Alastair S Garfield1,2, Bhavik P Shah1, Christian R Burgess1, Monica M Li1, Chia Li3,4, Jennifer S Steger1, Joseph C Madara1, John N Campbell1, Daniel Kroeger5, Thomas E Scammell5, Bakhos A Tannous6, Martin G Myers7,8, Mark L Andermann1, Michael J Krashes3,4, Bradford B Lowell1. 1. Division of Endocrinology, Diabetes and Metabolism, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA. 2. Centre for Integrative Physiology, Hugh Robson Building, University of Edinburgh, Edinburgh, UK. 3. Diabetes, Endocrinology and Obesity Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland, USA. 4. National Institute on Drug Abuse, National Institutes of Health, Baltimore, Maryland, USA. 5. Department of Neurology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA. 6. Department of Neurology, Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts, USA. 7. Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan, USA. 8. Department of Molecular and Integrative Physiology, University of Michigan, Ann Arbor, Michigan, USA.
Abstract
Agouti-related peptide (AgRP) neurons of the arcuate nucleus of the hypothalamus (ARC) promote homeostatic feeding at times of caloric insufficiency, yet they are rapidly suppressed by food-related sensory cues before ingestion. Here we identify a highly selective inhibitory afferent to AgRP neurons that serves as a neural determinant of this rapid modulation. Specifically, GABAergic projections arising from the ventral compartment of the dorsomedial nucleus of the hypothalamus (vDMH) contribute to the preconsummatory modulation of ARCAgRP neurons. In a manner reciprocal to ARCAgRP neurons, ARC-projecting leptin receptor-expressing GABAergic vDMH neurons exhibit rapid activation upon availability of food that additionally reflects the relative value of the food. Thus, leptin receptor-expressing GABAergic vDMH neurons form part of the sensory network that relays real-time information about the nature and availability of food to dynamically modulate ARCAgRP neuron activity and feeding behavior.
Agouti-related peptide (AgRP) neurons of the arcuate nucleus of the hypothalamus (ARC) promote homeostatic feeding at times of caloric insufficiency, yet they are rapidly suppressed by food-related sensory cues before ingestion. Here we identify a highly selective inhibitory afferent to AgRP neurons that serves as a neural determinant of this rapid modulation. Specifically, GABAergic projections arising from the ventral compartment of the dorsomedial nucleus of the hypothalamus (vDMH) contribute to the preconsummatory modulation of ARCAgRP neurons. In a manner reciprocal to ARCAgRP neurons, ARC-projecting leptin receptor-expressing GABAergic vDMH neurons exhibit rapid activation upon availability of food that additionally reflects the relative value of the food. Thus, leptin receptor-expressing GABAergic vDMH neurons form part of the sensory network that relays real-time information about the nature and availability of food to dynamically modulate ARCAgRP neuron activity and feeding behavior.
The sensory processing of caloric deficiency is critical to prevent starvation and ensure survival[1]. The fidelity of such need detection and response enactment is defined by an evolutionarily conserved homeostatic system that links the detection of this deficiency with the instinctual drive to consume food. ARCAgRP neurons have been classically viewed as a first-order interoceptive population fundamental for this counter-regulatory response[2-4]. Indeed, increasing ARCAgRP neuron activity with mounting energy deficit reflects caloric need[5] and promotes a hardwired anabolic program that drives feeding behaviour[3,6]. Experimentally, activation of ARCAgRP neurons during times of caloric repletion engenders a state of artificial hunger[7] that promotes motivated food seeking[3,6] and consumption[2,3]. Remarkably however, recent investigation of the endogenous activity of ARCAgRP neurons has revealed that while a high firing rate during times of caloric depletion permits overall feeding behavior, these neurons exhibit a rapid and robust decrease in activity, the onset of which is coincident with the detection/expectation of available food, prior to consumption (and maintained throughout the feeding bout)[5,7,8]. At present the functional significance of this pre-consummatory suppression remains uncertain, with numerous non-exclusive hypotheses proposed[9], including a) its role as a preparatory/predictive signal of future satiety (that prevents over-consumption and primes the celiac response for ingestion), b) its requirement for the transition from food seeking behavior to food consumption and c) its purpose as a negative teaching signal that facilitates a learning-based association between detected food items and future relief from hunger (following food ingestion)[7].Notwithstanding this issue, the rapidity of the ARCAgRP neuron response to the detection of food strongly suggests that the input responsible is neuronal in origin. As such, an important first step in understanding the nature and significance of the poly-synaptic connections that link food-related sensory input with this rapid modulatory event is the identification of the pre-synaptic population(s) that directly regulate ARCAgRP neuron activity at fast timescales. Here we identify an inhibitory afferent arising from the dorsomedial nucleus of the hypothalamus (DMH) that is sufficient to robustly inhibit ARCAgRP neurons and suppress homeostatic feeding. Identified by their expression of the leptin receptor (LepR) and of prodynorphin (pDYN), these pre-synaptic GABAergic DMH neurons exhibit rapid pre-consummatory activation upon detection of food, in a manner reciprocal to ARCAgRP neurons. We conclude that this population plays an important role in sensory cue-mediated regulation of ARCAgRP neuron activity.
Results
vDMHLepR neurons are ARCAgRP neuron inhibitory afferents
GABAergic modulation of ARC melanocortin neurons is well established to play a role in the regulation of energy homeostasis[10,11]. Previous monosynaptic rabies mapping[12] from genetically-defined ARCAgRP neurons identified the ARC, DMH and, to a much lesser extent, the lateral hypothalamus (LH) as potential anatomic sources of pre-synaptic input[13,14]. To validate these observations and determine their valence we employed channelrhodopsin-assisted circuit mapping (CRACM). Using a Slc32a1(vGAT)-ires-Cre mouse to selectively transduce putative pre-synaptic GABAergic neurons, we recorded post-synaptic currents on ARCAgRP neurons (as demarked by an Npy-GFP transgene that labels all ARCAgRP neurons[15,16]). All recorded ARCAgRP neurons exhibited picrotoxin-sensitive light-evoked inhibitory post-synaptic currents (IPSCs) arising from distal DMHvGAT neurons (25/25; Fig 1a, S1a) and local ARCvGAT neurons (10/10; Supplementary Fig. 1b, d), but not from LHvGAT neurons (0/13; Supplementary Fig. 1c, e). However, ARC-projecting DMHvGAT and ARCvGAT neurons were also synaptically connected to counteracting satiety-promoting ARC pro-opiomelanocortin (POMC) neurons (demarked by a Pomc-hrGFP transgene; Fig 1b, Supplementary Fig. 1f, g), negating the utility of the vGAT-ires-Cre mouse as a selective marker of inhibitory ARCAgRP neuron afferents.
Figure 1
DMHLepR neurons are a potent source of GABAergic input to ARCAgRP neurons
(a–b), DMHvGAT neurons provide monosynaptic inhibitory input to 100% of ARCAgRP neurons (a) and ARCPOMC neurons recorded (b). (c–d), DMHLepR neurons provide selective monosynaptic input to 100% of ARCAgRP (c) but only 9% of ARCPOMC neurons recorded (d). (e), DMHLepR→ARC neurons provide dense axo-somatic innervation of ARCAgRP neurons. (f), Photostimulation of DMHLepR→ARC terminals is sufficient to inhibit ARCAgRP action potential firing. Abbreviations, 3v, third ventricle; PTX, picrotoxin. Scale bar in panel e, 100 μm and f, 25 μm.
We subsequently identified the leptin receptor (labeled by a Lepr-ires-Cre mouse line) as a marker of GABAergic DMH afferents to ARCAgRP neurons. Specifically, CRACM analysis demonstrated that 100% of ARCAgRP neurons (31/31; Fig 1c), but only 9% of ARCPOMC neurons recorded (4/45; Fig 1d) and 5% of all ARCnon-AgRP neurons (1/20; Supplementary Fig. 1h), received monosynaptic inhibitory input from DMHLepR neurons (and no glutamatergic input). Furthermore, and consistent with their dense axo-somatic innervation of ARCAgRP cell bodies (Fig 1e), pulsed light-evoked GABA release from DMHLepR→ARC terminals was sufficient to robustly suppress ARCAgRP neuron action potential firing (Fig 1f). Contrasting this selectivity, ARCLepR neurons engaged 100% of recorded ARCAgRP (10/10; Supplementary Fig. 1i) and ARCPOMC neurons (21/21; Supplementary Fig. 1j–k), while LHLepR neurons did not engage either population (Supplementary Fig. 1l–m). Thus, GABAergic DMHLepR neurons represent a highly preferential and potent source of pre-synaptic inhibitory input to ARCAgRP neurons.As revealed by pSTAT3 immunoreactivity (IR) GABAergic leptin-responsive DMH neurons were largely restricted to the ventral compartment (Supplementary Fig. 2a), while the glutamatergic sub-population was localized to the dorsal regions (Supplementary Fig. 2b). Consistent with this and the GABAergic nature of vDMHLepR→ARCAgRP neurons (Fig 1c), the majority of vDMH ARCAgRP afferents are leptin-responsive (71±1.6%, n=3; Supplementary Fig. 2c–d). Together, these data suggest that the vDMH is the principle source of GABAergic DMHLepR-expressing ARCAgRP neuron afferents. In addition, although as a population DMHLepR neurons are widely ramifying (Supplementary Fig. 3a), the ARC-projecting axons do not collateralize to send projections to other neuroanatomical targets (Supplementary Fig. 3b–c), as demonstrated by rabies collateral mapping[17].
vDMHLepR→ARC neurons are sufficient to inhibit feeding
Since direct inhibition of ARCAgRP neurons suppresses food consumption[3,18] we anticipated that the in vivo activation of vDMHLepR→ARC projections would similarly reduce food intake during times of physiological hunger, thus confirming behaviorally the inhibitory nature of the circuit. In vivo optogenetic stimulation of vDMHLepR→ARC terminals facilitated the functional isolation of this non-collateralizing circuit from the broader DMHLepR population (Fig 2a). Photostimulation of ChR2-mCherry expressing vDMHLepR→ARC efferents (Supplementary Fig. 4a) prior to the initiation of consumption (10 min or 10 sec), using the same pulsed-light protocol that successfully silenced ex vivo ARCAgRP neuron firing (Fig 1f, Supplementary Fig. 4b), significantly decreased (~88%) dark-cycle food intake (Fig 2b); this was not observed in photostimulated GFP-controls (Supplementary Fig. 4c). Optogenetic activation also attenuated hyper-motivated food consumption following an overnight fast (Fig 2c), while cessation of photostimulation rapidly reestablished normal refeeding behavior (Fig 2c dashed line, Video 1). Interestingly, photostimulation of this circuit was also sufficient to halt food intake 10 seconds after the initiation of consumption following an overnight fast (Fig 2d) or during the dark cycle (Supplementary Fig. 4d). Photostimulation in the dark cycle (Supplementary Fig. 4e) or light cycle (Supplementary Fig. 4f) revealed no overt changes in locomotor activity. No changes in anxiety-like behaviors were evident in an open-field paradigm (Supplementary Fig. 4g–i). Photostimulation in the fasted state increased the time spent grooming to a level comparable to that following food intake (Supplementary Fig. 4j), consistent with an induction of satiety-like behavior[19]. Chemogenetic silencing of DMHLepR neurons did not increase light-cycle food consumption (Supplementary Fig. 5), indicating that this population is not required for maintaining physiological satiety. Together these data demonstrate that vDMHLepR→ARC neurons are sufficient, but not necessary, to robustly suppress homeostatic feeding through the inhibition of ARCAgRP neurons and the induction of artificial satiety.
Figure 2
DMHLepR→ARC neurons are sufficient to inhibit homeostatic feeding
(a–c), in vivo optogenetic stimulation of DMHLepR→ARC terminals (a) significantly reduced food consumption during the dark-cycle (b; n=12, repeated measures ANOVA, main effect of treatment (F(1,44)=171.10, p<0.0001), main effect of time (F(3,44)=48.48, p<0.0001) and interaction (F(3,44)=30.95, p<0.0001) and following an overnight fast (c; n=15, repeated measures ANOVA, main effect of treatment (F(1,84)=569.90, p<0.0001), main effect of time (F(3,84)=226.50, p<0.0001) and interaction (F(3,84)=43.74, p<0.0001). (d), photostimulation of DMHLepR→ARC terminals in a post-fast refeed paradigm was sufficient to inhibit food intake when applied before or after food consumption had begun (n=7 (off) and 6 (on), ANOVA, F(2,16)=6.73, p=0.0074). Abbreviations, Before, before food presentation; After, after the initiation of consumption. All data presented as mean±SEM; post-hoc p-values *p<0.05; ***p<0.001; ****P<0.0001.
vDMHLepR→ARC neurons are activated by food availability
Given these functional observations, and the inhibitory capacity of the DMHLepR→ARC projections, we considered whether vDMHLepR neurons contribute to the rapid and transient modulation of ARCAgRP neurons upon sensory detection of food[5,7,8]. We therefore employed in vivo fiber photometry to study the endogenous calcium activity of populations of vDMHLepR neurons during food presentation. Virally-mediated cre-dependent expression of the genetically-encoded calcium indicator GCaMP6s[20] in vDMHLepR neurons enabled within-subject fluorometric analysis of real-time neuronal activity.We first assessed the population response of vDMHLepR cell bodies (Fig 3a) to repeated presentation of small chow pellets (14 mg). In food-restricted mice (85% of free-feeding body weight) we observed a rapid and robust increase in calcium activity upon pellet detection and approach (Fig 3b–d), as compared to a similar sized non-food object. This effect preceded the initiation of consumption (Fig 3e). The absence of a significant calcium response to a non-food item also confirms that the observed effect was not due to a startle response. In the ad libitum fed state, when mice were calorically replete, calcium responses to presentation of these pellets were significantly attenuated as compared to the food-restricted state (Fig 3c–d). No calcium responses to food or object presentation were evident from vDMHLepR neurons transduced with cre-dependent GFP (Supplementary Fig. 6a–b) or in validated ‘misses’ (no GCaMP6s expression in DMH; Supplementary Fig. 6c–d). Thus, vDMHLepR neurons exhibit a pre-consummatory response that is similar in nature but opposite in sign to AgRP neurons[8] - a decrease in activity upon food presentation the magnitude of which correlates with the animal’s hunger state.
Figure 3
DMHLepR neurons are rapidly activated upon sensory detection of food
(a), the real-time activity of DMHLepR cell bodies was determined using in vivo fiber photometry. (b–d), DMHLepR neurons were rapidly activated upon presentation of a small chow pellet (t=0), compared to a non-food object, in a energy-state dependent manner (b, individual trials in one representative mouse on one day in the calorie restricted and ad libitum fed state; c, mean effects from all mice across time, n=6; d, mean response from 0–10s post food presentation, repeated measures ANOVA, F(5,15)=7.2, p=0.02). e, responses of DMHLepR to small pellet availability occurred prior to the initiation of consumption and was not increased further once consumption began (n=15; repeated measures ANOVA, F(14,28)=12.16, p=0.0002). (f–g), DMHLepR neurons were rapidly activated upon presentation of a large chow pellet, compared to a non-food object, in a energy-state dependent manner (f, mean effects from all mice across time, n=6; d, mean response from 0–10s post food presentation, repeated measures ANOVA, F(5,15)=24.15, p=0.0001). (h), response of DMHLepR neurons to large chow pellets was potentiated compared to that elicited by small chow pellets in the same mouse (n=7; paired t-test, t(6)=3.88, p=0.0081). (i–j), presentation of chocolate activated DMHLepR neurons, compared to a non-food object, and was comparable to responses in ad libitum chow-fed mice (i, mean effects from all mice across time, n=5; j, mean response from 0–10s post food presentation, repeated measures ANOVA, F(4,12)=24.21, p=0.0003). (k), responses to chocolate were increased compared to chow (n=6, paired t-test, t(5)=4.58, p=0.006). All data presented as mean±SEM; post-hoc p-values *p<0.05; **p<0.01; ****P<0.0001. Abbreviations, ΔF/F, fractional change in fluorescence.
Larger chow pellets (500 mg) also elicited a calcium response that exhibited energy-state dependence (Fig 3f–g), however this response was of greater magnitude than that observed with small pellets (Fig 3h), suggesting that vDMHLepR neuron activity conveys information not only about the presence but the nature of discovered food items. ARCAgRP neurons exhibit exaggerated pre-consummatory suppression upon the presentation of chocolate – a highly palatable food that is more calorically dense and rewarding (compared to chow)[8]. As predicted, presentation of chocolate fragments (approximately 14 mg) elicited an increase in GCaMP6 fluorescence in DMHLepR cell bodies. In contrast to chow presentation, responses to chocolate presentation did not vary across fasted vs. fed states (Fig 3i–j), possibly due to sustained food-seeking for chocolate vs. chow pellets in the ad libitum fed state. Furthermore, and as observed of ARCAgRP neurons[7], vDMHLepR neuron fluorometric responses to chocolate were significantly greater than to similar sized chow pellets (Fig 3k). Thus, the pre-consummatory activation of vDMHLepR neurons is potentiated by the nutritive value of detected food, in a manner that reflects both food quantity and quality.To isolate the vDMHLepR→ARC projecting neurons from the broader DMHLepR population, we assessed calcium activity specifically in vDMHLepR→ARC axons (Fig 4a). As observed in population activity from vDMHLepR cell bodies, axonal calcium activity in food-restricted mice rapidly increased upon small chow pellet presentation (Fig 4b–d) prior to consumption (Fig 4e–g), but not in reaction to a non-food object or in the ad libitum fed state. Larger chow pellets elicited larger calcium responses compared to small pellets (Fig 4h and Supplementary Fig. 7a–b), similar to responses in vDMHLepR cell bodies. The vDMHLepR→ARC axon responses were larger to presentation of chocolate vs. small pellets, and did not depend on hunger state (Fig 4i and Supplementary Fig. 7c–d). In sum, vDMHLepR→ARC neurons respond to availability of food in a manner opposite to that of ARCAgRP neurons, relaying real-time sensory information regarding the availability and quality of food.
Figure 4
DMHLepR→ARC axons are rapidly activated upon sensory detection of food
(a), the real-time activity of DMHLepR→ARC axons was determined using in vivo fiber photometry. (b–d), DMHLepR→ARC axons were rapidly activated upon presentation of a small chow pellet (t=0), compared to a non-food object, in a energy-state dependent manner (b, individual trials in one representative mouse on one day in the calorie restricted and ad libitum fed state; c, mean effects from all mice across time, n=6; d, mean response from 0–10s post food presentation, repeated measures ANOVA, F(5,15)=36.08, p<0.0001). (e), activation of DMHLepR→ARC axons to small pellet availability occurred prior to the initiation of consumption (n=36; repeated measures ANOVA, F(35,70)=35.30, p<0.0001). (f–g), Mean responses to small pellet presentation aligned to onset of consumption (f) and individual trial responses aligned to food availability (g; onset of consumption denoted with vertical black bar on each trial) demonstrating activity rising prior to consumption. (h–i), calcium response of DMHLepR→ARC axons to large chow pellets (h; n=6; paired t-test, t(6)=3.61, p=0.015) and chocolate (i; n=6; paired t-test, t(6)=3.13, p=0.026) were potentiated compared to that elicited by small chow pellets in the same mouse. All data presented as mean±SEM; post-hoc p-values *p<0.05; **p<0.01; ***p<0.001; ****P<0.0001. Abbreviations, ΔF/F, fractional change in fluorescence.
A subset of vDMHLepR→ARC neurons are dynorphinergic
In light of the heterogeneity of DMHLepR neurons[21-23], we sought to further specify the neurochemical identity of GABAergic vDMHLepR→ARCAgRP afferents. Recent analysis of hypothalamic LepR neurons has indicated that a subset of those in the DMH express the inhibitory neuropeptide pDYN[24]. Quantitative PCR analysis of individual manually-isolated vDMHLepR neurons revealed that 14/25 (56%) of those expressing Slc32a1 (vGAT) also expressed Pdyn (Supplementary Fig. 8a–b). Consistent with the location of vDMHLepR→ARCAgRP neurons (Supplementary Fig. 2) the preponderance of leptin-responsive vDMHpDYN neurons (as defined by pSTAT3 immunoreactivity) were within the vDMH (Supplementary Fig. 8c–e and Ref 18). Furthermore, projection profiling from DMHpDYN neurons identified the mediobasal ARC as their only long-range target (Supplementary Fig. 8f–h).CRACM analysis demonstrated that almost all recorded ARCAgRP neurons (20/21; Fig 5a) but no ARCnon-AgRP neurons (Supplementary Fig. 8i; including ARCPOMC neurons, Fig 5b) received direct GABAergic input from vDMHpDYN neurons. vDMHpDYN→ARCAgRP IPSCs were of smaller amplitude compared to those derived from vDMHLepR afferents (Supplementary Fig. 8j) which led to less effective light-evoked inhibition of ARCAgRP neuron spiking (Supplementary Fig. 8k). This suggests that vDMHpDYN neurons are only a proportion of the total GABAergic vDMHLepR→ARCAgRP population. In vivo optogenetic activation of vDMHpDYN→ARC terminals suppressed food consumption during the dark cycle (Fig 5c) and following an overnight fast (Fig 5d). The magnitude of feeding suppression was less than that observed of the vDMHLepR→ARC circuit (Fig 2), especially during a post-fast refeed, likely reflecting the weaker inhibitory potency of this circuit.
Figure 5
DMHpDYN neurons are a subset of GABAergic DMHLepR→ARC neurons
(a–b), DMHpDYN neurons (red) provide monosynaptic inhibitory input to 95% of ARCAgRP (a; 20/21 connected) neurons recorded but not ARCPOMC neurons (b; 0/12 connected). (c–d), in vivo optogenetic stimulation of DMHpDYN→ARC terminals significantly reduced food consumption during the dark-cycle (c; n=3, repeated measures ANOVA, main effect of treatment (F(1,8)=77.14, p<0.0001), main effect of time (F(3,8)=21.49, p=0.0003) and interaction (F(3,8)=12.69, p=0.002) and following an overnight fast (d; n=3, repeated measures ANOVA, main effect of treatment (F(1,8)=193.60, p<0.0001), main effect of time (F(3,8)=111.90, p<0.0001) and interaction (F(3,8)=22.63, p=0.0003). (e–f), in vivo fiber photometry demonstrated that DMHpDYN neurons were rapidly activated upon presentation of a small chow pellet (t=0), compared to a non-food object, in a energy-state dependent manner (e, mean effects from all mice across time, n=5–6; f, mean response from 0–10s post food presentation, one-way ANOVA, F(3,18)=19.56, p<0.0001). (g), activation of DMHpDYN to small pellet availability occurred prior to the initiation of consumption and was not increased further once consumption began (n=44; repeated measures ANOVA, F(43,86)=40.61, p<0.0001). (h–i), DMHpDYN neurons were rapidly activated upon presentation of a large chow pellet, compared to a non-food object, in a energy-state dependent manner (h, mean effects from all mice across time, n=5–6; i, mean response from 0–10s post food presentation, one-way ANOVA, F(3,18)=13.43, p<0.0001). (j), calcium response of DMHpDYN neurons to large chow pellets was potentiated compared to that elicited by small chow pellets in the same mouse (n=6; paired t-test, t(5)=3.56, p=0.016). (k–l), presentation of chocolate activated DMHpDYN neurons, compared to a non-food object, and was comparable to ad libitum chow-fed mice (k, mean effects from all mice across time, n=5–6; l, mean response from 0–10s post food presentation, one-way ANOVA, F(3,18)=18.03, p<0.0001). (m), DMHpDYN neuron calcium responses to chocolate were increased compared to chow (n=6, paired t-test, t(5)=5.09, p=0.0038). All data presented as mean±SEM; post-hoc p-values: *p<0.05; **p<0.01; ***p<0.001; ****P<0.0001. Abbreviations, ΔF/F, fractional change in fluorescence.
Subsequent in vivo GCaMP6s photometry demonstrated that vDMHpDYN neurons showed similar functional properties to vDMHLepR neurons and DMHLepR→ARC axons. Small pellets presented to hungry mice elicited a significant increase in calcium activity, prior to consumption, which was not observed upon detection of a non-food item or in ad libitum fed mice (Fig 5e–g). Calcium responses in food-restricted mice were potentiated by presentation of larger chow pellets (Fig 5h–j) and chocolate (Fig 5k–m), with chocolate responses being independent of energy-state. Together, these data suggest that vDMHpDYN neurons represent a sub-population of GABAergic vDMHLepR→ARCAgRP afferents.
Discussion
Using a combination of in vivo techniques for the manipulation and monitoring of genetically-defined neuronal populations we identify a source of inhibitory input to ARCAgRP neurons that contributes to their rapid sensory regulation[5,7,8]. This population of GABAergic vDMHLepR/vDMHpDYN neurons exhibits a highly circumscribed efferent field within the ventromedial ARC with dense peri-somatic innervation of ARCAgRP somata. As such, they provide a highly selective inhibitory input sufficient to robustly silence ARCAgRP neuron action potential firing and supress homeostatic feeding, when photostimulated. It is important to note that the complete inhibition of ARCAgRP neurons by way of the optogenetic activation of GABAergic vDMHLepR→ARC terminals (Fig 1f) represents a supra-physiological paradigm that exceeds the level of suppression induced by food availability[5]. Thus, while providing behavioural validation for the nature of the circuit such optogenetic manipulation does not speak to the physiological role of ARCAgRP neurons (or vDMHLepR→ARC neurons) in the regulation of homeostatic feeding. Indeed, as observed by others[22,23], DMHLepR neurons were not necessary for the maintenance of homeostatic satiety, indicating that they are not a source of tonic ARCAgRP neuron inhibition contributing to feeding suppression during times of caloric sufficiency. This circuit may however offer a highly tractable experimental approach for the real-time temporal control of ARCAgRP neurons.Recent investigations of the endogenous activity of ARCAgRP neurons has revealed their pre-consummatory suppression upon food presentation/expectation[5,7,8]. The rapidity of this response strongly suggests that it is synaptically, rather than hormonally, mediated. Indeed, that all ARCAgRP neurons recorded received GABAergic vDMHLepR/pDYN input is consistent with the majority of ARCAgRP neurons exhibiting pre-consummatory suppression[5,7]. Thus, in light of the specificity and potency of the vDMHLepR→ARC circuit we asked whether it contributed to the dynamic modulation of ARCAgRP neurons during food discovery. Strikingly, reciprocal to ARCAgRP neurons, vDMHLepR cell bodies and vDMHLepR→ARC axons exhibited rapid and reproducible pre-consummatory activation upon food detection. Chow presentation elicited fluorescent responses with both cue- and energy state-dependency, indicating some level of neural gating upstream of these neurons is important for attributing salience to the sensory input, in a manner that considers the animal’s broader external and internal environment. Furthermore, as observed of ARCAgRP neurons[8], the magnitude of calcium responses in vDMHLepR neurons and their ARC projections increased with presentation of more palatable food. Thus, in the fasted state, the potentiation of the vDMHLepR→ARC response to increased nutritive content (both quality and quantity) may signal the greater value of the food item as a source of relief from hunger. However, as reflected by vDMHLepR→ARC neuron activity (and feeding behavior), food quantity loses, but food quality retains incentive value in the calorically replete state, possibly suggesting a switch in value processing from the homeostatic to the hedonic in the absence of a physiological hunger drive.Other populations of neuronal afferents also contribute to the sensory regulation of ARCAgRP neurons. Indeed, although vDMHLepR neuron activity peaked upon food approach prior to consumption, we observed a decay in the peak amplitude of the calcium response before the termination of feeding. This contrasts with the sustained reduction in ARCAgRP neuron activity throughout consumption[5,7,8] and may suggest that additional inputs are important for prolonged ARCAgRP neuron suppression. This could include inhibition via other GABAergic afferents, such as ARCvGAT neurons, and/or dis-facilitation via removal of tonic excitatory inputs – such as those arising from the PVH[13]. To this latter possibility, it is interesting to note that ARCAgRP neurons do not express the kappa-opioid receptor (KOR)[25] (and data not shown), raising the possibility that any DYN released from vDMHLepR/pDYN neurons may act pre-synaptically to inhibit a KOR-expressing excitatory ARCAgRP neuron afferents. The kinetics of pre-synaptic neuropeptide action would define a slower onset but longer-lasting modulation of ARCAgRP neurons and potentially explain their sustained suppression during consumption. This model is also consistent with slow recovery in ARCAgRP neuron activity when presented food is subsequently removed prior to or during the consummatory phase[7,8].The significance of LepR expression on GABAergic vDMHLepR/pDYN→ARC neurons also remains to be determined. In acute electrophysiological slices leptin depolarizes GABAergic vDMHLepR neurons (data not shown). This raises the possibility that low leptin levels, by decreasing the basal activity of these neurons, may increase their dynamic range and facilitate their response to food related sensory cues. Alternatively, it is possible that LepR signaling at these neurons is involved in a slower transcriptional modulation, potentially related to synaptic restructuring. In this way, LepR signaling at vDMHLepR→ARCAgRP neurons may concern longer-term regulation reflecting the chronic nutritional state, such as might underlie maladapted associations between sensory cues and feeding behavior in obesity or eating disorders. Real-time monitoring of vDMHLepR neuron activity in diet-induced or genetically obesemice will prove informative in this regard.As a population, DMHLepR neurons have been implicated in a number of physiologies, including autonomic regulation of energy expenditure and cardiovascular tone[22,23,21]. Although the specific networks underlying these functions are yet to be defined, it is likely that they are independent of the vDMHLepR→ARCAgRP circuit. DMHLepR neurons that regulate energy expenditure are glutamatergic and located in the dorsal DMH[22,26] and thus spatially and neurochemically distinct from GABAergic vDMHLepR→ARCAgRP neurons. Furthermore, the thermogenic effect of DMHLepR neurons has been demonstrated to be melanocortin independent[21]. For a number of reasons it is also unlikely that the vDMHLepR→ARCAgRP circuit is involved in cardiovascular control. Firstly, DMH mediated regulation of blood pressure is predicted to proceed via more direct projections to pre-autonomic neurons in the RVLM[27]. Secondly, leptin-mediated or chemogenetic activation of DMHLepR neurons only influences blood pressure after 3 days of chronic simulation[23,28], inconsistent with the acute modulatory function of vDMHLepR→ARCAgRP neurons. Thirdly, no feeding suppression was observed during chemogenetically-induced hypotension[23], as would be expected of activation of the vDMHLepR→ARCAgRP circuit. It is therefore likely that vDMHLepR→ARC neurons represent a functionally specific sub-population involved in transitory sensory modulation of ARCAgRP neurons. Of note, LepR-expressing vDMHpDYN neurons are distinct from the non-LepR expressing cDMHpDYN neurons implicated in the attenuation of food consumption during intense feeding bouts[29].The rapid pre-consummatory inhibition of ARCAgRP neurons and their sustained suppression during consumption represents a fascinating new aspect of their physiological function[5,7,8], although the significance of this phenomenon for feeding behaviour remains controversial. Our data now expand an understanding of the nature and source of this modulation. Specifically, we identify GABAergic vDMHLepR/pDYN neurons as a potent inhibitory afferent to ARCAgRP neurons that, like their post-synaptic target, are rapidly regulated by food detection. As expected, the directionality of this modulation is reciprocal to ARCAgRP neurons but occurs on a comparable timescale. Furthermore, like ARCAgRP neurons, vDMHLepR/pDYN neuron activity reflects not only the presence, but also the quality of the food item. These observations strongly support the hypothesis that vDMHLepR/pDYN neurons are a physiologically relevant source of inhibitory input to ARCAgRP neurons and provide an entry point into the upstream circuitry that underlies rapid evaluation of sensory food cues during homeostatic feeding.
Material and methods
Animals
Slc32a1(vGAT)-ires-Cre mice were generated and maintained as previously described. All mice are on a mixed background. All animal care and experimental procedures were approved by the National Institute of Health and Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committee. Mice were housed at 22–24 °C with a 12 h light:12 h dark cycle with standard mouse chow (Teklad F6 Rodent Diet 8664; 4.05 kcal g−1, 3.3 kcal g−1 metabolizable energy, 12.5% kcal from fat; Harlan Teklad) and water provided ad libitum, unless otherwise stated. All diets were provided as pellets. For all behavioral studies male mice between 6–10 weeks were used. For electrophysiological studies male mice between 4–8 weeks were used.
Brain tissue preparation
Mice were terminally anesthetised with chloral hydrate (Sigma Aldrich) and transcardially perfused with phosphate-buffered saline (PBS) followed by 10% neutral buffered formalin (Fisher Scientific). Brains were extracted, cryoprotected in 20% sucrose, and sectioned coronally on a freezing sliding microtome (Leica Biosystems) at 30 μm and collected in four equal series.
Immunohistochemistry
Brain sections were washed in 0.1 M phosphate-buffered saline pH 7.4, blocked in 3% normal donkey serum/0.25% Triton X-100 in PBS for 1 hour at room temperature and then incubated overnight at room temperature in blocking solution containing primary antiserum (rabbit anti-dsRed, Clonetech (#632496) 1:1000; chicken anti-GFP, Life Technologies (#A10262). The next morning sections were extensively washed in PBS and then incubated in Alexa fluorophore secondary antibody (Molecular Probes, 1:1000) for 2 h at room temperature. After several washes in PBS, sections were mounted onto gelatin-coated slides and fluorescent images were captured with Olympus VS120 slide scanner microscope. All primary antibodies used are validated for species and application (1DegreeBio and Antibody Registry).
pSTAT3 immunohistochemistry
Mice were injected with 5 mg/kg recombinant leptin two hours prior to perfusion (as above). Brain sections were washed in 0.1 M phosphate-buffered saline pH 7.4 followed by incubation in 5% NaOH and 0.3% H2O2 for 2 min, then with 0.3% glycine (10 min), and finally with 0.03% SDS (10 min), all made up in PBS. Sections were blocked in 3% normal donkey serum/0.25% Triton X-100 in PBS for 1 hour at room temperature and then incubated overnight at room temperature in blocking solution containing 1/250 rabbit anti-pSTAT3 (Cell Signalling, #9145) and 1/1000 chicken anti-GFP (Life Technologies, #A10262). The next morning sections were extensively washed in PBS and then incubated in 1/250 donkey anti-rabbit 594 (Molecular Probes, R37119) and 1/1000 donkey anti-chicken 488 (Jackson ImmunoResearch, 703-545-155) for 2 h at room temperature. After several washes in PBS, sections were mounted onto gelatin-coated slides and fluorescent images were captured with Olympus VS120 slide scanner microscope.
Single cell quantitative PCR
DMH was acutely dissected from adult LepR-ires-Cre::L10-GFP mice (n=2), then enzymatically dissociated and manually sorted for GFP+ cells as described previously[32]. Isolated GFP positive cells and negative control samples (cell-picking buffer) were concurrently processed into cDNA libraries using Smart-Seq2[33], except that the amplified cDNA was eluted in 30 μl volumes. Gene expression was analyzed by probe-based qPCR on a 7500 Fast Real-Time PCR System (Applied Biosystems) using Brilliant II qPCR Low ROX Master Mix (Agilent Technologies) according to the manufacturer’s instructions. Each 20 μl qPCR reaction contained 2 μl of eluted cDNA and 1 μl of a custom primer/probe set (sequences below; 1:1 ratio of primer:probe; default FAM/ZEN modifications; IDT). Cells showing relatively little to no expression of Gfp, Actb, or Slc32a1 were excluded from further analysis. Remaining cells were analyzed for expression of Pdyn. A heatmap of Ct values was generated using GenePattern software (Broad Institute), with a “global” color scale for across-gene comparisons. Note that in order to include cells for which no signal was detected in 40 cycles of qPCR, a “pseudocount” of 40 was entered as the Ct. Primers (5′→3′): Actb (L, AAAAGGGAGGCCTCAGACCTGG; R, TCACCCTCCCAAAAGCCACC; probe, GCCCTGAGTCCACCCCGGGG); Gfp (L, ATCTGCACCACCGGCAAGCT; R, ATCTGCACCACCGGCAAGCT; probe, CGTGCCCTGGCCCACCCTCG); Slc32a1 (L, ACGAGCACACCACACGCACA; R, ATTTCGGGCGGGCGACTTCA; probe, GGCCCCGTTTGCCTGCCGGT); Pdyn (L, AGGATGGGGATCAGGTAGGGCA; R, CACCTTGAACTGACGCCGCA; probe, GGGGGCTTCCTGCGGCGCAT).
Viral injections
Stereotaxic injections were performed as previously described. Mice were anaesthetised with xylazine (5 mg per kg) and ketamine (75 mg per kg) diluted in saline (350 mg per kg) and placed into a stereotaxic apparatus (KOPF Model 963 or Stoelting). For postoperative care, mice were injected intraperitoneally with meloxicam (5 mg/kg). After exposing the skull via small incision, a small hole was drilled for injection. A pulled-glass pipette with 20–40 mm tip diameter was inserted into the brain and virus was injected by an air pressure system. A micromanipulator (Grass Technologies, Model S48 Stimulator) was used to control injection speed at 25 nl min−1 and the pipette was withdrawn 5 min after injection. For electrophysiology and in vivo optogenetic experiments, AAV8-hSyn-DIO-ChR2(H134R)-mCherry (University of North Carolina Vector Core; titer 1.3 × 1012 genome copies per ml) was injected into the ARC (15–50 nl, AP: −1.50 mm, DV: −5.80 mm, ML: +/−0.20 mm from bregma), DMH (50 nl, AP: −1.80 mm, DV: −5.2 mm, ML: +/−0.3 mm from bregma), LH (50–100 nl, AP: −1.50 mm, DV: −5.00 mm, ML: +/−1.00 mm from bregma). For electrophysiology and in vivo chemogenetic experiments, AAV8-hSyn-DIO-hM4Di-mCherry (University of North Carolina Vector Core; titer 1.7 × 1012 genome copies per ml) were bilaterally injected into the DMH (15–40 nl, coordinates as above). For ex vivo and in vivo calcium imaging experiments, AAV1-hSyn-DIO-GCaMP6(s) (University of Pennsylvania Vector Core) was injected into the DMH (50 nl, coordinates as above). Mice were given a minimum of 2 weeks recovery and 1 week acclimation before being used in any experiments.
Electrophysiology
To prepare brain slices for electrophysiological recordings, brains were removed from anesthetized mice (4–8 weeks old) and immediately submerged in ice-cold, carbogen-saturated (95% O2, 5% CO2) high sucrose solution (238 mM sucrose, 26 mM NaHCO3, 2.5 mM KCl, 1.0 mM NaH2PO4, 5.0 mM MgCl2, 10.0 mM CaCl2, 11 mM glucose). Then, 300-μM thick coronal sections were cut with a Leica VT1000S Vibratome and incubated in oxygenated aCSF (126 mM NaCl, 21.4 mM NaHCO3, 2.5 mM KCl, 1.2 mM NaH2PO4, 1.2 mM MgCl2, 2.4 mM CaCl2, 10 mM glucose) at 34 °C for 30 minThen, slices were maintained and recorded at room temperature (20–24°C). For most voltage clamp recordings intracellular solution contained the following (in mM): 140 CsCl, 1 BAPTA, 10 HEPES, 5 MgCl2, 5 Mg-ATP, 0.3 Na2GTP, and 10 lidocaine N-ethyl bromide (QX-314), pH 7.35 and 290 mOsm. The intracellular solution for current clamp recordings contained the following (in mM): 128 K gluconate, 10 KCl, 10 HEPES, 1 EGTA, 1 MgCl2, 0.3 CaCl2, 5 Na2ATP, 0.3 NaGTP, adjusted to pH 7.3 with KOH.Light-evoked IPSCs and EPSCs during CRACM studies[34,35] were recorded in the whole cell voltage clamp mode, with membrane potential clamped at −60 mV. In a subset of voltage clamp CRACM experiments it was necessary to detect light-evoked GABAergic synaptic currents in ChR2-mCherry expressing neurons (Supplementary Fig. 2d, h, i). As such, to negate the movement of monovalent cations, a Cs+ based low Cl− internal solution was used (129 mM CsMeSO4, 16 mM CsCl, 8mM NaCl, 10 mM HEPES, 0.25 mM EGTA, 3 mM Mg-ATP, 0.3 mM Na2GTP) and light-evoked IPSCs recorded at ~0 mV. All recordings were made using multiclamp 700B amplifier, and data was filtered at 2 kHz and digitized at 10 kHz. To photostimulate Channelrhodopsin2-positive fibers, a laser or LED light source (473 nm; Opto Engine LLC; Thorlabs) was used. The blue light was focused on to the back aperture of the microscope objective, producing a wide-field exposure around the recorded cell of 1 mW. The light power at the specimen was measured using an optical power meter PM100D (ThorLabs). The light output is controlled by a programmable pulse stimulator, Master-8 (AMPI Co. Israel) and the pClamp 10.2 software (AXON Instruments). Photostimulation-evoked EPSCs/IPSCs detection protocol constitutes four blue light laser pulses (pulse duration - 2 ms) administered 1 second apart, repeating for a total of 30 sweeps. When recording light-evoked changes in membrane potential in AgRP neurons, current (~5 pA) was injected into cells to maintain continuous action potential firing.Number of animals used per study (all male): DMHvGAT→ARCAgRP
n=2; DMHvGAT→ARCPOMC
n=3; ARCvGAT→ARCAgRP
n=4; ARCvGAT →ARCPOMC
n=5; LHvGAT →ARCAgRP
n=2; LHvGAT →ARCPOMC
n=2; DMHLepR→ARCAgRP
n=3; DMHLepR→ARCPOMC
n=6; ARCLepR→ARCAgRP
n=2; ARCLepR →ARCPOMC
n=4; LHLepR →ARCAgRP
n=1; LHLepR →ARCPOMC
n=3. DMHpDYN→ARCAgRP
n=4; DMHpDYN→ARCPOMC n=2.
Optic fiber implantation
Optic fiber implantations were performed during the same surgery as viral injection (above). For optogenetic photostimulation of DMH→ARC terminals, ceramic ferrule optical fibers (200 μm diameter core, BFH37-200 Multimode, NA 0.37; Thor Labs) were implanted bilaterally over the ARC (AP: −1.55 mm, DV: (R) −5.75 mm and (L) − 5.50 mm, ML: (R) +0.3 mm and (L at 20°) −2.40 mm from bregma). For DMHLepR and DMHpDYN cell body calcium photometry a metal ferrule optic fiber (200 μm diameter core; BFH37-200 Multimode; NA 0.37; Thor Labs) was implanted unilaterally over the vDMH (AP: −1.80 mm, DV: −5.0 mm, ML: +0.3 mm from bregma). For DMHLepR→ARC axon calcium photometry a metal ferrule optic fiber (400 μm diameter core; BFH37-400 Multimode; NA 0.37; Thor Labs) was implanted unilaterally over the ARC (AP: −1.55 mm, DV: −5.8 mm, ML: (at 2°) −0.49 mm from bregma). Fibers were fixed to the skull using dental acrylic and mice were allowed 2 weeks for recovery before acclimatisation to home cages customized for optogenetic stimulation or photometry recording (12 h light/dark cycle starting at 6am) for 1 week. After the completion of the experiments, mice were perfused and the approximate locations of fiber tips were identified based on the coordinates of Franklin and Paxinos.[36]
Food intake studies
Food intake studies on chow were performed as previously described. All animals were singly housed for at least 2.5 weeks following surgery and handled for 10 consecutive days before the assay to reduce stress response. Studies were conducted in a home-cage environment with ad libitum food access. A full trial consisted of assessing food intake from the study subjects after they received injections of saline or pseudo-photostimulation on day-1 and 1 mg/kg CNO or photostimulation on day-2. Animals received a week ‘off’ between trials before another trial was initiated. The food intake data from all days were then averaged and combined for analysis. Mice with ‘missed’ injections, incomplete ‘hits’ or expression outside the area of interest were excluded from analysis after post hoc examination of mCherry expression. In this way, all food intake measurements were randomised and blind to the experimenter.Dark-cycle feeding studies were conducted between 6:00pm to 9:00pm and intake was monitored for three hours. For post-fast refeed studies, animals were fasted overnight at 5:00pm and food returned the following morning at 9:00am. Food intake was monitored for five hours after photostimulation. Light-cycle feeding studies were conducted between 9:00am to 12:00pm and intake was monitored for three hours.
In vivo optogenetic studies
In vivo photostimulation was conducted as previously described[32]. Fiber optic cables (1.25 m long, 200 μm diameter, 0.37 NA; Doric Lenses) were firmly attached to the implanted fiber optic cannulae with zirconia sleeves (Doric Lenses). Animals were stimulated with blue light (473 nm) at 10 Hz, 5 ms pulses for 5 sec with a 1 sec recovery period (laser off) during stimulation trains to avoid neuronal transmitter depletion and tissue heating. Photostimulation was provided using a waveform generator (PCGU100; Valleman Instruments or Arduino electronics platform) that provided TTL input to a blue light laser (Laserglow). We adjusted the power of the laser such that the light power exiting the fiber optic cable was at least 10 mW. Using an online light transmission calculator for brain tissue http://web.stanford.edu/group/dlab/cgi-bin/graph/chart.php we estimated the light power at the ARC to be 18.35 mW/mm2. Mice were tethered to the patch cords at least 1 hour prior to the commencement of any experiment.To test the sufficiency of DMHLepR→ARC neurons for satiety mice were tested under two conditions of physiological hunger, at the onset of the dark cycle and refeeding following an overnight fast.. For dark cycle feeding analysis mice with ad libitum access to food were photostimulated for 10 min prior to the onset of the dark cycle (which serves as a natural cue for the initiation of feeding behaviour) and photostimulation maintained for the duration of the study. For post-fast refeeding analysis mice were photostimulated 10 min prior to food presentation (which serves as an experimental cue for the initiation of feeding behaviour) and photostimulation maintained for the duration of the study. In the explicit case of the ‘ON (After) group’ in Figure 2D, mice were allowed to consume freely for 5 min and then photostimulated for the duration of the experiment.
Behavioural profiling
Open field testing was conducted in ad libitum fed mice during the light cycle. Mice were placed in a large arena (40 cm × 40 cm) in which they were allowed to freely explore for 20 min. Trials were recorded via a CCD camera interfaced with Ethovision software for offline analysis of distance moved, time spent at the edge and center of the arena. Animals were run in a counter-balanced order of laser-on versus laser-off to avoid acclimation.For assessment of homecage behaviour mice were compared in the fasted state with photostimulation and ad libitum fed state during the light cycle in the absence of food. 10 minute trials were recorded via a CCD camera interfaced with Ethovision software for offline analysis of time spent grooming and total distance moved. Animals were run in a counter-balanced order of laser-on versus laser-off to avoid acclimation. Locomotor activity during the dark cycle was also assessed in ad libitum fed mice with and without laser stimulation, in the presence of food.
In vivo fiber photometry
All photometery experiments were conducted as within-subject, with animals tested in both the fed and fasted state. Studies were conducted in the animal’s homecage. Beginning two weeks post-surgery (details above) mice were food restricted to 85–90% of starting body weight. Over this one week period mice were acclimated to the chow pellets (both small and large) used in subsequent photometry experiments. Mice were habituated to the paradigm for 1–2 days prior to the first recording day. In vivo fiber photometry was conducted as previously described[8]. Fiber optic cables (1 m long, metal ferrule, 400 μm diameter; Doric Lenses) were firmly attached to the implanted fiber optic cannulae with zirconia sleeves (Doric Lenses). Laser light (473 nm) was focused on the opposite end of the fiber optic cable such that a light intensity of 0.1–0.2mW entered the brain; light intensity was kept constant across sessions for each mouse. Emission light was passed through a dichroic mirror (Di02-R488-25×36, Semrock) and GFP emission filter (FF03-525/50-25, Semrock), before being focused onto a sensitive photodetector (2151, Newport). The signal was passed through a low-pass filter (50Hz) and digitized with a National Instruments data acquisition card and collected using a custom MATLAB script. Photobleaching over the course of each 30 min run was negligible, most likely due to the very low laser power used for excitation (0.1 mW) and the short duration of each run. Although we continued to observe clear responses to food presentation at the end of each run (in the food restricted state) we did note average 37% decrease between first and last responses. It is possible that minor photobleaching contributed to this effect, though it was likely predominantly due to reduced novelty of food and some level of caloric repletion.Each 30 minute session consisted of 4–6 trials of chow (14 mg pellets) or chocolate (14 mg pellets) and 4–6 trials of a similar sized non-food object (bedding), in an alternating fashion. Large pellets (500 mg) required up to 15 minutes to consume and therefore only had 1–2 presentations per a run, with alternating non-food item presentation. Only one food type was used in a given run. Up to 4 runs were performed in a single day for each mouse and mice were run multiple days, with large pellet and chocolate runs never preceding small pellet runs. All trials across days (14mg: 12 ± 1 presentations per mouse; 500 mg: 6 ± 0.7; chocolate: 7 ± 0.6) were pooled to calculate mean response to food/object in each mouse. After fasted runs mice were given ad libitum access to chow for 5–7 days and the above studies repeated in the fed state. Within run responses to the same food stimulus showed a trend towards a decrease in response magnitude (decreasing by 37% from the first to the last instance of food availability; data not shown) this may reflect decreasing novelty or increasing satiety (as mice had consumed food throughout the run prior to the last instance of food presentation).For data analysis, fluorescent traces were down-sampled to 1Hz. dF/F (F − F0)/F0; where F0 was the 20 sec prior to food presentation) was calculated for each presentation of food. Small pellets (per 14mg pellet 0.01 Kcal from protein, 0.007 Kcal from fat and 0.03 Kcal from carbohydrate; Bio-Serv). Large pellets (per 500 mg pellet 0.38 Kcal from protein, 0.25 Kcal from fat and 1.18 Kcal from carbohydrate; Bio-Serv) or 14 mg chocolate (Hershey’s) or control (cob bedding of size comparable to food). In a subset of mice both time of food availability and the moment when the mouse first made contact with the food item were recorded. For analysis differentiating approach from consumption, the 10s prior to food availability was compared to the time between food availability and consumption and to the 10s following contact with the food item.
Monosynaptic rabies mapping
AgRP-ires-Cre::RABVgp4-TVA mice expressing the avian TVA receptor and rabies glycoprotein selectively in ARCAgRP neurons were injected with SADΔG–EGFP (EnvA) rabies (Salk Gene Transfer Targeting and Therapeutics Core; titer 7.5 × 108 infectious units per ml) unilaterally into the ARC (n=3). Animals were allowed 6 days for retrograde transport of rabies virus and EGFP expression before perfusion and tissue collection. Sites of afferent input to ARCAgRP neurons were assessed by the presence of EnvA-EGFP positive neurons and the slides imaged on an Olympus VS120 slide scanner microscope.
Rabies collateral mapping[17]
Three weeks after unilateral injection of AAV8-EFIα-DIO-TVA-mCherry (University of North Carolina Vector Core; titer 1.1 × 1012 genomes copies per ml) into the DMH of LepR-ires-Cre mice, SADΔG–EGFP (EnvA) rabies (Massachusetts General Hospital Vector Core; titer 107 infectious units per ml) was unilaterally injected into the ARC. Animals were allowed 6 days for retrograde transport of rabies virus and EGFP transgene expression before perfusion and tissue collection. Comprehensive examination of SADΔG–EGFP (EnvA) axonal and retrograde transductions were obtained using 10–15 confocal images of DMHLepR→ARC boutons along the neuraxis using an Zeiss LSM-510 confocal microscope.
Statistical analysis
Statistical analyses were performed using Origin Pro 8.6 and Prism 6.0 (GraphPad) software. Details of statistical tests employed can be found in the relevant figure legends and supplementary methods checklist. Power analyses were calculated to estimate sample size using statistical conventions for 80% power, assuming a standard deviation of change of 1.0, a difference between the means of 1.5-fold and alpha level of 0.05. In all statistical tests normal distribution and equal variance was established. The data presented met the assumptions of the statistical test employed. No randomisation of animals was conducted since all behavioral tests were within-subject comparisons. Exclusion criteria for experimental animals were a) sickness or death during the testing period or b) if histological validation of the injection site demonstrated an absence of reporter gene expression. These criteria were established prior to data collection. N-numbers represent final number of healthy/validated animals.
Data availability
The data that support the findings of this study are available from the corresponding author upon request.
Authors: Eyal Vardy; J Elliott Robinson; Chia Li; Reid H J Olsen; Jeffrey F DiBerto; Patrick M Giguere; Flori M Sassano; Xi-Ping Huang; Hu Zhu; Daniel J Urban; Kate L White; Joseph E Rittiner; Nicole A Crowley; Kristen E Pleil; Christopher M Mazzone; Philip D Mosier; Juan Song; Thomas L Kash; C J Malanga; Michael J Krashes; Bryan L Roth Journal: Neuron Date: 2015-04-30 Impact factor: 17.173
Authors: Anthony N van den Pol; Yang Yao; Li-Ying Fu; Kylie Foo; Hao Huang; Roberto Coppari; Bradford B Lowell; Christian Broberger Journal: J Neurosci Date: 2009-04-08 Impact factor: 6.167
Authors: Yoav Livneh; Rohan N Ramesh; Christian R Burgess; Kirsten M Levandowski; Joseph C Madara; Henning Fenselau; Glenn J Goldey; Veronica E Diaz; Nick Jikomes; Jon M Resch; Bradford B Lowell; Mark L Andermann Journal: Nature Date: 2017-06-14 Impact factor: 49.962
Authors: João Paulo Cavalcanti-de-Albuquerque; Eduardo de Souza Ferreira; Denise Pires de Carvalho; Antonio Galina Journal: Mol Neurobiol Date: 2017-11-08 Impact factor: 5.590