to 100 %), or pre-incubated for 1 h with S. salivarius K12 or S. salivarius K12mp - at high (~2 × 107 CFU); medium (~2 × 106 CFU, med); or low (~2 × 105 CFU) doses. Data are mean + SD; n ≥ 6. * indicates p < 0.05, ** indicates p < 0.001 when compared to Pnc alone (Student’s t test) Time course of S. salivarius adherence to D562 cells. Cells were inoculated with either ~1.1 × 105 CFU of S. salivarius K12 or ~1.9 × 105 CFU of S. salivarius K12mp- and the number of adherent bacteria measured over three hours. Median ± IQR for both S. salivarius isolates are depicted (n ≥ 2)

Cell contact is required for K12 to inhibit adherence by serotype 19F, but not serotype 6A

To determine whether contact of S. salivarius with D562 cells was required to inhibit pneumococcal adherence, we performed adherence assays in which K12 was administered using transwell inserts, preventing direct contact with epithelial cells but allowing the passage of secreted molecules. Using this transwell system, no inhibition of 19F adherence was observed at any dose, while 6A adherence was inhibited at the medium (p = 0.049) and low (p < 0.001) doses (Table 3). Preliminary experiments showed that culture supernatants did not inhibit pneumococcal growth in the deferred antagonism test.

Protein synthesis may be required for K12 to inhibit 6A adherence

The above experiments indicated the involvement of multiple mechanisms for S. salivarius inhibiting pneumococcal adherence. We further investigated the molecular mechanism(s) of S. salivarius K12 inhibition of 6A adherence by performing different treatments on the K12 inoculum prior to its use in adherence assays. Denaturing proteins and killing K12 cells (heat-treatment), interrupting protein synthesis (spectinomycin treatment), and removing outer surface carbohydrates (sodium periodate treatment) and proteins (pronase E treatment) all reduced inhibition of 6A adherence compared with untreated K12 (Fig. 5). However, only spectinomycin-treated K12 could no longer significantly inhibit 6A adherence (p = 0.402, Fig. 5).
Fig. 5

Adherence of pneumococcal serotype 6A to pharyngeal epithelial cells following pre-administration of treated S. salivarius K12. Approximately 1.5 × 106 CFU pneumococci were added to D562 monolayers at an MOI of 10:1. Pneumococcal adherence was determined when incubated with pneumococci alone (Pnc, normalised to 100 %), or pre-incubated for 1 h with approximately 1.5 × 107 CFU S. salivarius K12 (untreated), or treated with sodium periodate, Pronase E, heat-killed (heat), or spectinomycin. Data are mean + SD; n ≥ 3. * indicates p < 0.05, ** indicates p < 0.001 when compared to Pnc alone (Student’s t test)

Adherence of pneumococcal serotype 6A to pharyngeal epithelial cells following pre-administration of treated S. salivarius K12. Approximately 1.5 × 106 CFU pneumococci were added to D562 monolayers at an MOI of 10:1. Pneumococcal adherence was determined when incubated with pneumococci alone (Pnc, normalised to 100 %), or pre-incubated for 1 h with approximately 1.5 × 107 CFU S. salivarius K12 (untreated), or treated with sodium periodate, Pronase E, heat-killed (heat), or spectinomycin. Data are mean + SD; n ≥ 3. * indicates p < 0.05, ** indicates p < 0.001 when compared to Pnc alone (Student’s t test)

Discussion

In this study, we found that various bacteriocin-producing strains of S. salivarius can prevent pneumococcal growth on solid media and that the commercial probiotic strains, K12 and M18, inhibit pneumococcal 6A and 19F adherence to a pharyngeal epithelial cell line. Studies investigating the probiotic mechanisms of S. salivarius have largely focused on the role of bacteriocins and BLIS. The ~190 kb megaplasmid of S. salivarius K12 harbours genes encoding the bacteriocins salivaricin A2 and B, which prevent the growth of some bacterial pathogens, including Streptococcus pyogenes, in vitro [7, 14, 15]. Our results showed that the K12 megaplasmid is required to prevent pneumococcal growth in vitro, but is not essential to inhibit pneumococcal adherence. Therefore the primary mechanism of inhibition of pneumococcal adherence in this model does not appear to be mediated by megaplasmid-encoded bacteriocins; although we note that lack of inhibition of 19F adherence by a low dose of K12mp- indicates a possible role for the megaplasmid at this concentration. Instead, our findings indicated that S. salivarius K12 can inhibit pneumococcal adherence by blocking pneumococcal binding sites on D562 cells. We observed a correlation between S. salivarius K12 adherence to D562 cells and inhibition of adherence by pneumococcal isolate PMP843 (19F). We also found that K12 contact with cells was essential for this inhibition. K12 binding to D562 cells did not require megaplasmid-encoded molecules, since a megaplasmid-negative strain of K12 displayed equal adherence. We observed differences in the inhibition of pneumococcal adherence depending on both the strain of S. salivarius used and the pneumococcal isolate tested. This was not unexpected, given that S. salivarius strains vary in their capacity to adhere to epithelial cells and inhibit other pathogens [7, 15, 16]. The pneumococcus is a diverse pathogen, with different strains and serotypes known to behave differently in vitro and in vivo [25, 26]. Overall, S. salivarius K12 displayed stronger inhibition of pneumococcal adherence than the M18 strain, possibly due to its increased capacity to adhere to D562 cells. Interestingly, K12 adherence to D562 cells did not correlate with 6A adherence, suggesting that mechanisms other than S. salivarius-mediated blocking of pneumococcal binding sites on epithelial cells may be involved in the inhibition of 6A adherence. This was further supported by the inhibition of 6A adherence by all doses of M18 despite its low adherence capability. Although a high dose of megaplasmid-negative K12 could still inhibit 6A adherence, the effect was significantly less than that observed with megaplasmid-positive K12, indicating a possible contribution to inhibition by the K12 megaplasmid in this assay. Transwell experiments demonstrated that for 19F, contact of S. salivarius K12 with D562 cells was required to inhibit pneumococcal adherence, consistent with a previous report showing that contact with epithelial cells was needed for S. salivarius K12 to inhibit adherence by S. pyogenes to HEp-2 cells [27]. However, low doses of K12 administered in the absence of cell contact could inhibit adherence of 6A. This could be due to bacteriocins or other secreted products, which may not necessarily be encoded on the megaplasmid. The differences observed using varying doses of probiotic suggest that quorum sensing may play a role in the expression of S. salivarius genes relevant to pneumococcal inhibition. Further transwell experiments that test the K12 megaplasmid-negative strain may determine whether the molecules involved are chromosomally or plasmid encoded. Preliminary attempts to detect if bacteriocins were secreted through transwell membranes by deferred antagonism were unsuccessful, however this approach may have been insufficiently sensitive. Overall, the data obtained in this study suggest that the primary mechanism by which S. salivarius K12 inhibits pneumococcal adherence to D562 cells is by blocking pneumococcal attachment to the epithelial cell surface. A number of pneumococcal surface molecules have been shown to play a role in adherence, such as the adhesion molecule PsaA, which binds to cell surface carbohydrates [28]. For S. salivarius, various cell surface molecules including fibrils and fimbriae have been implicated in adherence [29]. As heparin does not block S. salivarius adherence to D562 cells, glycosylaminoglycans do not seem to be a shared cell surface receptor. Since airway epithelial cells derived from carcinomas, such as D562 cells, can display altered expression of surface molecules compared to primary human epithelial cells [30], further investigation of common receptors used by these species should include testing of primary cells. Although inhibition of pneumococcal adherence could be due to competition for receptor-mediated binding, it could also result through a less specific mechanism, such as steric hindrance, or the ability of S. salivarius to mask pneumococcal binding sites. Other potential mechanisms by which S. salivarius may inhibit pneumococcal adherence, such as immune modulation of epithelial cells [31], were not examined in this study. Additionally, the in vitro model lacks the complexity of the nasopharynx, which can harbour a wide range of colonising bacterial species that interact with each other and with epithelial cells. Whilst megaplasmid-encoded bacteriocins are required to inhibit the growth of pneumococci on solid media, our data suggest that it is the adherence of S. salivarius to epithelial cells that primarily blocks pneumococcal adherence in vitro. Therefore, strategies to use S. salivarius as a probiotic in the respiratory tract should optimise the ability of this species to colonise the target tissue. In vitro studies performed in our laboratory, and by others, have shown that the addition of probiotic bacteria to epithelial cells prior to pathogen administration is more effective than attempting to disrupt established pathogen colonisation [17, 27]. In clinical studies, high doses of M18 achieve greater colonisation rates and density in the oral cavity compared to lower doses [15]. Clinical studies of S. salivarius K12 as an oral probiotic have involved daily administration of high doses of the bacterium in an effort to achieve long-term colonisation of the oral cavity [32-34]. S. salivarius may be better suited as a probiotic for the oral cavity, where it predominates, than for the nasopharynx, the preferred niche of the pneumococcus. Strategies that facilitate S. salivarius adherence to the nasopharyngeal epithelium, such as the nasal spray recently employed by Santagati and colleagues [35], would likely be needed for this probiotic to inhibit pneumococcal colonisation in vivo.

Conclusions

Bacteriocin-encoding megaplasmids of S. salivarius strains K12 and M18 were essential to prevent pneumococcal growth on solid media but were not required to inhibit pneumococcal adherence to pharyngeal epithelial cells. Our results suggest that S. salivarius K12 employs several mechanisms, including blocking pneumococcal binding sites, to reduce pneumococcal adherence to pharyngeal epithelial cells. Further research is needed to identify the specific molecules involved. These findings contribute to our understanding of how probiotics may inhibit pneumococcal adherence and could assist with the development of novel strategies to prevent pneumococcal colonisation in the future.
  37 in total

Review 1.  Streptococcus adherence and colonization.

Authors:  Angela H Nobbs; Richard J Lamont; Howard F Jenkinson
Journal:  Microbiol Mol Biol Rev       Date:  2009-09       Impact factor: 11.056

2.  Megaplasmids encode differing combinations of lantibiotics in Streptococcus salivarius.

Authors:  Philip A Wescombe; Jeremy P Burton; Peter A Cadieux; Nikolai A Klesse; Otto Hyink; Nicholas C K Heng; Chris N Chilcott; Gregor Reid; John R Tagg
Journal:  Antonie Van Leeuwenhoek       Date:  2006-07-27       Impact factor: 2.271

3.  Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: a randomized, placebo-controlled, double-blind study.

Authors:  J P Burton; S Cowley; R R Simon; J McKinney; P A Wescombe; J R Tagg
Journal:  Food Chem Toxicol       Date:  2011-06-21       Impact factor: 6.023

4.  Distribution and persistence of probiotic Streptococcus salivarius K12 in the human oral cavity as determined by real-time quantitative polymerase chain reaction.

Authors:  H-P Horz; A Meinelt; B Houben; G Conrads
Journal:  Oral Microbiol Immunol       Date:  2007-04

5.  Oral bacteria as potential probiotics for the pharyngeal mucosa.

Authors:  Simone Guglielmetti; Valentina Taverniti; Mario Minuzzo; Stefania Arioli; Milda Stuknyte; Matti Karp; Diego Mora
Journal:  Appl Environ Microbiol       Date:  2010-04-23       Impact factor: 4.792

6.  Preliminary investigations of the colonisation of upper respiratory tract tissues of infants using a paediatric formulation of the oral probiotic Streptococcus salivarius K12.

Authors:  D A Power; J P Burton; C N Chilcott; P J Dawes; J R Tagg
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2008-06-17       Impact factor: 3.267

7.  Protective mechanisms of respiratory tract Streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.

Authors:  Tomas Fiedler; Catur Riani; Dirk Koczan; Kerstin Standar; Bernd Kreikemeyer; Andreas Podbielski
Journal:  Appl Environ Microbiol       Date:  2012-12-14       Impact factor: 4.792

8.  The commensal Streptococcus salivarius K12 downregulates the innate immune responses of human epithelial cells and promotes host-microbe homeostasis.

Authors:  Celine Cosseau; Deirdre A Devine; Edie Dullaghan; Jennifer L Gardy; Avinash Chikatamarla; Shaan Gellatly; Lorraine L Yu; Jelena Pistolic; Reza Falsafi; John Tagg; Robert E W Hancock
Journal:  Infect Immun       Date:  2008-07-14       Impact factor: 3.441

9.  Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.

Authors:  Paul V Licciardi; Zheng Quan Toh; Eileen Dunne; Sook-San Wong; Edward K Mulholland; Mimi Tang; Roy M Robins-Browne; Catherine Satzke
Journal:  PLoS Pathog       Date:  2012-06-07       Impact factor: 6.823

10.  Lactobacillus plantarum DK119 as a probiotic confers protection against influenza virus by modulating innate immunity.

Authors:  Min-Kyung Park; Vu Ngo; Young-Man Kwon; Young-Tae Lee; Sieun Yoo; Young-Hee Cho; Sung-Moon Hong; Hye Suk Hwang; Eun-Ju Ko; Yu-Jin Jung; Dae-Won Moon; Eun-Ji Jeong; Min-Chul Kim; Yu-Na Lee; Ji-Hun Jang; Joon-Suk Oh; Cheol-Hyun Kim; Sang-Moo Kang
Journal:  PLoS One       Date:  2013-10-04       Impact factor: 3.240

View more
  10 in total

Review 1.  Functions and emerging applications of bacteriocins.

Authors:  Michael L Chikindas; Richard Weeks; Djamel Drider; Vladimir A Chistyakov; Leon Mt Dicks
Journal:  Curr Opin Biotechnol       Date:  2017-08-05       Impact factor: 9.740

2.  Competitive Dominance within Biofilm Consortia Regulates the Relative Distribution of Pneumococcal Nasopharyngeal Density.

Authors:  Xueqing Wu; Nathan T Jacobs; Catherine Bozio; Preston Palm; Santiago M Lattar; Christiane R Hanke; David M Watson; Fuminori Sakai; Bruce R Levin; Keith P Klugman; Jorge E Vidal
Journal:  Appl Environ Microbiol       Date:  2017-08-01       Impact factor: 4.792

Review 3.  Commensal bacteria in the upper respiratory tract regulate susceptibility to infection.

Authors:  Sarah E Clark
Journal:  Curr Opin Immunol       Date:  2020-05-19       Impact factor: 7.486

Review 4.  Probiotics: A Promising Role in Dental Health.

Authors:  Sari A Mahasneh; Adel M Mahasneh
Journal:  Dent J (Basel)       Date:  2017-09-27

5.  Dolosigranulum pigrum Cooperation and Competition in Human Nasal Microbiota.

Authors:  Silvio D Brugger; Sara M Eslami; Melinda M Pettigrew; Isabel F Escapa; Matthew T Henke; Yong Kong; Katherine P Lemon
Journal:  mSphere       Date:  2020-09-09       Impact factor: 4.389

Review 6.  Commensal Bacteria: An Emerging Player in Defense Against Respiratory Pathogens.

Authors:  Rabia Khan; Fernanda Cristina Petersen; Sudhanshu Shekhar
Journal:  Front Immunol       Date:  2019-05-31       Impact factor: 7.561

7.  Streptococcus salivarius inhibits immune activation by periodontal disease pathogens.

Authors:  Kyle W MacDonald; Ryan M Chanyi; Jean M Macklaim; Peter A Cadieux; Gregor Reid; Jeremy P Burton
Journal:  BMC Oral Health       Date:  2021-05-07       Impact factor: 2.757

Review 8.  Relationships Between Oral Microecosystem and Respiratory Diseases.

Authors:  Jiajia Dong; Wei Li; Qi Wang; Jiahao Chen; Yue Zu; Xuedong Zhou; Qiang Guo
Journal:  Front Mol Biosci       Date:  2022-01-04

9.  The Effect of Oral Probiotics (Streptococcus Salivarius k12) on the Salivary Level of Secretory Immunoglobulin A, Salivation Rate, and Oral Biofilm: A Pilot Randomized Clinical Trial.

Authors:  Ksenia Babina; Dilara Salikhova; Maria Polyakova; Oxana Svitich; Roman Samoylikov; Samya Ahmad El-Abed; Alexandr Zaytsev; Nina Novozhilova
Journal:  Nutrients       Date:  2022-03-07       Impact factor: 5.717

10.  Swine-Derived Probiotic Lactobacillus plantarum Inhibits Growth and Adhesion of Enterotoxigenic Escherichia coli and Mediates Host Defense.

Authors:  Jing Wang; Yanxia Zeng; Sixin Wang; Hui Liu; Dongyan Zhang; Wei Zhang; Yamin Wang; Haifeng Ji
Journal:  Front Microbiol       Date:  2018-06-26       Impact factor: 5.640

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.