Literature DB >> 27631733

Cosavirus, Salivirus and Bufavirus in Diarrheal Tunisian Infants.

Siwar Ayouni1,2, Marie Estienney1, Sabeur Hammami3,4, Mohamed Neji Guediche3,4, Pierre Pothier1,5, Mahjoub Aouni2, Gael Belliot1,5, Alexis de Rougemont1,5.   

Abstract

Three newly discovered viruses have been recently described in diarrheal patients: Cosavirus (CosV) and Salivirus (SalV), two picornaviruses, and Bufavirus (BuV), a parvovirus. The detection rate and the role of these viruses remain to be established in acute gastroenteritis (AGE) in diarrheal Tunisian infants. From October 2010 through March 2012, stool samples were collected from 203 children <5 years-old suffering from AGE and attending the Children's Hospital in Monastir, Tunisia. All samples were screened for CosV, SalV and BuV as well as for norovirus (NoV) and group A rotavirus (RVA) by molecular biology. Positive samples for the three screened viruses were also tested for astrovirus, sapovirus, adenovirus, and Aichi virus, then genotyped when technically feasible. During the study period, 11 (5.4%) samples were positive for one of the three investigated viruses: 2 (1.0%) CosV-A10, 7 (3.5%) SalV-A1 and 2 (1.0%) BuV-1, whereas 71 (35.0%) children were infected with NoV and 50 (24.6%) with RVA. No mixed infections involving the three viruses were found, but multiple infections with up to 4 classic enteric viruses were found in all cases. Although these viruses are suspected to be responsible for AGE in children, our data showed that this association was uncertain since all infected children also presented infections with several enteric viruses, suggesting here potential water-borne transmission. Therefore, further studies with large cohorts of healthy and diarrheal children will be needed to evaluate their clinical role in AGE.

Entities:  

Mesh:

Year:  2016        PMID: 27631733      PMCID: PMC5025138          DOI: 10.1371/journal.pone.0162255

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Diarrhea remains a frequent illness throughout the world and causes the death of almost 6 million children annually, especially in developing countries. Besides well-documented enteric viruses, the list of viral pathogens causing acute gastroenteritis (AGE) is continuously growing with the emergence of new viruses. No less than three new types of virus have been discovered in diarrheal patients these last years: Cosavirus and Salivirus, two new genera in the Picornaviridae family since 2013, and Bufavirus from the Protoparvovirus genus of the Parvoviridae. Cosavirus (CosV) was first identified in 2008 from children suffering from acute flaccid paralysis but has been later associated with diarrhea. It has been detected in feces from both patients with gastroenteritis and healthy subjects [. CosV has a single-stranded RNA genome of around 7.6 Kb organized in a typical picornavirus genome and has a wide genetic diversity: not less than 6 species (noted A to F) have already been described, of which CosV-A includes 24 different genotypes, and CosV-D includes 5 different genotypes [. Salivirus (SalV) was first identified in 2009 [. SalV has a single-stranded RNA genome of around 7.1Kb organized in a typical picornavirus genome. Although this virus is related, but distinct, to the Kobuvirus genus, SalV forms a genus that presently includes a single genotype with 2 clusters [. Human salivirus (also formerly called klasseviruses) has been associated with diarrhea and detected in feces from both gastroenteritis patients and healthy subjects from all continents, as well as in sewage from Spain and Hong-Kong, suggesting a widespread geographic distribution [. Bufavirus (BuV) was first discovered in 2012 in fecal samples from children suffering from diarrhea in Burkina Faso, from which it get its name [. Thereafter, BuV was detected in diarrheal stool samples of children from other continents [. BuV has a single-stranded DNA genome of around 4.9Kb, which encodes nonstructural protein 1 (NS1) and viral structural protein (VP2). Three genotypes (BuV1, 2 and 3) have been described so far [, but diversity within the capsid gene suggests the possibility of several other genotypes [. Whether these viruses are etiologic agents of human gastroenteritis remains unclear, but knowledge about their distribution and genetic divergence in humans is mounting. In this context, the detection rate and the role of these new viruses in AGE in diarrheal infants remain to be established.

Methods

From October 2010 through March 2012, stool samples were collected from 203 children <5 years-old suffering from AGE and attending the Fattouma-Bourguiba Children’s Hospital in Monastir, Tunisia. The children’s median age (MA) was 7.0 mo (ranging 0.5 to 60 mo), and the sex ratio was 1.29. The study and the data collection procedure were approved by the Ethics and Research Committee of the Fattouma-Bourguiba Public Hospital. Informed consents were obtained verbally from the parents of the study participants and consigned in their clinical records in accordance to the Tunisian good clinical practices and hospital clinical investigations guidelines. The samples were anonymized before processing. For each stool sample, nucleic acids were extracted from 800 μl of 10% fecal suspension in PBS on a Nuclisens® EasyMAG system (bioMérieux, Marcy l’Etoile, France), according to the manufacturer’s instructions. RNA/DNA was eluted in a final volume of 110 μL. CosV and SalV were screened by nested RT-PCR using primer sets targeting the 5’UTR region [; and BuV by nested PCR using primer sets targeting the NS1 region [. Virus characterization was performed using primer sets targeting various regions: capsid (VP1) and polymerase (3Dpol) for CosV [; capsid (VP0), helicase (2Chel) and polymerase (3Dpol) for SalV [; and the capsid protein region (VP2) for BuV using the following designed primers: ARUB259: 5’- ATCTCTTTGTTAACCTTGCTAGAAAAAAAG -3’ and ARUB261: 5’- TTASWWTGTGTAGTTWGGCATDSMTC -3’ giving a PCR product of 1710 nt. Primer details are provided in . RT-PCRs were performed using the Qiagen OneStep RT-PCR kit (Qiagen GmbH, Hilden, Germany) and PCRs with Novagen KOD Hot Start polymerase kit (EMD Millipore, Darmstadt, Germany) on an Eppendorf MasterCycler PCR machine (Eppendorf AG, Hamburg, Germany), according to the manufacturer’s instructions. Sequences were obtained with the ABI Big Dye sequencing kit on an ABI 3130XL sequencer (Applied Biosystems, Waltham, USA). Phylogenetic analysis were performed using using MEGA6 software [. After sequence alignment using the MUSCLE programme with a maximum of 64 iterations [, phylogenetic trees were inferred using the Maximum Likelihood method based on the Tamura-3-parameter model with a discrete gamma distribution, which was the best-fit DNA substitution model for the nucleotide dataset submitted. Bootstrap values were calculated from 1000 replicates. The nucleotide sequences were deposited in the GenBank database under the accession numbers: KU362760 to KU362792. All samples were tested for norovirus (NoV) and group A rotavirus (RVA) by RT-qPCR. Positive samples for the three screened viruses were also tested for astrovirus (AstV) and sapovirus (SaV) by RT-qPCR, adenovirus (AdV) by qPCR and Aichi virus (AiV) by RT-PCR then genotyped when technically feasible, using the NRC’s PCR screening and typing procedures as reported in . Secretor status of positive individuals has been determined by genotyping on blood samples by using the methods described in our previous studies [.

Results and Discussion

During the study period, 71 (35.0%) children were infected with norovirus and 50 (24.6%) with rotavirus, of which 11 were mixed infections. In all, 11 (5.4%) samples were positive for one of the three investigated viruses: 2 (1.0%) CosV (MA = 12.0 mo.), 7 (3.5%) SalV (MA = 6.0 mo.) and 2 (1.0%) BuV (MA = 20.8 mo.). Of note, all individuals infected by these new viruses were secretors. No mixed infections involving these viruses were found, but multiple infections with 1 to 4 viruses responsible for GEA in humans were found in all cases (. These mixtures of several enteric viruses, particularly with non-enteric adenoviruses, suggest here an environmental contamination from soiled waters. While both CosV and BuV infections occurred during winter in 2 different seasons, most SalV infections occurred in the autumn of the second season of the survey (. However, the number of tested stools being rather limited, a larger sampling will be required to confirm any seasonality pattern. CosV: cosavirus; SalV: salivirus; BuV: bufavirus; NoV: norovirus; RVA: rotavirus; AstV: astrovirus; AdV: adenovirus; SaV: sapovirus; AiV: Aichi virus * Genotypes are shown when available; ‒: negative; +: positive; M: male; F: female a Polymerase region b Helicase region c 5’UTR region d VP region Our data showed that the detection rate of CosV in diarrheal children (1%) was lower than observed in China or Brazil, where they were reported in diarrheal children in 2.8% and 3.6% of patients [, respectively. CosV has been previously reported in up to 33.0% of healthy Tunisian subjects or suffering from non-polio acute flaccid paralysis, most of them being children <6 years old [. However, the difference in detection rates is due to different natures of the two cohorts. According to phylogenetic analysis of their VP1 regions, the two CosV strains, H036 and H226, were closely related to the genotype A10. Indeed, they shared 87% and 88% of their nucleotide sequences, respectively, but 98% of their amino acids (aa) sequences with the Nepalese NP8/3 CosV strain (JQ811823) (. Since the 3Dpol sequence of the NP8/3 strain is not known and the length of the sequences is short, their 3Dpol regions were closely related to the Nigerian NG263 CosV strain (JN867756), which belongs to the genotype A20, with 93% and 94% of nucleotide sequence homology, respectively (. Of note, the VP1 sequences of our strains shared merely 56% of their aa sequences with the NG263 strain.

Phylogenetic trees of cosaviruses detected in diarrheal Tunisian children.

A. VP1 region of cosavirus (904 nt); B. 3Dpol region of cosavirus (400 nt). Phylogenetic trees were inferred using the Maximum Likelihood method based on the Tamura-3-parameter nucleotide substitution model with a discrete gamma distribution. Bootstraps values were calculated from 1000 replicates. Strains of this study are shown in red. Genotypes are shown in bold. In this study, the detection rate of SalV infections accounted for 3.5% of the Tunisian cases, which is close to the 4.2% observed in Chinese children but much less than the 8.8% of cases in South Korea [. Although they are globally widespread, SalV seem to circulate more in Asia that in North Africa. Interestingly, the detection rate of SalV in this study was similar to the detection rate of AiV (3.6%) in Tunisian children [. Since Salivirus is a genus phylogenetically close to Kobuvirus, both viruses might share some epidemiology characteristics that remain to be defined. Phylogenetic analysis of VP0, 2Chel and 3Dpol regions of 6 of the 7 detected SalV also showed that they belonged to the cluster A1 and were all closely related with various Asian strains, especially from South Korea (. Further analysis also showed that the nt and aa sequences of the Tunisian clustering strains (i.e. strains H010, H142, H144, H159 and H214) had 99% of homology with Hungarian strains detected 1 year later in newborns suffering from AGE [ (data not show).

Phylogenetic trees of saliviruses detected in diarrheal Tunisian children.

A. VP0 region of salivirus (815 nt); B. 2CHel region of salivirus (275 nt); C. 3Dpol region of (686 nt); Phylogenetic trees were inferred using the Maximum Likelihood method based on the Tamura-3-parameter nucleotide substitution model with a discrete gamma distribution. Bootstraps values were calculated from 1000 replicates. Strains of this study are shown in blue. Genotypes are shown in bold. With a low detection rate (1%), BuV were only found occasionally in Tunisian stools. These findings are similar to those observed in children from Asia, Europe or Africa where detection rates range from 0.5% to 4.0% in patients of all ages [. Given that this present study was focused only on young children, our results suggest that BuV detection rate is the similar in young children as the rest of the Tunisian population. Complete VP2 sequences of H040 and H232 BuV strains showed that both strains belonged to genotype 1 and shared 99% of their sequence with published West-African and Finnish strains (. The 2 BuV strains shared 99% of their VP2 aa sequences (7/569 aa substitutions). Although NS1 sequences appeared more closely related to strains from genotype 3 (, aa sequence analysis of BuV polymerase showed small divergence between genotypes. Serological studies will be needed to get a better picture of BuV circulation in Tunisian population.

Phylogenetic trees of bufaviruses detected in diarrheal Tunisian children.

A. VP2 region of bufavirus (1710 nt); B. NS1 region of bufavirus (441 nt) Phylogenetic trees were inferred using the Maximum Likelihood method based on the Tamura-3-parameter nucleotide substitution model with a discrete gamma distribution. Bootstraps values were calculated from 1000 replicates. Strains of this study are shown in green. Genotypes are shown in bold.

Conclusion

Although these new viruses are suspected to be responsible for AGE in children, our data showed that this association was uncertain since all infected children also presented infections with several enteric viruses. Nevertheless, these multiple infections exemplified the threat that enteric viruses pose in terms of public health within communities in North Africa and generally in developing countries. Therefore, further studies with large cohorts of healthy and diarrheal children will be needed to evaluate their clinical role in AGE.

GenBank Accession Numbers.

(DOCX) Click here for additional data file.

Oligonucleotides used for detection and genotyping of classic enteric viruses in this study.

(PDF) Click here for additional data file.
Table 1

Oligonucleotides used for detection and genotyping of cosavirus, salivirus and bufavirus in this study.

VirusMethodTargetPrimerNucleotide SequenceReference
CosavirusRT-PCR5’UTRDKV-N5U-F1CGT GCT TTA CAC GGT TTT TGAKapoor et al, 2008 [1]
(1st round)DKV-N5U-R1GGT ACC TTC AGG ACA TCT TTG G
VP1INO-VP1-F1GAI CAR GCI ATG ATG GGI ACKapusinszky et al, 2012 [2]
INO-VP1-R2GCI GGI CCI GGR TTK GWY TC
3DpolDKV-IF1CTA CCA RAC ITT YCT IAA RGAKapoor et al, 2008 [1]
DKV-IR1GCA ACA ACI ATR TCR TCI CCR TA
PCR5’UTRDKV-N5U-F2ACG GTT TTT GAA CCC CAC ACKapoor et al, 2008 [1]
(2nd round)DKV-N5U-R2GTC CTT TCG GAC AGG GCT TT
VP1INO-VP1-F1-2GCC ATG ATG GGI ACI TWY DCI ATI TGG GAKapusinszky et al, 2012 [2]
INO-VP1-R3TAR TCI GGR TAI CCR TCR AA
3DpolDKV-IF2CTA CCA GAC ATT TCT CAA RGA YGAKapoor et al, 2008 [1]
DKV-IR2CCG TGC CAG AIG GIA RIC CIC C
SalivirusRT-PCR5’UTRSAL-L1CCC TGC AAC CAT TAC GCT TAShan et al, 2010 [12]
(1st round)SAL-R1CAC ACC AAC CTT ACC CCA CC
VP0LG0119GCT AAC TCT AAT GCT GCC ACCHoltz et al, 2009 [4]
LG0136GCT AGG TCA GTG GAA GGA TCA
2ChelKL-2C-F1CTC GCY GAG GAC ATC ACG GAHan et al, 2010 [13]
KL-2C-R1GTA CAG GTA CAC RAC CAG TGG CT
3DpolLL-3D-F1GAA GAT GCC ATT CGT GGT CTCLi et al, 2009 [14]
LL-3D-R1AGT CCA GAA CAC GAC CAG GTT
PCR5’UTRSAL-L2ATT GAG TGG TGC ATG TGT TGShan et al, 2010 [12]
(2nd round)SAL-R2ACA AGC CGG AAG ACG ACT AC
VP0KLVPFGTC ACY CCM AAC ACC TCC ACT GAA GHan et al, 2010 [13]
KLVPRTTC TGC RCC ATC RGC TCC CGA
2ChelKL-2C-F2AAT CTG CTG CCC AGG CCG CHan et al, 2010 [13]
KL-2C-R2AGG GAG ATG GCR GAG AGA GCT GT
3DpolLL-3D-F2CTT TCC CAA TCT CCT GGC TACLi et al, 2009 [14]
LL-3D-R2GAA GGA CAG AGG GGA TAG TGG
BufavirusRT-PCRNS1BF.F1TCA ACA ATC ACT CAG GCA AAT GGPhan et al, 2012 [6]
(1st round)BF.R1AGT TTG CCT GGA TGT TCT TTG A
PCRNS1BF.F2CTA ACA CTG GTA CTT GCT ATG GACPhan et al, 2012 [6]
(2nd round)BF.R2TTC TCT GGT GAT GAT TCT TTT GTC
Table 2

Demographic characteristic and detected enteric viruses in patients with cosavirus, salivirus or bufavirus infections.

New viruses detectedGenotypeSample IDAge, mo / sexSample dateOther viruses tested*GenBank Accession Numbers
NoVRVAAstVAdVSaVAiV
CosVA10H0369/M2011/01/21GII.g/GII.1AdV-2GI.2AiV-AKU362764a, KU362766b, KU362784c, KX721253d
A10H2263/F2012/03/15+KU362765a,KU362785cKX721254d
SalVA1H01027/M2011/03/09G2P[4]+KU362767d, KU362773a, KU362779b, KU362786c
A1H10813/M2011/12/03G9P[8]+GII.1KU362768d, KU362774a, KU362780b, KU362787c
A1H14212/M2011/10/04GII.P21/GII.3G4P[8]AdV-41KU362769d, KU362775a, KU362781b, KU362788c
A1H1442.5/F2011/09/30+KU362770d, KU362776a, KU362782b, KU362789c
A1H1596/F2011/10/20GII.P21/GII.3AdV-6KU362771d, KU362777a, KU362783b, KU362790c
A1H16939/M2012/02/18G3P[8]KU362791c
A1H2147/M2011/11/15HAstV-5KU362772d, KU362778a, KU362792c
BuV1H0402.5/M2011/01/30GII+AdV-6KU362760a, KU362762d
1H23239/M2012/03/05GxP[8]AdV-2KU362761a, KU362763d

CosV: cosavirus; SalV: salivirus; BuV: bufavirus; NoV: norovirus; RVA: rotavirus; AstV: astrovirus; AdV: adenovirus; SaV: sapovirus; AiV: Aichi virus

* Genotypes are shown when available; ‒: negative; +: positive; M: male; F: female

a Polymerase region

b Helicase region

c 5’UTR region

d VP region

  35 in total

1.  Amino acid substitution within the VP7 protein of G2 rotavirus strains associated with failure to serotype.

Authors:  M I Gómara; D Cubitt; U Desselberger; J Gray
Journal:  J Clin Microbiol       Date:  2001-10       Impact factor: 5.948

2.  Human cosavirus infections in children in China.

Authors:  X Q Dai; X G Hua; T L Shan; Eric Delwart; W Zhao
Journal:  J Clin Virol       Date:  2010-07       Impact factor: 3.168

3.  A highly prevalent and genetically diversified Picornaviridae genus in South Asian children.

Authors:  Amit Kapoor; Joseph Victoria; Peter Simmonds; Elizabeth Slikas; Thaweesak Chieochansin; Asif Naeem; Shahzad Shaukat; Salmaan Sharif; Muhammad Masroor Alam; Mehar Angez; Chunlin Wang; Robert W Shafer; Sohail Zaidi; Eric Delwart
Journal:  Proc Natl Acad Sci U S A       Date:  2008-11-25       Impact factor: 11.205

4.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

5.  Relationship between GII.3 norovirus infections and blood group antigens in young children in Tunisia.

Authors:  S Ayouni; M Estienney; K Sdiri-Loulizi; K Ambert-Balay; A de Rougemont; S Aho; S Hammami; M Aouni; M N Guédiche; P Pothier; G Belliot
Journal:  Clin Microbiol Infect       Date:  2015-05-21       Impact factor: 8.067

6.  Parkville virus: a novel genetic variant of human calicivirus in the Sapporo virus clade, associated with an outbreak of gastroenteritis in adults.

Authors:  J S Noel; B L Liu; C D Humphrey; E M Rodriguez; P R Lambden; I N Clarke; D M Dwyer; T Ando; R I Glass; S S Monroe
Journal:  J Med Virol       Date:  1997-06       Impact factor: 2.327

7.  Bufavirus genotype 3 in Turkish children with severe diarrhoea.

Authors:  A Altay; T Yahiro; G Bozdayi; T Matsumoto; F Sahin; S Ozkan; A Nishizono; M Söderlund-Venermo; K Ahmed
Journal:  Clin Microbiol Infect       Date:  2015-06-15       Impact factor: 8.067

8.  Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II.

Authors:  Allegra Kyria da Silva; Jean-Claude Le Saux; Sylvain Parnaudeau; Monique Pommepuy; Menachem Elimelech; Françoise S Le Guyader
Journal:  Appl Environ Microbiol       Date:  2007-10-12       Impact factor: 4.792

9.  Genetic diversity of the genus Cosavirus in the family Picornaviridae: a new species, recombination, and 26 new genotypes.

Authors:  Beatrix Kapusinszky; Tung G Phan; Amit Kapoor; Eric Delwart
Journal:  PLoS One       Date:  2012-05-16       Impact factor: 3.240

10.  Identification of Bufavirus-1 and Bufavirus-3 in Feces of Patients with Acute Diarrhea, China.

Authors:  Dou-Dou Huang; Wei Wang; Qing-Bin Lu; Jin Zhao; Chen-Tao Guo; Hong-Yu Wang; Xiao-Ai Zhang; Yi-Gang Tong; Wei Liu; Wu-Chun Cao
Journal:  Sci Rep       Date:  2015-08-19       Impact factor: 4.379

View more
  11 in total

1.  Persistent Detection of Cosavirus and Saffold Cardiovirus in Riachuelo River, Argentina.

Authors:  Gabriela Riviello López; Leila Marina Martinez; Laura Freyre; María Cecilia Freire; Sara Vladimirsky; Alejandro Rabossi; Daniel Marcelo Cisterna
Journal:  Food Environ Virol       Date:  2020-11-09       Impact factor: 2.778

2.  Molecular Detection of Human Salivirus in Italy Through Monitoring of Urban Sewages.

Authors:  Pamela Mancini; Giusy Bonanno Ferraro; Elisabetta Suffredini; Carolina Veneri; Marcello Iaconelli; Teresa Vicenza; Giuseppina La Rosa
Journal:  Food Environ Virol       Date:  2019-10-22       Impact factor: 2.778

3.  High viral load detection of human Cosavirus in Iranian pediatric patients with acute gastroenteritis.

Authors:  Sadaf Khoshbazan; Zahra Ivani; Seyed Dawood Mousavi Nasab; Nayebali Ahmadi; Aynaz Parhiz; Bahman Khalesi; Mohammad Hassan Firouzjani; Mostafa Ghaderi; Maryam Barati; Mohammad Javad Ehsani Ardakani
Journal:  Gastroenterol Hepatol Bed Bench       Date:  2021

Review 4.  Human Protoparvoviruses.

Authors:  Elina Väisänen; Yu Fu; Klaus Hedman; Maria Söderlund-Venermo
Journal:  Viruses       Date:  2017-11-22       Impact factor: 5.048

5.  Global Distribution of Human Protoparvoviruses.

Authors:  Elina Väisänen; Ushanandini Mohanraj; Paula M Kinnunen; Pikka Jokelainen; Haider Al-Hello; Ali M Barakat; Mohammadreza Sadeghi; Farid A Jalilian; Amir Majlesi; Moses Masika; Dufton Mwaengo; Omu Anzala; Eric Delwart; Olli Vapalahti; Klaus Hedman; Maria Söderlund-Venermo
Journal:  Emerg Infect Dis       Date:  2018-07       Impact factor: 6.883

Review 6.  Advances in Diagnostic Approaches for Viral Etiologies of Diarrhea: From the Lab to the Field.

Authors:  Yashpal Singh Malik; Atul Kumar Verma; Naveen Kumar; Nadia Touil; Kumaragurubaran Karthik; Ruchi Tiwari; Durlav Prasad Bora; Kuldeep Dhama; Souvik Ghosh; Maged Gomaa Hemida; Ahmed S Abdel-Moneim; Krisztián Bányai; Anastasia N Vlasova; Nobumichi Kobayashi; Raj Kumar Singh
Journal:  Front Microbiol       Date:  2019-09-13       Impact factor: 5.640

7.  Detection and Characterization of Human Enteroviruses, Human Cosaviruses, and a New Human Parechovirus Type in Healthy Individuals in Osun State, Nigeria, 2016/2017.

Authors:  Folakemi Abiodun Osundare; Oladele Oluyinka Opaleye; Akeem Abiodun Akindele; Samuel Adeyinka Adedokun; Olusola Anuoluwapo Akanbi; Claus-Thomas Bock; Sabine Diedrich; Sindy Böttcher
Journal:  Viruses       Date:  2019-11-07       Impact factor: 5.048

8.  Enteric virome negatively affects seroconversion following oral rotavirus vaccination in a longitudinally sampled cohort of Ghanaian infants.

Authors:  Andrew HyoungJin Kim; George Armah; Francis Dennis; Leran Wang; Rachel Rodgers; Lindsay Droit; Megan T Baldridge; Scott A Handley; Vanessa C Harris
Journal:  Cell Host Microbe       Date:  2021-12-20       Impact factor: 21.023

9.  Viral species richness and composition in young children with loose or watery stool in Ethiopia.

Authors:  Kristen Aiemjoy; Eda Altan; Solomon Aragie; Dionna M Fry; Tung G Phan; Xutao Deng; Melsew Chanyalew; Zerihun Tadesse; E Kelly Callahan; Eric Delwart; Jeremy D Keenan
Journal:  BMC Infect Dis       Date:  2019-01-14       Impact factor: 3.090

10.  Human Protoparvovirus DNA and IgG in Children and Adults with and without Respiratory or Gastrointestinal Infections.

Authors:  Ushanandini Mohanraj; Maija Jokinen; Rajita Rayamajhi Thapa; Minna Paloniemi; Timo Vesikari; Maija Lappalainen; Eveliina Tarkka; Zaiga Nora-Krūkle; Anda Vilmane; Kim Vettenranta; Charles Mangani; Sami Oikarinen; Yue-Mei Fan; Per Ashorn; Elina Väisänen; Maria Söderlund-Venermo
Journal:  Viruses       Date:  2021-03-15       Impact factor: 5.048

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.