Literature DB >> 27564988

Construction of Marker-Free Transgenic Strains of Chlamydomonas reinhardtii Using a Cre/loxP-Mediated Recombinase System.

Yuki Kasai1, Shigeaki Harayama1.   

Abstract

The Escherichia coli bacteriophage P1 encodes a site-specific recombinase called Cre and two 34-bp target sites of Cre recombinase called loxP. The Cre/loxP system has been used to achieve targeted insertion and precise deletion in many animal and plant genomes. The Cre/loxP system has particularly been used for the removal of selectable marker genes to create marker-free transgenic organisms. For the first time, we applied the Cre/loxP-mediated site-specific recombination system to Chlamydomonas reinhardtii to construct marker-free transgenic strains. Specifically, C. reinhardtii strains cc4350 and cc124 carrying an aphVIII expression cassette flanked by two direct repeats of loxP were constructed. Separately, a synthetic Cre recombinase gene (CrCRE), the codons of which were optimized for expression in C. reinhardtii, was synthesized, and a CrCRE expression cassette was introduced into strain cc4350 carrying a single copy of the loxP-flanked aphVIII expression cassette. Among 46 transformants carrying the CrCRE expression cassette stably, the excision of aphVIII by CrCre recombinase was observed only in one transformant. We then constructed an expression cassette of an in-frame fusion of ble to CrCRE via a short linker peptide. The product of ble (Ble) is a bleomycin-binding protein that confers resistance to bleomycin-related antibiotics such as Zeocin and localizes in the nucleus. Therefore, the ble-(linker)-CrCRE fusion protein is expected to localize in the nucleus. When the ble-(linker)-CrCRE expression cassette was integrated into the genome of strain cc4350 carrying a single copy of the loxP-flanked aphVIII expression cassette, CrCre recombinase-mediated excision of the aphVIII expression cassette was observed at a frequency higher than that in stable transformants of the CrCRE expression cassette. Similarly, from strain cc124 carrying a single loxP-flanked aphVIII expression cassette, the aphVIII expression cassette was successfully excised after introduction of the ble-(linker)-CrCRE expression cassette. The ble-(linker)-CrCRE expression cassette remained in the genome after excision of the aphVIII expression cassette, and it was subsequently removed by crossing with the wild-type strain. This precise Cre-mediated deletion method applicable to transgenic C. reinhardtii could further increase the potential of this organism for use in basic and applied research.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27564988      PMCID: PMC5001723          DOI: 10.1371/journal.pone.0161733

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The green unicellular alga Chlamydomonas reinhardtii has been widely used as a model system for studying the genetic and molecular mechanisms of biological processes such as photosynthesis and flagellar motility [1, 2, 3]. Recently, this alga has also been used to manipulate metabolic pathways involved in biofuel and hydrogen production using the range of genetic manipulation tools available to this organism [4, 5, 6, 7]. However, the number of selectable marker genes used in C. reinhardtii is limited even though availability of multiple selectable markers is necessary for the sequential introduction of transgenes. C. reinhardtii is considered to be a model organism for basic research and an industrial biotechnology host [8]. For the large-scale deployment of transgenic C. reinhardtii for various industrial applications, there are public concerns regarding the spread of marker genes in the environment. Therefore, efficient methods for the removal of marker genes from transgenic C. reinhardtii are highly anticipated. Sexual crossing is a powerful tool for this purpose. However, this technique cannot be used if the linkage between a marker gene and a co-introduced transgene is tight. Such tight linkage between a marker gene and co-introduced transgenes was observed in transgenic rice and soybean generated by biolistic bombardment, in which most of the transgenes were co-integrated together with a marker gene at one or multiple loci [9, 10, 11]. Co-transformation of plants by Agrobacterium tumefaciens-mediated transformation using multiple plasmids also resulted in the integration of multiple T-DNAs at the same locus on plant chromosomes [12, 13, 14]. Thus, although the fate of multiple-plasmid co-transformation in C. reinhardtii was not examined systematically, we presume that multiple plasmids are frequently integrated at the same locus, leading to a tight genetic linkage between marker genes and co-introduced transgenes in transgenic C. reinhardtii. One strategy to increase co-transformation frequency is the use of a marker gene physically linked to a gene of interest [15]. Several vectors systems were developed for this purpose [16, 17], including those enabling sustained expression of transgenes in recipients [18]. In cases in which transgenes were obtained using such vectors, the marker gene and transgene are genetically linked and usually inherited together. The genomic sequence of C. reinhardtii includes numerous functionally uncharacterized genes [19]. Reverse genetics is a robust method for revealing the functions of such genes. Because C. reinhardtii displays an extremely low efficiency of homologous recombination [20, 21, 22], insertional random mutagenesis using selectable markers in C. reinhardtii was identified as a valuable tool for investigating diverse biological functions [23, 24, 25, 26, 27, 28, 29]. Although the removal of selectable markers from insertional mutants without the loss of mutant phenotypes is desired for further genetic manipulation or industrial application, marker rescue from insertional mutants using sexual crossing is not possible. To overcome the limitations of sexual crossing, several strategies have been developed to remove selectable markers from transgenic eukaryotic cells [30], including the use of site-specific DNA excision systems such as Cre/loxP from bacteriophage P1 [31, 32, 33, 34], Flp/frt from Saccharomyces cerevisiae [35, 36], R/RS from Zygosaccharomyces rouxii [37, 38], and Gin/gix from bacteriophage Mu [39]. In the bacteriophage P1 bipartite Cre/loxP-mediated site-specific DNA excision system, Cre recombinase specifically recognizes the loxP sequence of 34 bp in length and excises a DNA segment flanked by two direct repeats of loxP, leaving a single copy of loxP [40, 41, 42]. This system has been proven to be a powerful marker rescue tool in eukaryotes [43, 44, 45]. Curiously, no research on the use of Cre/loxP-mediated system in C. reinhardtii has been published. In this study, we discuss the exact excision of a marker gene from the nuclear genome of C. reinhardtii via Cre/loxP-mediated site-specific recombination. This report expands the list of available genetics tools in this organism.

Materials and Methods

Plasmid Construction

PCR for plasmid construction was performed using PrimeSTAR Max DNA polymerase (Takara) and appropriate primers, the sequences of which are listed in Table 1. aphVIII from Streptomyces rimosus encodes aminoglycoside 3′-phosphotransferase type VIII and confers resistance to paromomycin. The pSI103 plasmid carries the aphVIII expression cassette consisting of the C. reinhardtii HSP70_RBCS2 promoter, aphVIII, and the RBCS2 terminator [46]. For PCR amplification of the aphVIII expression cassette flanked by two direct repeats of loxP (loxP-P-aphVIII-T-loxP), the pSI103 plasmid was used as a template, and loxPphsp70_F1 and loxPtrbcS_R1 were employed as primers. The amplified fragment was digested using SmaI and XbaI and inserted between the SmaI and XbaI sites of the pBluescript II SK (+) plasmid to construct the ploxP-aphVIII plasmid (Fig 1).
Table 1

Primers used in this study.

PrimerSequence (5′ to 3′)Underlined sequence
Primers for plasmid construction
phsp70_F1TCCCCGGGATAACTTCGTATAGCATACATTATACGAAGTTATGAGCTCGCTGAGGCTTGACASmaI site
trbcS_R1CCTCTAGAATAACTTCGTATAATGTATGCTATACGAAGTTATCGCTTCAAATACGCCCAGCCXbaI site
phsp70_F2TCCCCGGGGAGCTCGCTGAGGCTTGACASmaI site
prbcS_R1TCAGCAGGTTGCTCATGCTTCGAAATTCTTCAGCACCGGUnderlined sequence is complementary to the underlined sequence of Crcre_F1
trbcS_F1CGCCTGCTGGAGGACGGCGACTAAGGATCCCCGCTCCGUnderlined sequence is complementary to the underlined sequence of Crcre_R1
trbcS_R2CACTCTAGAGCTTCAAATACGCCCAGCCCXbaI site
Crcre_F1GAAGAATTTCGAAGCATGAGCAACCTGCTGACCGTGCACCUnderlined sequence is complementary to the underlined sequence of prbcS_R1
Crcre_R1CGGAGCGGGGATCCTTAGTCGCCGTCCTCCAGCAGGCGUnderlined sequence is complementary to the underlined sequence of trbcS_F1
phsp70_F3CACAAGCTTGACGGCGGGGAGCTCGCTGAHindIII site
ble_RTTCTGGTGCACGGTCAGCAGGTTGTCCTGCTCCTCGGCCACGUnderlined sequence is complementary to the underlined sequence of Crcre_F2
Crcre_F2GCCGAGGAGCAGGACAACCTGCTGACCGTGCACCAGAACUnderlined sequence is complementary to the underlined sequence of ble_R
ble_R2GCGGCCGCCGGAGCCGCCGTCCTGCTCCTCGGCCACGAAGTGUnderlined sequence encodes a linker peptide, and is complementary to the underlined sequence of Crcre_F3
Crcre_F3GGCGGCTCCGGCGGCCGCATGAGCAACCTGCTGACCGTGCACCAUnderlined sequence encodes a linker peptide, and is complementary to the underlined sequence of ble_R2
Primers used for the detection of specific sequences
aphVIII_FATGGACGATGCGTTGCGT
aphVIII_RTCAGAAGAACTCGTCCAAC
loxP_FAGCCCGGGATAACTTCGTA
loxP_RGGCCGCTCTAGAATAACTTCGT
Crcre_F4GAGCACACCTGGAAGATGCT
Crcre_R2CAGGTAGTTGTTGGGGTCGT
trbcS_inv_F1GCGGTGGATGGAAGATACTGCTCTC
aphVIII_F2CGACTTGGAGGATCTGGACG
phsp70_inv_R2CCGCCAAATCAGTCCTGTAGCTTCA
trbcS_inv_F2AGTTTTGCAATTTTGTTGGTTGT
trbcS_inv_RGGGGCAAGGCTCAGATCAAC
LPm1_F2TCTGATTTTGACTGATTTCGAGGC
LPm1_R4GGACAGGTATCCGGTAAGCG
LPm19_FAGCACCGTGCACCACCTGCCTGCGCA
LPm19_RGCGTTGGCCGATTCATTAATGCAGCT
Fig 1

Structures of plasmids used in this study.

The abbreviations of genes and loci were as follows: aphVIII, the gene for aminoglycoside 3′-phosphotransferase type VIII conferring paromomycin resistance; CrCRE, the codon-optimized gene for Cre recombinase; ble, the gene for bleomycin/Zeocin-binding protein conferring bleomycin/Zeocin resistance; Phsp70-rbcS2, the artificial tandem promoter consisting of the HSP70A and RBCS2 promoters; TrbcS2, the terminator of RBCS2.

Structures of plasmids used in this study.

The abbreviations of genes and loci were as follows: aphVIII, the gene for aminoglycoside 3′-phosphotransferase type VIII conferring paromomycin resistance; CrCRE, the codon-optimized gene for Cre recombinase; ble, the gene for bleomycin/Zeocin-binding protein conferring bleomycin/Zeocin resistance; Phsp70-rbcS2, the artificial tandem promoter consisting of the HSP70A and RBCS2 promoters; TrbcS2, the terminator of RBCS2. The codons of the Cre recombinase gene were optimized on the basis of the nuclear codon usage of C. reinhardtii stored in the codon usage database at Kazusa DNA Research Institute (http://www.kazusa.or.jp/codon/). Codon optimization was performed using the OptimumGene™ algorithm, and the optimized gene (CrCRE) was synthesized by GenScript (New Jersey, USA). The CrCRE sequence was cloned into the pUC57 plasmid to create the pUCrcre plasmid. The pCrcre plasmid (Fig 1) carrying the CrCRE sequence flanked by the HSP70-RBCS2 promoter and RBCS2 terminator (hereafter referred as “the CrCRE expression cassette”) was constructed using an overlapping PCR method as follows. In the first step, three DNA fragments were amplified separately using PCR: the 0.7-kb HSP70-RBCS2 promoter sequence was amplified using phsp70_F2 and prbcS_R1 as primers and the pSI103 plasmid as a template; the 0.3-kb RBCS2 terminator sequence was amplified using trbcS_F1 and trbcS_R2 as primers and the pSI103 plasmid as a template; and the 1.0-kb CrCRE sequence was amplified using Crcre_F1 and Crcre_R1 as primers and the pUCrcre plasmid as a template. In the second step, the three fragments amplified in the first step were assembled into a single fragment by PCR using the three fragments as templates and phsp70_F2 and trbcS_R2 as primers. The amplified product was purified using a PCR purification kit (Qiagen), digested with SmaI and XbaI, and cloned between the SmaI and XbaI sites of the pBluescript II SK (+) plasmid. To facilitate the nuclear localization of CrCre recombinase, CrCRE was fused in frame to ble from Streptoalloteicus hindustanus, conferring bleomycin/Zeocin resistance [47], to generate ble-CrCRE expression cassette I as follows. A 1.2-kb fragment containing the HSP70-RBCS2 promoter fused to ble was amplified using phsp70_F3 and ble_R as the primers and the pMF59 plasmid [47] as a template. A 1.3-kb fragment containing CrCRE fused to the RBCS2 terminator was amplified using Crcre_F2 and trbcS_R2 as primers and the pCrcre plasmid as a template. The 1.2- and 1.3-kb fragments were assembled into a single fragment by PCR with the phsp70_F3 and trbcS_R2 primers to form ble-CrCRE expression cassette I. The cassette DNA was purified using a PCR purification kit (Qiagen), digested with HindIII and XbaI, and cloned between the HindIII and XbaI sites of the pBluescript II SK (+) plasmid to generate the pbleCrcre plasmid (Fig 1). The pbleLCrcre plasmid harboring ble-CrCRE expression cassette II (Fig 1), in which a DNA sequence encoding a short artificial linker peptide, GGSGGR [48], was inserted in-frame between the 3'-end of ble and the 5'-end of CrCRE, was constructed as follows. First, PCR amplification was conducted using ble_R2 and Crcre_F3 as primers and the pbleCrcre plasmid as a template. Next, the amplified 5.5-kb fragment was circularized using an In-Fusion Cloning kit (Clontech) according to the manufacturer’s instructions.

C. reinhardtii Strains and Growth Conditions

C. reinhardtii strains cc124 (mt−) and cc4350 (cw15 arg7-8 mt+, Chlamydomonas Resource Center) were used as recipients of the ploxP-aphVIII plasmid, whereas strain cc125 (mt+) was used in backcross experiments. Cells were cultivated mixotrophically at 25°C in Tris acetate phosphate (TAP) medium [49] supplemented with 10 μg ml−1 arginine if necessary under white fluorescent light (100 μmol photons m−2 s−1) with gentle shaking or on solid medium supplemented with 1.5% Bacto agar (BD Difco).

Genetic Transformation of C. reinhardtii Strains

Nuclear transformation was performed using electroporation as described previously [50]. Briefly, the cells were grown for approximately 24 h until the cell densities reached 1 × 106–2 × 106 cells ml−1 in TAP medium. Cells were harvested by centrifugation at 800 × g for 5 min and washed with EP solution (30 mM HEPES, 5 mM MgSO4, 50 mM potassium acetate, 1 mM calcium acetate, 60 mM sucrose, pH 7.4), and suspend in EP solution to a final density of 1 × 108–3 × 108 cells ml−1. Then, 4 μl of 500 μg ml−1 DNA were added to 121 μl of the cell suspension. The cell suspension was placed into an electroporation cuvette with a 2-mm gap (Bio-Rad) and incubated at 15°C for 2 min. An exponential electric pulse of 2000 V/cm was applied to the suspension of strain cc124 using a GenePulser XCell™ (Bio-Rad) electroporation apparatus. The capacitance was set at 25 μF, and no shunt resistor was used. For strain cc4350, an exponential electric pulse of 700 V/cm at a capacitance of 600 μF was applied. After electroporation, cells were incubated at 15°C for 1 h and transferred to 10 ml of fresh TAP medium containing 40 mM sucrose. After incubation for 18 h at 25°C under dim light, the cells were collected by centrifugation at 800 × g for 5 min and selected on TAP agar plates supplemented with 20 μg ml−1 paromomycin (Wako) or 10 μg ml−1 Zeocin (Invitrogen). Each single colony developed on the agar plates was screened by PCR to identify gene-positive clones as described previously [51, 52] with some modifications. Each paromomycin-resistant (Pmr) clone was suspended in 10 μl of distilled water, into which the same volume of ethanol and 100 μl of 50% Chelex-100 (Bio-Rad, USA) were added. After incubation at 100°C for 10 min, cell debris was removed by centrifugation at 6000 rpm for 10 min. PCR was then performed using the supernatant as a template and aphVIII_F and aphVIII_R as primers to detect a partial aphVIII sequence or loxP_F and loxP_R as primers to detect the loxP-P-aphVIII-T-loxP sequence. In addition, PCR was performed to detect a partial CrCRE sequence using the primers Crcre_F4 and Crcre_R2, whereas detection of the full-length sequence of the CrCRE expression cassette, ble-CrCRE expression cassette I, or ble-CrCRE expression cassette II on the pCrcre, pbleCrcre, or pbleLCrcre plasmid was performed by two PCR amplifications using two primer sets: phsp70_F2 plus Crcre_R2 and Crcre_F4 plus trbcS_R2. The sequences of the primers used for the detection of transgenes are listed in Table 1.

Southern Blot Analysis to Detect aphVIII Insertions

C. reinhardtii genomic DNA was extracted using a standard phenol-chloroform protocol [53]. Five micrograms of genomic DNA were digested with BamHI, separated on 0.8% (w/v) agarose gel, and blotted onto a Hybond-N+ membrane (GE Healthcare, UK) by a standard capillary transfer method using 20 × SSC as a transfer buffer. The blotted membrane was then baked at 80°C for 2 h. An aphVIII fragment prepared by PCR using aphVIII_F and aphVIII_R as primers and the pSI103 plasmid as a template was labeled using a DIG High Prime DNA labeling and detection kit (Roche Applied Science). Hybridization and signal detection were performed according to the manufacturer’s instructions.

Isolation of the Flanking Region of loxP-P-aphVIII-T-loxP Insertions

DNA regions flanking the loxP-P-aphVIII-T-loxP insertion were determined using inverse PCR as follows. Genomic DNA (0.5 μg) of transformants carrying a single copy of the loxP-P-aphVIII-T-loxP sequence was digested with BamHI or PvuII (Takara), both enzymes being single cutters of the ploxP-aphVIII plasmid (Fig 1). After inactivation of the restriction enzymes using phenol, digested DNA was ethanol-precipitated and dissolved in TE buffer. To amplify the 5′-flanking region of the loxP-P-aphVIII-T-loxP insertion, PvuII-digested DNA was self-ligated and used as a template for an inverse PCR using trbcS_inv_F and phsp70_inv_R as primers. Similarly, to amplify the 3′-flanking region of the loxP-P-aphVIII-T-loxP insertion, BamHI-digested DNA was self-ligated and used as a template for an inverse PCR using trbcS_inv_F and trbcS_inv_R as primers. The PCR reactions were conducted using Advantage-GC Genomic PCR mix (Clontech) using the step-down PCR protocol according to the manufacturer’s instruction. The resulting amplified fragments were purified using a QIAquick Gel Extraction kit (Qiagen) and cloned into the pGEMT-Easy plasmid (Promega). The nucleotide sequences of the fragments were then determined using dideoxy chain termination via a commercial service provided by Macrogen Japan Corp. The nucleotide sequences thus obtained were compared with the genome sequence of Chlamydomonas at a Joint Genome Institute site (https://phytozome.jgi.doe.gov/pz/portal.html#!info?alias=Org_Creinhardtii). To verify excision of the loxP-P-aphVIII-T-loxP sequence integrated in the genomes of C. reinhardtii strains cc124_LPm1 and cc4350_LPm19 by Cre/loxP-mediated recombination, the insertion/excision regions were PCR-amplified using the primers designed from the sequences outside the loxP-P-aphVIII-T-loxP cassette sequence, namely primers LPm1_F and LPm1_R for the derivatives of strain cc124_LPm1 and primers LPm19_F and LPm19_R for the derivative of strain cc4350_LPm19. The nucleotide sequences of the PCR-amplified fragments were then determined as described previously.

Reverse Transcription (RT)-PCR for the Detection of CrCRE Expression

Total RNA was extracted from cells grown in TAP medium to an OD750 of 2.0 using a TRIzol® plus RNA purification kit (Ambion), and the remaining DNA was digested using a TURBO DNA-free kit (Ambion) according to the manufacturer’s instructions. First-strand cDNA was synthesized using a PrimeScript™ RT reagent kit with gDNA Eraser (Perfect Real Time, TaKaRa) and an RT primer mix containing oligo (dT)18 and random hexamers. PCR to confirm the expression of CrCRE was performed using primers Crcre_F4 and Crcre_R2.

Backcrossing and Segregation Analysis

Strain BLCP30, a derivative of cc124_LPm1 containing a single copy of loxP after Cre-mediated excision of the loxP-P-aphVIII-T-loxP sequence, was backcrossed to cc125 (mt+) to remove the CrCRE expression cassette. Mating was performed as described previously [54]. The resulting Zeocin-sensitive progenies were tested for the presence of the loxP sequence and the absence of the CrCRE expression cassette by PCR using primer sets LPm1_F2/LPm1_R4 and Crcre_F4/Crcre_R2.

Accession Numbers

Sequence data from this study can be found in the DDBJ/NCBI data libraries under the accession numbers LC150884 (pCrcre), LC150885 (pbleCrcre), and LC150883 (pbleLCrcre).

Results and Discussion

Construction and Characterization of C. reinhardtii Transformants Carrying a Single loxP-P-aphVIII-T-loxP Insertion

The EcoRI-linearized ploxP-aphVIII plasmid was introduced in strains cc124 and cc4350, and 16 and 79 Pmr transformants, respectively, were isolated. The sequences of the loxP-flanked aphVIII expression cassettes (loxP-P-aphVIII-T-loxP) integrated in the genomes of these transformants were analyzed by PCR with primers loxP_F and loxP_R, and the integration of the whole loxP-P-aphVIII-T-loxP sequence was confirmed in 6 cc124-derived and 13 cc4350-derived Pmr transformants (Fig 2). Southern blot analyses were performed to detect the aphVIII sequence in BamHI-digested DNAs isolated from 4 cc124-derived and 13 cc4350-derived transformants carrying the whole loxP-P-aphVIII-T-loxP sequence. The BamHI restriction endonuclease cuts ploxP-aphVIII plasmid once at the 3′-end of aphVIII; therefore, the number of bands revealed by the probe corresponds to the number of aphVIII insertions in the host genomes. The top band in each lane was thought to be non-specific signals as the band was also observed in the lanes for the wild type strains, cc124 and cc4350. The analyses thus revealed that most transformants contained a single aphVIII insertion, whereas the remainder carried two (Fig 3). The sizes of the majority of the bands were different from each other, indicating that most of the loxP-P-aphVIII-T-loxP insertions were located at different loci on the C. reinhardtii chromosomes. Two transformants, cc124_LPm1 and cc4350_LPm19, each carrying a single copy of the loxP-P-aphVIII-T-loxP insertion, were selected for further studies to demonstrate the excision of the loxP-P-aphVIII-T-loxP insertion by CrCre recombinase.
Fig 2

PCR analysis of transgenes in Pmr transformants of strains cc124 and cc4350.

(A) Map of the aphVIII expression cassette. The positions of two PCR primers that amplify the loxP-P-aphVIII-T-loxP sequence are shown below the map. (B) Agarose gel electrophoresis of the PCR-amplified loxP-P-aphVIII-T-loxP fragments. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp. The template DNAs were as follows: lane P, the ploxP-aphVIII plasmid; lanes 1–7, genomic DNAs of Pmr transformants of strain cc124; lane N, no template. (C) Agarose gel electrophoresis of the PCR-amplified loxP-P-aphVIII-T-loxP fragments. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp. The template DNAs were as follows: lane P, the ploxP-aphVIII plasmid; lanes 1–14, genomic DNAs of Pmr transformants of strain cc4350; lane N, no template.

Fig 3

Analysis of the aphVIII copy number by Southern blotting.

Genomic DNAs were isolated from Pmr transformants of strains cc124 and cc4350, digested with BamHI, and hybridized with a digoxigenin-labeled aphVIII fragment. (A) Southern blot analysis of the genomic DNAs of four Pmr transformants derived from strain cc124. Lane M: DNA marker (λ-EcoT14 I digest) with molecular size in bp; next five lanes, BamH1-digested genomic DNA of the strains indicated above the lanes; lane ploxP-aphVIII, the ploxP-aphVIII plasmid digested with BamHI. (B) Southern blot analysis of the genomic DNAs of 13 Pmr transformants derived from strain cc4350. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp; next 14 lanes, BamHI-digested genomic DNAs of the strains indicated above the lanes; lane ploxP-aphVIII, the ploxP-aphVIII plasmid digested with BamHI.

PCR analysis of transgenes in Pmr transformants of strains cc124 and cc4350.

(A) Map of the aphVIII expression cassette. The positions of two PCR primers that amplify the loxP-P-aphVIII-T-loxP sequence are shown below the map. (B) Agarose gel electrophoresis of the PCR-amplified loxP-P-aphVIII-T-loxP fragments. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp. The template DNAs were as follows: lane P, the ploxP-aphVIII plasmid; lanes 1–7, genomic DNAs of Pmr transformants of strain cc124; lane N, no template. (C) Agarose gel electrophoresis of the PCR-amplified loxP-P-aphVIII-T-loxP fragments. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp. The template DNAs were as follows: lane P, the ploxP-aphVIII plasmid; lanes 1–14, genomic DNAs of Pmr transformants of strain cc4350; lane N, no template.

Analysis of the aphVIII copy number by Southern blotting.

Genomic DNAs were isolated from Pmr transformants of strains cc124 and cc4350, digested with BamHI, and hybridized with a digoxigenin-labeled aphVIII fragment. (A) Southern blot analysis of the genomic DNAs of four Pmr transformants derived from strain cc124. Lane M: DNA marker (λ-EcoT14 I digest) with molecular size in bp; next five lanes, BamH1-digested genomic DNA of the strains indicated above the lanes; lane ploxP-aphVIII, the ploxP-aphVIII plasmid digested with BamHI. (B) Southern blot analysis of the genomic DNAs of 13 Pmr transformants derived from strain cc4350. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp; next 14 lanes, BamHI-digested genomic DNAs of the strains indicated above the lanes; lane ploxP-aphVIII, the ploxP-aphVIII plasmid digested with BamHI. To map the insertion sites of the loxP-P-aphVIII-T-loxP sequence in strains cc124_LPm1 and cc4350_LPm19, flanking DNA regions were amplified using inverse PCR and sequenced as described in the Materials and Methods. The nucleotide sequences of the flanking regions were then aligned to the C. reinhardtii genome sequence [gene model version JGI 5.5 (Phytozome 10), Joint Genome Institute: http://www.phytozome.net/chlamy]. In strain cc124_LPm1, the loxP-P-aphVIII-T-loxP sequence was inserted in a gene of unknown function (Cre08.g362400, 1,099,596…1,102,295 on chromosome 8) at location 1,099,903, whereas the insertion site in the cc4350_LPm19 genome was mapped to multiple locations in the genome, which could not be determined unequivocally (Table 2).
Table 2

The mapped locations of genomic sequence flanking of the loxP-P-aphVIII-T-loxP sequence in the cc4350_LPm19 genome.

Position
startendidentity
5' flanking sequencechromosome_289317108932113399/404 (98.8)
chromosome_368132356812832404/404 (100)
chromosome_368616576862060403/404 (99.8)
chromosome_4803530803127397/404 (98.3)
chromosome_416794371679840404/404 (100)
chromosome_416824911682894402/404 (99.5)
chromosome_429945182994921404/404 (100)
chromosome_959344215934824404/404 (100)
chromosome_1342488884248485404/404 (100)
chromosome_1420964152096818404/404 (100)
chromosome_1513784571378054404/404 (100)
chromosome_17804556804959404/404 (100)
chromosome_17816331816734404/404 (100)
chromosome_1726614312661028404/404 (100)
scaffold_22160645160242401/404 (99.3)
3' flanking sequencechromosome_2893211489344622324/2349 (98.7)
chromosome_3686206168644042344/2344 (100)
chromosome_3681283168105122339/2344 (98.8)
chromosome_48031268007862324/2344 (99.0)
chromosome_4168289516852382340/2344 (99.8)
chromosome_4299492229972652343/2344 (99.9)
chromosome_8287423328723501883/1884 (99.9)
chromosome_9593482559371682344/2344 (100)
chromosome_13424848442461412342/2344 (99.9)
chromosome_14209681920991512342/2344 (99.4)
chromosome_15137805313757202342/2344 (99.5)
chromosome_178049608072922341/2344 (99.4)
chromosome_178167358190782341/2344 (99.9)
chromosome_17266102726586842343/2344 (99.9)
scaffold_221602411579912229/2251 (99.0)

Demonstration of CrCre Recombinase-Mediated Site-Specific Recombination in C. reinhardtii

To examine excision of the loxP-P-aphVIII-T-loxP sequence by CrCre recombinase, the pCrcre plasmid carrying the CrCRE expression cassette was introduced into strain cc4350_LPm19 via co-transformation with the pMF59 plasmid carrying ble conferring Zeocin resistance (Zeor), and Zeor transformants were screened on TAP agar plates containing Zeocin. The existence of the CrCRE expression cassette in 226 Zeor transformants was then examined by PCR with two primer sets: phsp70_F2 plus Crcre_R2 and Crcre_F4 plus trbcS_R2 (Fig 4A). The entire CrCRE cassette sequence was detected in 46 Zeor transformants. We first expected that all transformants carrying the intact CrCRE expression cassette would be Pm-sensitive (Pms), as the loxP-P-aphVIII-T-loxP sequence might have been excised by CrCre recombinase. However, only 1 of the 46 transformants was Pms, and excision of the aphVIII sequence in the Pms transformant was confirmed by PCR (Fig 4B).
Fig 4

PCR amplification of the CrCRE expression cassette sequence integrated in the genomes of ZeoR transformants.

(A) The structure of the CrCRE expression cassette and the sizes of the PCR products (1 and 2) amplified using two different primer sets. (B) Agarose gel electrophoresis of three different PCR products. Panels 1 and 2, detection of PCR products 1 and 2; panel aphVIII, detection of aphVIII. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp. The template DNAs were as follows: lane P, the pCrcre plasmid for panels 1 and 2 and the ploxP-aphVIII plasmid for panel aphVIII; lanes 1–4, genomic DNAs of Zeor transformants of strain cc4350_LPm19; lane N, no template. For panels 1 and 2, the primer sets phsp70_F/Crcre_R2 and Crcre_F4/trbcS_R2, respectively, were used, whereas for panel aphVIII, the primer set aphVIII_F/aphVIII_R was used. (C) Reverse transcription-PCR analysis of the expression of CrCRE and aphVIII in the ZeoR transformants of strain cc4350_LPm19 containing the CrCRE expression cassette. Panel CrCRE, detection of CrCRE transcripts. Panel aphVIII, the detection of aphVIII transcripts. Lane M, DNA markers (λ-EcoT14 I digest) with molecular size in bp. Lane P, template DNAs were extracted from the pCrcre plasmid for CrCRE detection and the ploxP-aphVIII plasmid for aphVIII detection; lanes 1–9, RNAs were isolated from the ZeoR transformants of strain cc4350_LPm19 containing the CrCRE expression cassette; lane N, minus reverse transcriptase. The same lane numbers within Fig4(A) and 4(B) do not represent the same transformants.

PCR amplification of the CrCRE expression cassette sequence integrated in the genomes of ZeoR transformants.

(A) The structure of the CrCRE expression cassette and the sizes of the PCR products (1 and 2) amplified using two different primer sets. (B) Agarose gel electrophoresis of three different PCR products. Panels 1 and 2, detection of PCR products 1 and 2; panel aphVIII, detection of aphVIII. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp. The template DNAs were as follows: lane P, the pCrcre plasmid for panels 1 and 2 and the ploxP-aphVIII plasmid for panel aphVIII; lanes 1–4, genomic DNAs of Zeor transformants of strain cc4350_LPm19; lane N, no template. For panels 1 and 2, the primer sets phsp70_F/Crcre_R2 and Crcre_F4/trbcS_R2, respectively, were used, whereas for panel aphVIII, the primer set aphVIII_F/aphVIII_R was used. (C) Reverse transcription-PCR analysis of the expression of CrCRE and aphVIII in the ZeoR transformants of strain cc4350_LPm19 containing the CrCRE expression cassette. Panel CrCRE, detection of CrCRE transcripts. Panel aphVIII, the detection of aphVIII transcripts. Lane M, DNA markers (λ-EcoT14 I digest) with molecular size in bp. Lane P, template DNAs were extracted from the pCrcre plasmid for CrCRE detection and the ploxP-aphVIII plasmid for aphVIII detection; lanes 1–9, RNAs were isolated from the ZeoR transformants of strain cc4350_LPm19 containing the CrCRE expression cassette; lane N, minus reverse transcriptase. The same lane numbers within Fig4(A) and 4(B) do not represent the same transformants. This unexpectedly low excision rate of the loxP-P-aphVIII-T-loxP sequence in the pCrcre transformants may be due to several reasons. The first possibility was the low expression of CrCRE from the CrCRE expression cassette. Then, CrCRE expression was examined in nine randomly selected pCrcre transformants by RT-PCR using PCR primers Crcre_F4 and Crcre_R2. CrCRE expression was detected in seven of nine strains, whereas aphVIII expression was detected in all strains (Fig 4C). To overcome potential problems including malfunction of translation and/or inefficient nuclear translocation of the CrCre protein, CrCRE was fused to ble to construct the pbleCrcre plasmid (Fig 1). There were two reasons for the construction of the Ble-CrCre fusion proteins: (i) As the level of resistance to Zeocin is proportional to the protein expression level of Ble [55], transformants expressing the Ble-CrCre fusion protein at high levels could readily be isolated by selecting for Zeor at higher levels. (ii) Ble is a bleomycin-binding protein that localizes in the nucleus [47]; thus, fusion with the Ble protein would further facilitate the nuclear translocation of the CrCre recombinase. When the pbleCrcre plasmid carrying ble-CrCRE expression cassette I was introduced into strain cc4350_LPm19 by selecting Zeor transformants, excision of the loxP-P-aphVIII-T-loxP sequence was not detected. We expect that the CrCre recombinase directly fused to the Ble protein was not functional in the Zeor transformants probably because two domains in the bifunctional fusion protein were not effectively separated each other [56, 57], or that the fusion protein had a high chance of misfolding [58]. A fusion gene encoding the Ble protein fused to CrCre recombinase via a flexible linker of six amino acids was then designed. The pbleLCrcre plasmid harboring ble-CrCRE expression cassette II ([the HSP-RBCS promoter]–[the ble-linker-CrCRE fusion protein gene]–[the RBCS terminator]) (Fig 1) was introduced into strain cc4350_LPm19, and Zeor transformants were screened on TAP agar plates containing Zeocin. Seventy-four Zeor transformants were obtained, and the existence of the ble-CrCRE expression cassette II sequence in the transformants was examined by PCR as described previously (Fig 5A). In the genomes of 12 of 74 transformants, the intact ble-CrCRE expression cassette II was integrated (Fig 5B). The absence of the aphVIII sequence in the genome of 12 transformants was next examined by PCR using primers aphVIII-F and aphVIII-R. The aphVIII sequence was not detected in four of the transformants (Fig 5B). These four aphVIII-free transformants were Pms, whereas the remaining eight transformants were Pmr. The four aphVIII-free transformants were named strains BLCP1, BLCP6, BLCP15, and BLCP17. From the remaining eight Pmr transformants, aphVIII-free descendants were isolated after single-colony isolation repeated 2–6 times, indicating that CrCre recombinase-mediated site-specific recombination could be delayed, requiring many generations to elapse before recombination.
Fig 5

PCR amplification of the ble-CrCRE expression cassette II sequence integrated into the Zeor transformants.

(A) The structure of ble-CrCRE expression cassette II, positions of two PCR primer sets, and PCR products 1 and 2 amplified with the two primer sets are shown. (B) Agarose gel electrophoresis of three different PCR products. Panels 1 and 2, detection of PCR products 1 and 2; panel aphVIII, detection of aphVIII. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp. The template DNAs were as follows: lane P, the pbleLCrcre plasmid for panels 1 and 2 and the ploxP-aphVIII plasmid for panel aphVIII; next 13 lanes, genomic DNAs of the strains indicated above the lanes; lane N, no template. The Zeor transformants of strain cc4350_LPm19 carrying ble-CrCRE expression cassette II were named BLPC. The aphVIII sequence was not detected in strains BLCP1, BLCP6, BLCP15, and BLCP17.

PCR amplification of the ble-CrCRE expression cassette II sequence integrated into the Zeor transformants.

(A) The structure of ble-CrCRE expression cassette II, positions of two PCR primer sets, and PCR products 1 and 2 amplified with the two primer sets are shown. (B) Agarose gel electrophoresis of three different PCR products. Panels 1 and 2, detection of PCR products 1 and 2; panel aphVIII, detection of aphVIII. Lane M, DNA marker (λ-EcoT14 I digest) with molecular size in bp. The template DNAs were as follows: lane P, the pbleLCrcre plasmid for panels 1 and 2 and the ploxP-aphVIII plasmid for panel aphVIII; next 13 lanes, genomic DNAs of the strains indicated above the lanes; lane N, no template. The Zeor transformants of strain cc4350_LPm19 carrying ble-CrCRE expression cassette II were named BLPC. The aphVIII sequence was not detected in strains BLCP1, BLCP6, BLCP15, and BLCP17. Genomic DNA was extracted from strains BLCP6, BLCP15, and BLCP17, and Southern blotting with a probe specific for the aphVIII sequence was performed (Fig 6). The aphVIII signal was not detected in these three strains. The DNA sequences of strains BLCP6, BLCP15, and BLCP17 corresponding to the loxP-P-aphVIII-T-loxP integration site in their parental strain, cc4350_LPm19, were analyzed by PCR using primers LPm19_F and LPm19_R. A 2.7-kb fragment was amplified from strain cc4350_LPm19, whereas a 0.9-kb fragment was amplified from BLCP6, BLCP15, and BLCP17 (Fig 7). The nucleotide sequence of the 0.9-kb fragment revealed that the loxP-P-aphVIII-T-loxP sequence was accurately excised by Cre/loxP-mediated recombination, leaving a single copy of loxP.
Fig 6

Southern blot analysis of transgenes in strains BLCP6, BLCP15, and BLCP17.

All DNAs were digested with BamHI, electrophoresed, and hybridized with a digoxigenin-labeled aphVIII fragment. The arrow indicates the restriction fragment containing the loxP-P-aphVIII-T-loxP sequence in the genome of strain cc4350_LPm19.

Fig 7

PCR analysis to detect Cre-mediated excision of the loxP-P-aphVIII-T-loxP sequence.

(A) The box indicates a partial sequence of the ploxP-aphVIII plasmid, and solid lines indicate the genomic sequence. The loxP sites are indicated by short arrows. The two arrows beneath the image denote the PCR primer set used for the amplification of either a 2.7-kb fragment from DNA without the excision event or a 0.9-kb fragment from DNA with the Cre-mediated excision. (B) Agarose gel electrophoresis of the 2.7- and 0.9-kb fragments. Lane M1, DNA size marker (λ-EcoT14 I digest) with molecular size in bp; lane M2, DNA size marker (50–2500 bp, Lonza); next five lanes, PCR fragments amplified from genomic DNAs of the strains indicated above the lanes; lane N, no template control.

Southern blot analysis of transgenes in strains BLCP6, BLCP15, and BLCP17.

All DNAs were digested with BamHI, electrophoresed, and hybridized with a digoxigenin-labeled aphVIII fragment. The arrow indicates the restriction fragment containing the loxP-P-aphVIII-T-loxP sequence in the genome of strain cc4350_LPm19.

PCR analysis to detect Cre-mediated excision of the loxP-P-aphVIII-T-loxP sequence.

(A) The box indicates a partial sequence of the ploxP-aphVIII plasmid, and solid lines indicate the genomic sequence. The loxP sites are indicated by short arrows. The two arrows beneath the image denote the PCR primer set used for the amplification of either a 2.7-kb fragment from DNA without the excision event or a 0.9-kb fragment from DNA with the Cre-mediated excision. (B) Agarose gel electrophoresis of the 2.7- and 0.9-kb fragments. Lane M1, DNA size marker (λ-EcoT14 I digest) with molecular size in bp; lane M2, DNA size marker (50–2500 bp, Lonza); next five lanes, PCR fragments amplified from genomic DNAs of the strains indicated above the lanes; lane N, no template control. ble-CrCRE expression cassette II was also introduced into strain cc124_LPm1. In the genomes of 5 of the 163 Zeor transformants, the entire cassette was integrated, and one of the five Zeor transformants was Pms. This strain was named BLCP30, and the aphVIII sequence was absent in its genome (Fig 8A). The DNA sequence of strain BLCP30 corresponding to the loxP-P-aphVIII-T-loxP insertion site in its parental strain, cc124_LPm1, was analyzed by PCR using primers LPm1_F2 and LPm1_R4. The 2.9-kb fragment was amplified from strain cc124_LPm1, whereas a 1.1-kb fragment was amplified from strain BLCP30 (Fig 8B). The accurate excision of loxP-P-aphVIII-T-loxP leaving a single copy of loxP was confirmed by nucleotide sequencing of the 1.1-kb fragment.
Fig 8

PCR analysis to detect the Cre-mediated excision of the loxP-P-aphVIII-T-loxP sequence.

(A) Agarose gel electrophoresis to detect aphVIII. Lane M, DNA size marker (λ-EcoT14 I digest) with molecular size in kb. The template DNAs were as follows: lane P, the ploxP-aphVIII plasmid; next five lanes, DNAs of the strains indicated above the lanes; lane N, no template. The Zeor transformants of strain cc124_LPm1 carrying ble-CrCRE expression cassette II were named BLCP. No aphVIII signal was detected in strain BLPC30 indicating the excision of the loxP-P-aphVIII-T-loxP sequence in this strain. (B) PCR amplification of the loxP-P-aphVIII-T-loxP integration sites of strains cc124, cc124_LPm1, and BLCP30.

PCR analysis to detect the Cre-mediated excision of the loxP-P-aphVIII-T-loxP sequence.

(A) Agarose gel electrophoresis to detect aphVIII. Lane M, DNA size marker (λ-EcoT14 I digest) with molecular size in kb. The template DNAs were as follows: lane P, the ploxP-aphVIII plasmid; next five lanes, DNAs of the strains indicated above the lanes; lane N, no template. The Zeor transformants of strain cc124_LPm1 carrying ble-CrCRE expression cassette II were named BLCP. No aphVIII signal was detected in strain BLPC30 indicating the excision of the loxP-P-aphVIII-T-loxP sequence in this strain. (B) PCR amplification of the loxP-P-aphVIII-T-loxP integration sites of strains cc124, cc124_LPm1, and BLCP30.

Removal of ble-CrCRE Expression Cassette II via Backcross to a Wild-Type Strain

ble-CrCRE expression cassette II remained in the genomes of aphVIII-cured derivatives. The presence of ble-CrCRE expression cassette II in a host genome hinders the subsequent introduction of a loxP-flanked marker gene into the host. Furthermore, constitutive expression of CrCre recombinase may induce DNA damage at off-target sites [59, 60, 61, 62]. To remove ble-CrCRE expression cassette II from strain BLCP30, which is a descendent of strain cc124 (mt−), this strain was crossed to the wild-type strain cc125 (mt+). Seven tetrads were dissected, and 25 recombinant progenies were isolated. They were grown on TAP plates for 72 h and tested for their phenotypes. In total, 12 of 25 progeny were sensitive to Zeocin, and four carried the loxP sequence. The absence of CrCRE in the genomes of the four progeny was also confirmed by PCR (Fig 9).
Fig 9

Removal of ble-CrCRE expression cassette II sequence by backcross.

Agarose gel electrophoresis of PCR-amplified loxP and CrCRE sequences from the genomes of four progeny obtained by backcross between strains BLCP30 and cc125. Lane M, DNA size marker (λ-EcoT14 I digest) with molecular size in kb. Template DNAs were extracted from the following: lane 1, strain cc124; lane 2, strain BLCP30; lanes 3–6, progeny; lane N, no template.

Removal of ble-CrCRE expression cassette II sequence by backcross.

Agarose gel electrophoresis of PCR-amplified loxP and CrCRE sequences from the genomes of four progeny obtained by backcross between strains BLCP30 and cc125. Lane M, DNA size marker (λ-EcoT14 I digest) with molecular size in kb. Template DNAs were extracted from the following: lane 1, strain cc124; lane 2, strain BLCP30; lanes 3–6, progeny; lane N, no template.

Conclusion

In this study, we developed a method to obtain marker-free transgenic strains in C. reinhardtii, and the steps of the method are outlined in Fig 10. The Cre/loxP-mediated precise marker excision method applicable to transgenic C. reinhardtii could further increase the potential of this organism for use in basic and applied research.
Fig 10

Summary of the method to obtain marker-free transgenic strains in C. reinhardtii.

  57 in total

1.  Expression and inheritance of nine transgenes in rice.

Authors:  Liying Wu; Somen Nandi; Lifang Chen; Raymond L Rodriguez; Ning Huang
Journal:  Transgenic Res       Date:  2002-10       Impact factor: 2.788

2.  Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas.

Authors:  Laura Houille-Vernes; Fabrice Rappaport; Francis-André Wollman; Jean Alric; Xenie Johnson
Journal:  Proc Natl Acad Sci U S A       Date:  2011-12-05       Impact factor: 11.205

3.  Oil accumulation is controlled by carbon precursor supply for fatty acid synthesis in Chlamydomonas reinhardtii.

Authors:  Jilian Fan; Chengshi Yan; Carl Andre; John Shanklin; Jörg Schwender; Changcheng Xu
Journal:  Plant Cell Physiol       Date:  2012-05-28       Impact factor: 4.927

Review 4.  Elucidation of basal body and centriole functions in Chlamydomonas reinhardtii.

Authors:  Susan K Dutcher
Journal:  Traffic       Date:  2003-07       Impact factor: 6.215

5.  High-efficiency transformation of Chlamydomonas reinhardtii by electroporation.

Authors:  K Shimogawara; S Fujiwara; A Grossman; H Usuda
Journal:  Genetics       Date:  1998-04       Impact factor: 4.562

6.  Nuclear-gene targeting by using single-stranded DNA avoids illegitimate DNA integration in Chlamydomonas reinhardtii.

Authors:  Boris Zorin; Peter Hegemann; Irina Sizova
Journal:  Eukaryot Cell       Date:  2005-07

7.  Improving the oral efficacy of recombinant granulocyte colony-stimulating factor and transferrin fusion protein by spacer optimization.

Authors:  Yun Bai; Wei-Chiang Shen
Journal:  Pharm Res       Date:  2006-08-09       Impact factor: 4.200

8.  Functional expression of the yeast FLP/FRT site-specific recombination system in Nicotiana tabacum.

Authors:  A M Lloyd; R W Davis
Journal:  Mol Gen Genet       Date:  1994-03

9.  Robust expression and secretion of Xylanase1 in Chlamydomonas reinhardtii by fusion to a selection gene and processing with the FMDV 2A peptide.

Authors:  Beth A Rasala; Philip A Lee; Zhouxin Shen; Steven P Briggs; Michael Mendez; Stephen P Mayfield
Journal:  PLoS One       Date:  2012-08-24       Impact factor: 3.240

10.  Enhancement of extraplastidic oil synthesis in Chlamydomonas reinhardtii using a type-2 diacylglycerol acyltransferase with a phosphorus starvation-inducible promoter.

Authors:  Masako Iwai; Keiko Ikeda; Mie Shimojima; Hiroyuki Ohta
Journal:  Plant Biotechnol J       Date:  2014-06-09       Impact factor: 9.803

View more
  4 in total

1.  Multigene engineering of medium-chain fatty acid biosynthesis in transgenic Arabidopsis thaliana by a Cre/LoxP multigene expression system.

Authors:  Yusheng Zheng; Lizhi Chen; Zhiyong Zhu; Dongdong Li; Peng Zhou
Journal:  3 Biotech       Date:  2020-07-17       Impact factor: 2.406

2.  Unrestrained markerless trait stacking in Nannochloropsis gaditana through combined genome editing and marker recycling technologies.

Authors:  John Verruto; Kristie Francis; Yingjun Wang; Melisa C Low; Jessica Greiner; Sarah Tacke; Fedor Kuzminov; William Lambert; Jay McCarren; Imad Ajjawi; Nicholas Bauman; Ryan Kalb; Gregory Hannum; Eric R Moellering
Journal:  Proc Natl Acad Sci U S A       Date:  2018-07-09       Impact factor: 11.205

3.  Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote.

Authors:  Junhao Dan; Huafeng Deng; Yumei Xia; Yijie Zhan; Ning Tang; Yao Wang; Mengliang Cao
Journal:  Open Life Sci       Date:  2022-03-11       Impact factor: 0.938

4.  Metabolic engineering using iterative self-cloning to improve lipid productivity in Coccomyxa.

Authors:  Yuki Kasai; Takuya Tsukahara; Fukiko Ikeda; Yoko Ide; Shigeaki Harayama
Journal:  Sci Rep       Date:  2018-08-06       Impact factor: 4.379

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.