Literature DB >> 27525259

Genetic Characterization and Comparative Genome Analysis of Brucella melitensis Isolates from India.

Sarwar Azam1, Sashi Bhushan Rao2, Padmaja Jakka1, Veera NarasimhaRao1, Bindu Bhargavi1, Vivek Kumar Gupta3, Girish Radhakrishnan1.   

Abstract

Brucellosis is the most frequent zoonotic disease worldwide, with over 500,000 new human infections every year. Brucella melitensis, the most virulent species in humans, primarily affects goats and the zoonotic transmission occurs by ingestion of unpasteurized milk products or through direct contact with fetal tissues. Brucellosis is endemic in India but no information is available on population structure and genetic diversity of Brucella spp. in India. We performed multilocus sequence typing of four B. melitensis strains isolated from naturally infected goats from India. For more detailed genetic characterization, we carried out whole genome sequencing and comparative genome analysis of one of the B. melitensis isolates, Bm IND1. Genome analysis identified 141 unique SNPs, 78 VNTRs, 51 Indels, and 2 putative prophage integrations in the Bm IND1 genome. Our data may help to develop improved epidemiological typing tools and efficient preventive strategies to control brucellosis.

Entities:  

Year:  2016        PMID: 27525259      PMCID: PMC4976149          DOI: 10.1155/2016/3034756

Source DB:  PubMed          Journal:  Int J Genomics        ISSN: 2314-436X            Impact factor:   2.326


1. Introduction

Brucellosis is a worldwide zoonotic disease that accounts for huge loses to the livestock sector and poses a serious threat to public health. The disease is caused by bacteria of the genus Brucella, a member of the α-2 Proteobacteria [1]. Brucellae are Gram-negative, facultative, intracellular bacteria that can infect a wide range of domestic and wild animals as well as humans. Six classical species were initially recognized within the genus Brucella, namely, B. abortus, B. melitensis, B. suis, B. ovis, B. canis, and B. neotomae [2]. Brucella invades and replicates in professional phagocytic cells such as macrophages and dendritic cells as well as nonprofessional phagocytes such as trophoblasts [3-5]. Brucella mechanisms and virulence factors that mediate invasion and intracellular persistence have been poorly characterized. Brucellosis remains endemic and is a reemerging disease in many regions of the world including Latin America, Middle East, Africa, Central Asia, and the Mediterranean basin that affects human health and animal productivity. The disease leads to a significant detrimental effect on local economies resulting in the perpetuation of poverty [6]. Brucellosis is a serious veterinary and public health problem in India and the disease is reported in cattle, buffalo, sheep, goats, pigs, camel, dogs, and humans [7]. Brucellosis is an endemic disease in India and the country experienced a sharply increasing rate of human brucellosis in recent years, and the species of main concern is B. melitensis. B. melitensis, the most virulent species in humans, primarily affects goats and the zoonotic transmission occurs by ingestion of unpasteurized milk products or through direct contact with fetal tissues. Genetic diversity and population structure of Brucella spp. remain unknown in India. Multilocus sequence typing (MLST) has been considered as the robust tool for dissecting genetic diversity and population structure within the bacterial species. The established MLST schema for Brucella spp. employed nine highly distinct genomic loci [8]. However, MLST resolution is limited and often fails to differentiate closely related strains. With the advent of next generation sequencing, whole genome offers new opportunities to analyze the genetic diversity among the groups [9]. Genome sequencing and analysis of Brucella spp. from diverse hosts and geographical regions have been reported [9]. Until now, 61 genomes of B. melitensis have been sequenced and made available in the GenBank. B. melitensis contains more than 3000 genes that are distributed over two circular chromosomes. These sequenced species serve as vast resources for comparative genomics and understanding the evolutionary history. Comparative genomics will provide insights into the virulence mechanisms of the Brucella spp. such as novel genomic islands and integration of prophages and SNPs that regulate the expression of certain genes or affect the function of important virulence-associated proteins. One of the previous studies demonstrated conservation of genes and genomic islands across the different Brucella spp. [10]. In a recent study, the evolutionary relationship of B. melitensis on the basis of whole genome SNPs revealed spatial clustering of B. melitensis isolates into five genotypes [11]. All the Asian isolates of B. melitensis clustered into genotype II, whereas the isolates from Europe and America clustered into genotypes IV and V, respectively. We performed genotyping by MLST on B. melitensis strains isolated from naturally infected goats. To perform detailed genetic characterization and comparative genome analysis, we performed whole genome sequencing of one of the strains, B. melitensis IND1, using the Illumina platform. The analysis revealed the extent of genetic variation of B. melitensis IND1 in comparison to B. melitensis isolates from other geographical locations. Data generated from our studies may help to develop new diagnostic assays based on stable markers such as SNPs (Single Nucleotide Polymorphisms) and Variable Number of Tandem Repeats (VNTRs) for molecular epidemiological studies. Identification of SNPs, Indels, and novel phage integration sites will provide insights into the virulence mechanisms of this stealthy pathogen which could ultimately lead to the development of novel therapeutic and preventive strategies to control brucellosis.

2. Materials and Methods

2.1. Isolation of B. melitensis

For isolation of Brucella, materials from four different sources are listed in the Supplementary Table  1 (in Supplementary Material available online at http://dx.doi.org/10.1155/2016/3034756). Samples were inoculated on sterile plates of Brucella selective agar containing Hemin and Vitamin K1 media (Hi Media, India) and incubated at 37°C for 48 hours. The plates were observed at every 24 hours for the development of growth. After obtaining the growth, the colonies suspected for Brucella on the basis of cultural characteristics were selected and streaked again on plates containing Brucella selective agar with Hemin and Vitamin K1 and incubated at 37°C for 2 days to obtain the pure culture.

2.2. Biotyping of Brucella Isolates

Cultures showing typical Brucella characteristics were subjected to biotyping techniques such as H2S production, growth in the presence of thionin, and basic fuchsin (10–40 μg/mL) dye incorporated into tryptic soy agar at different concentrations and CO2 requirement immediately after the primary isolation as described [12]. Lead acetate strips were used to identify the production of H2S during growth, and the growth was evaluated on media containing streptomycin (2.5 μg/mL) to discriminate the isolates from vaccine strain Rev1 as described [13]. Genomic DNA of all five strains was isolated using the Wizard Genomic DNA Purification Kit (Promega, USA). Isolated DNA was used for polymerase chain reactions to amplify 16S rRNA and the Omp 31 gene for the confirmatory identification of Brucella melitensis using the Taq PCR master mix kit (Qiagen). 16S rRNA is specific to the genus Brucella while Omp 31 is a species-specific gene to Brucella melitensis [14-16].

2.3. MLST Analysis of B. melitensis Isolates

For MLST analysis, 4,396 nucleotide sequences spanning nine genomic fragments from Brucella were selected as described [8]. Of the nine loci, seven belong to classical housekeeping genes, one locus derived from the outer membrane protein 25 gene, and one from an intergenic region. Genomic DNA was isolated from Bm IND isolates using the Wizard Genomic DNA Purification Kit (Promega). Genomic fragments were amplified by PCR using the following cycling parameters: 94°C for 2 min, 35 cycles of 94°C for 30 sec, 53°C for 30 sec, and 72°C for 1 min and 72°C for 5 min. Primers used for MLST analysis are listed in the Additional file 13. An aliquot of the PCR amplicons was analyzed by 1% agarose gel and photographed. Remaining PCR products were purified and subjected to Sanger sequencing using the forward and reverse primers that were used for PCR amplifications. Editing of the sequences and generation of contigs from forward and reverse sequences was performed using Lasergene 8 software (DNA Star, USA). To perform the phylogenetic analysis, nine genomic fragments mentioned above were fetched from representative Brucella species and the loci were amplified in silico using the MLST primers. All the sequences were concatenated to identify the allelic profile with the help of Brucellabase [17] and the concatenated sequences were subjected to multiple sequence alignment using MAFFT version 7.123b [18]. Phylogenetic analyses were performed with RAxML version 8.1.2 [19] using GTRGAMMA model of evolution. The phylogram was visualized using Dendroscope version 3 [20].

2.4. Genome Sequencing, Assembly, and Annotations

The complete genome of Brucella melitensis IND1 (Bm IND1) was sequenced using Illumina technology. The sequenced data have been deposited at DDBJ/EMBL/GenBank under the accession number JMKL00000000 [21]. Paired end data generated were filtered for low quality reads using in-house script. After preprocessing, high quality data were used to make a scaffold level assembly using the SOAPdenovo version 2.01 assembler [22]. Scaffolds were further mapped with raw reads using bowtie2 version 2.2.4 [23], and coverage at each base was calculated using SAMtools version 0.1.19 [24]. Graphs for coverage analysis were plotted using GNUplot version 4.6 (http://www.gnuplot.info/). Completely sequenced genomes of B. melitensis such as B. melitensis 16M, B. melitensis M28, B. melitensis ATCC23457, and B. melitensis NI were initially considered as candidates for the template to construct the chromosomal assembly of Bm IND1. The raw data of Bm IND1 were aligned onto all the genomes using bowtie2 and the SNPs were identified using SAMtools [24], BCFtools, and VCFtools (http://vcftools.sourceforge.net/). Highly confident SNPs were filtered out using scripts from ISMU pipeline [25] based on the criteria that the raw read depth is greater than 10 and there is no reference base in the alignment. Finally, B. melitensis ATCC 23457 that showed the minimum number of SNPs with Bm IND1 was used as the template for chromosome level assembly. Abacas version 1.3.1 [26] was used to assemble Bm IND1 scaffolds into two chromosomes. Bm IND1 chromosomal level assembly was further manually curated using the BLAST output of Bm IND1 scaffolds with the B. melitensis ATCC 23457 genome. We compared the syntenic relationships between Bm IND1, B. melitensis ATCC 23457, and B. melitensis 16M using Mauve version 2.3.1 [27]. The structural and functional annotations of Bm IND1 genome were carried out by RAST server [28].

2.5. Whole Genome Phylogeny

Genomes of B. melitensis isolates were downloaded from GenBank (ftp://ftp.ncbi.nih.gov/genomes/genbank/bacteria/Brucella_melitensis/). First, we assessed the completeness of the assembly and annotations of each sequenced genome and filtered out the incomplete ones. To assess the core genome and single copy orthologs, Orthomcl v.1.4 [29] was used with default parameters. We used 2319 single copy orthologs to construct a maximum-likelihood tree following the approach of Wattam et al. [10]. MAFFT version 7.123b [18] was used to align sequences from each gene family independently. All the alignments were further processed and concatenated using Gblocks version 0.91b [30]. RAxML version 8.1.21 [19] was used to generate a tree for all the dataset using the PROTGAMMALG model of evolution. The tree was visualized using Dendroscope version 3 [20].

2.6. Detection of Prophages

The genome was searched for prophage sequences and phage attachment site using PHAST (phage search tool), available at http://phast.wishartlab.com/ [31].

2.7. Identification of Variable Number of Tandem Repeats (VNTRs)

Tandem repeats in each chromosomes of Bm IND1 were identified using Tandem repeat finder [32]. A precompiled Tandem repeat finder version 4.07b was downloaded from http://tandem.bu.edu/trf/trf.download.html and run on Linux (64-bit) platform using the parameter of a minimum alignment score of 80.

2.8. Identification of SNPs

We downloaded the genome sequences of B. melitensis 16M, B. melitensis M28, B. melitensis ATCC 23457, B. melitensis M5-90, B. melitensis NI, B. melitensis Ether, and B. abortus 2308 for SNP analysis. We considered only the completely assembled genomes for analysis of SNPs. We established a pipeline for finding SNPs between two reference sequences using Nucmer and show-snps program from the Mummer3 package [33]. Show-snps provide SNPs derived only from uniquely aligned regions. SNPs were extracted from each strain against Bm IND1 and the data were further annotated using SnpEff [34] to predict SNP effects in the genome.

2.9. Indels Analysis

To find insertions and deletions in the coding region, VCF files generated against B. melitensis ATCC 23457 using Bm IND1 reads for template genome selection were annotated with SnpEff. Indels in the coding regions and their corresponding functions were extracted from B. melitensis ATCC 23457 using in-house Perl script.

3. Results and Discussion

3.1. Isolation and Genotyping of B. melitensis IND Strains

We isolated four strains of B. melitensis from naturally infected goat followed by MLST analysis to understand the genetic diversity among the B. melitensis IND strains. To perform MLST analysis, we amplified nine loci that included seven housekeeping genes, one locus from the outer membrane protein 25 (omp25), and one locus from an intergenic region (Supplementary Figure  1). The inclusion of loci from omp25 and intergenic region was reported to have provided more discriminatory power in the phylogenetic analysis [8]. Subsequently, we compared the allelic profiles of the four B. melitensis IND isolates with each other and with other reported Brucella species. All the B. melitensis IND isolates displayed identical sequences with an allelic profile of 3-2-3-2-1-5-3-8-2, which belong to Sequence Typing- (ST-) 8. The phylogram was rooted with B. microti and in the phylogram all the B. melitensis isolates clustered into one lineage (Figure 1). Bm IND strains grouped with other Asian strains, that is, B. melitensis M28, B. melitensis M5-90, and B. melitensis NI, whereas B. melitensis Ether and B. melitensis 16M branched separately. This was anticipated as all the Asian strains belong to ST-8 and B. melitensis Ether and B. melitensis 16M falls into ST-9 and ST-7, respectively. In fact, the support value is very low for the branches of Asian isolates in the phylogram owing to the same allelic profile (ST-8) of MLST loci that were considered for the phylogenetic analysis. As expected, B. suis and B. ovis clustered into different clades in the phylogram (Figure 1). The analysis indicates that B. melitensis with ST-8 is prevalent in Asia.
Figure 1

Phylogenetic tree based on MLST analysis. Seven housekeeping genes and two loci from outer membrane protein 25 and an intergenic region, respectively, were used for MLST analysis. Bootstrap percentages retrieved in 100 replications are shown at the nodes.

3.2. Whole Genome Sequencing, Assembly, and Annotation of B. melitensis Strain Bm IND1

We performed the whole genome sequencing of Bm IND1 to analyze the genetic divergence and genomic features in detail. The raw data generated using the Illumina sequencing platform were assembled using SOAPdenovo. This provided 102 contigs that were further assembled into 29 scaffolds (Table 1). Mapping reads onto them further validated these scaffolds. On average, each scaffold base was covered more than 100 times (100x); however, some scaffolds like scaffolds 9, 14, 18, 20, and 22 have shown high depth of coverage (Supplementary Figure  2). This is likely due to the presence of duplicated or repeat regions of the genome.
Table 1

Genome assembly statistics for Bm IND1 genome.

All scaffolds
Number of scaffolds29
N50 (scaffolds)298927 bp
Longest scaffold (pseudo molecule)609256 bp
Smallest scaffold599 bp
Number of contigs102
N50 (contigs)64911 bp
Longest contig151060 bp
Smallest contig384 bp
Length of Chromosome I2128440 bp
Length of Chromosome II1185949 bp
To generate chromosome level assembly, the scaffolds were assigned to two Brucella chromosomes with proper order and orientation. Generally, a reference genome of a closely related species is used as the template to align and order the scaffolds. To achieve this, we considered genomes of B. melitensis 16M reported from USA, B. melitensis NI from Mongolia, B. melitensis Ether from Italy, B. melitensis ATCC 23457 from India, and the B. melitensis M28 from China. All these genomes are completely sequenced and well annotated and the genome assembly of few has previously been used as reference genomes for other strains [35, 36]. We aligned the raw data of Bm IND1 on the genomes of above B. melitensis strains using bowtie2 and identified the SNPs (Supplementary Table  2). Since B. melitensis ATCC 23457 displayed the least number of SNPs, which indicates minimum genetic divergence, we selected the genome of this strain as the reference genome for chromosomal assembly of Bm IND1. B. melitensis IND1 and B. melitensis ATCC 23457 were isolated from India; however, they belong to different biovars. Bm IND1 scaffolds were assembled into two chromosomes using B. melitensis ATCC 23457 as the template. Total number of scaffolds assigned on Chromosomes I and II are 23 and 6, respectively. Subsequently, assembly was manually curated with a focus on those scaffolds that showed higher physical coverage to fix the duplications. We observed the duplications of scaffolds 20, 22, 27, 28, and 29 on Chromosome I and scaffold 26 on Chromosome II with respect to the B. melitensis ATCC 23457 genome. These manually placed scaffolds were in concordance with observed physical coverage. However, no duplication in other scaffolds was observed, especially scaffolds 9 and 14 that showed high coverage (Supplementary Figure  2(b)). We assume that the higher coverage in these scaffolds may be due to internal repeats or sequencing bias. Next, we aligned the genomes of B. melitensis ATCC 23457, B. melitensis 16M, and Bm IND1 and observed for macrolevel synteny and large genomic rearrangements. In fact, they were highly syntenic with each other except for one segment of B. melitensis 16M on Chromosome II which was in reverse orientation in B. melitensis ATCC 23457 and Bm IND1 (Figure 2(a)). All general features of the genome are summarized in Figures 2(b) and 2(c).
Figure 2

(a) Alignment of B. melitensis 16M, B. melitensis ATCC 23457 and B. melitensis IND1 genome. Mauve alignment shows the synteny regions between the three strains. Bm IND1 and B. melitensis ATCC 23457 aligned well with each other; however, a segment (olive color block) on Chromosome II of Bm IND1 is in reverse orientation in B. melitensis 16M. ((b) and (c)) Circular representation of B. melitensis IND1 Chromosome I (b) and Chromosome II (c). Chromosomal coordinates are indicated on outer most circle. Circles are represented from outer to inner as circle 1, CDS on the positive strand (green for annotated, red for hypothetical); circle 2, CDS on negative strand (blue for annotated, red for hypothetical); circle 3, RNA genes (orange for tRNA and purple for rRNA); circle 4, VNTRS (turquoise); circle 5, GC content (olive for positive and purple for negative); circle 6, GC skew (olive for positive and purple for negative). Red blocks above circle 1 represent phage integration site in Chromosome I.

We annotated the genome of B. melitensis Bm IND1 using Rapid Annotations with Subsystems Technology (RAST) to obtain the coding and noncoding genes [28]. A total of 55 tRNA, 12 rRNA, and 3191 protein coding genes with an average CDS length of 874 bp were annotated (Table 2). In addition, RAST annotates the genomic structures and assigns their functions on the basis of presence of subsystems in the genome. This makes functional annotation of genes more accurate than simply assigning the functions on the basis of sequence similarity of known genes. Functions of 2562 genes were assigned while 629 genes were annotated as hypothetical (Table 2). A total of 1649 genes were assigned for different subsystems where maximum number (405) was assigned for metabolism of amino acids followed by carbohydrate metabolism (331) (Figure 3).
Table 2

Structural annotations of Bm IND1 genome.

AttributeTotalChromosome IChromosome II
Genome size (bp)331438921284401185949
DNA coding region (bp)2789706 (84.16%)1781325 (83.69%)1008381 (85.20%)
DNA G+C content (bp)1887544 (56.94%)1039770 (58.37%)588706 (58.38%)
Total genes325821321126
RNA genes674918
Protein coding genes319120831108
Hypothetical genes629446183
rRNA genes1284
tRNA genes554114
Figure 3

Distribution of subsystem category for B. melitensis IND1. Bm IND1 genome sequence was annotated using Rapid Annotation System Technology server. Features of each subsystem and their coverage are summarized in the pie chart.

3.2.1. Whole Genome Phylogeny

Determining the phylogenetic relationship in a bacterial population is essential to understand the population structure, evolutionary history, and host relationship and to develop diagnostic assays for molecular epidemiological studies [9]. To perform comparative phylogenomics, we downloaded all the currently available B. melitensis genomes (59 genomes) from GenBank and considered B. abortus 2308 as the outgroup species. We evaluated the completeness of assembly and annotation of the genomes by assessing the number of orthologous genes, which are highly conserved among the strains. Any B. melitensis strain showing less number of orthologous genes than the number of orthologous genes present in B. abortus with respect to B. melitensis were ignored for the downstream phylogenomic studies. This facilitates more accurate core genome estimation and identification of single copy orthologs present in the species, which improves resolution of the phylogenetic tree. Therefore, we ignored the genomes of 12 B. melitensis strains and considered the entire repertoire of coding genes of 48 B. melitensis strains including Bm IND1 for the analysis (Supplementary Table  3). A total of 151361 genes of B. melitensis strains were clustered in 3800 gene families, of which 25124 gene families present in all the 48 strains. However, 2461 genes only showed exact single copy orthology in each strain that could be considered as the core genome of B. melitensis clade. The core genome includes 73–82% of genes from each of the B. melitensis strain. Wattam et al. [10] reported that 2,285 core genes are present in the Brucella genus by analyzing the genomes of 40 Brucella species. Conceivably, the core genome of B. melitensis clade was higher than the total number of core genes present across the Brucella genus. We used B. abortus 2308 as the outgroup for whole genome phylogeny that increased the total cluster of genes to 3829. After including the B. abortus strain, the total number of single copy orthologs decreased to 2319 genes. In the whole genome phylogram, Bm IND1 clustered with other Asian isolates of B. melitensis as observed in the MLST analysis (Figure 4). Bm IND1 grouped with B. melitensis NI which was originated from Mongolia and both the strains belong to biovar 3 (Figure 4). The phylogenetic relationship established here is in agreement with the earlier reports [10, 11]. Tan et al. [11] performed a comparative whole genome SNP analysis of B. melitensis strains from around the world and reported clustering of B. melitensis isolates into five genotypes. In agreement with this observation, our phylogenomic studies also revealed the clustering of B. melitensis isolates into five groups where Group 1 formed the earliest diverging clade. Group II represents most of the Asian isolates of B. melitensis including Bm IND1. Parallel to Group II, another lineage evolved which further branched into groups III, IV, and V. Group III represents isolates from Africa and groups IV and V constitute isolates from Europe and America, respectively.
Figure 4

Phylogenetic tree showing relationship between B. melitensis IND1 and other B. melitensis strains. Maximum likelihood tree of 49 whole genome sequenced B. melitensis strains, inferred from concatenated, partitioned alignment of 2319 core genes using RAxML. Support values of branches are calculated from 100 bootstrap replicates and the branch length is proportional to the number of substitutions per site. B. abortus 2308 has been used as outgroup species.

3.2.2. Prophages

Prophages that are integrated into the genome of bacteria can contribute many biological properties to their bacterial hosts such as virulence, biosynthesis, and secretion of toxins, genomic divergence, and evolution [37]. We analyzed the genome of Bm IND1 for prophages using PHAST that was designed to identify and annotate prophage sequences in bacterial genomes [31]. The analysis identified 2 putative prophage integrations in Chromosome I of Bm IND1 (Table 3 and Figure 5). Region 1 is composed of a fragment of 13.7 kb size that encoded 18 genes, out of which 14 genes were phage specific and 4 genes were bacteria specific. Region II is composed of 22.6 kb with 14 genes where 8 genes were phage specific and remaining 6 genes belonged to Brucella. Notably, region 1 is considered as intact prophage upstream of QseB locus and the RAST server could identify the genes in this region. Region II is predicted as incomplete prophage but flanked with attachment sites. Region I is present in the Chinese isolate of B. melitensis M28 also. We identified two putative phage integrations in Chromosome I of B. melitensis 16M genome, which did not show any similarity to that of Bm IND1 or B. melitensis M28. The analyses clearly indicate that the prophage integration events contribute to the genetic diversity of B. melitensis.
Table 3

Prophage regions detected in B. melitensis isolate.

StrainsRegionPositionLengthGC%Total proteins
Bm IND1IChr1: 526311–54005113.7 Kb61.1818
IIChr1: 1903640–192629222.6 Kb58.1414

Bm M28IChr1: 598561–61232513.7 Kb61.1818

Bm 16MIChr1: 20541–3796717.4 Kb58.0515
IIChr1: 1450561–147318622.6 Kb51.5133
Figure 5

Genomic organization of two putative phage like regions. Scales are described below the chromosomal region and legends are described at the bottom.

3.2.3. VNTRs

VNTRs play an important role in evolution, gene regulation, genome structure, antigenic variation and virulence [38-40]. Mutations in VNTRs produce a wide range of allelic diversity and VNTRs are considered as a powerful technique in molecular typing of bacterial species [41-43]. We have analysed the genome of Bm IND1 and identified 78 VNTRs with DNA motif size ranges from 8 to 30 bps and the copy number ranges from 1.9 to 10.4 (Supplementary Table  4). The data generated in our analysis could be used for developing rapid diagnostic assays for high-resolution molecular epidemiological and clinical studies.

3.2.4. SNPs

SNPs serve as a powerful tool to describe the phylogenetic framework of a species [44]. SNPs data will help to develop novel high-resolution molecular typing techniques for inter- and intraspecies discrimination of pathogenic microorganisms. We compared the genome of Bm IND1 with seven other B. melitensis strains, that is, B. melitensis 16M, B. melitensis M28, B. melitensis ATCC 23457, B. melitensis M5-90, B. melitensis NI, B. melitensis Ether, and B. abortus 2308 for SNPs (Table 4 and Figure 6). The highest number of SNPs was detected with B. abortus as it belonged to a different species (Table 4). Four B. melitensis strains that are originated from Asia, namely, B. melitensis M28 bv1, B. melitensis M5-90 bv1, B. melitensis ATCC 23457 bv2, and B. melitensis NI bv3 exhibited fewer SNPs ranging from 252 to 351 indicating their close genetic relatedness irrespective of their biovars. This observation was in agreement with the reported SNP-based phylogenetic analysis by Tan et al. [11]. However, the SNPs observed with different strains in Additional file 4 were less than the SNPs detected from NGS raw reads for template genome selection. This is because the polymorphisms extracted in these cases were derived from uniquely aligned regions between two genome sequences. Most of the identified SNPs were in the coding regions of the genomes that may be attributed to the high proportion of coding regions in bacteria.
Table 4

SNPs detected in other B. melitensis isolates and B. abortus 2308 with respect to Bm IND1.

SpeciesSynonymous SNPsNonsynonymous SNPsTotal number of SNPs
B. melitensis 16M60314622561
B. melitensis M2856142281
B. melitensis M5-9055141308
B. melitensis NI78180351
B. melitensis ATCC 2345751124252
B. melitensis ether 64915512726
B. abortus 2308 145834546049
Figure 6

Circular representation of identified Single Nucleotide Polymorphisms in B. melitensis IND1 Chromosome I (a) and Chromosome II (b). Chromosomal coordinates are indicated on outer most circle. From outer to inner, circles represented as circle 1, CDS (black); circle 2, SNPs against B. abortus 2308 (purple); circle 3, SNPs against B. melitensis Ether (blue); circle 4, SNPs against B. melitensis 16M (pink); circle 5, SNPs against B. melitensis NI (green); circle 6, SNPs against B. melitensis M5-90 (Orange); circle 7, SNPs against B. melitensis M 28.

While analysing the distribution of SNP locus among all Asian strains, 142 SNPs were shared by four strains, namely, B. melitensis M28, B. melitensis ATCC 23457, B. melitensis M5-90, and B. melitensis NI (Figure 7). Out of 142 SNPs, 141 are shared by all the 7 strains included in the polymorphism analysis (Table 5). Therefore, these 141 unique loci in Bm IND1 could be employed for genotyping and other molecular epidemiological studies. B. abortus 2308, B. melitensis Ether, and B. melitensis 16M shared the maximum number of SNPs (952) against Bm IND1. These 952 loci are conserved in all Asian strains, which may indicate that Asian strains evolved from a common ancestor, and these loci mutated before its differentiation. This finding is in agreement with whole genome phylogenetic analysis where B. melitensis M28, B. melitensis M5-90, B. melitensis NI, and Bm IND1 clustered together as a separate clade (Figure 4). However, 4864 SNP loci are highly specific to B. abortus 2308, which are not shared by any of the six B. melitensis strains. These loci with interspecific polymorphisms can differentiate these two species in clinical and epidemiological studies. Also, identified SNPs that are unique to each B. melitensis strain could be employed for in-depth molecular analysis and development of novel molecular typing tools.
Figure 7

The Venn diagram of SNPs detected in different Asian strains against B. melitensis IND1.

Table 5

Distribution of shared SNPs among 7 different strains of B. melitensis identified against Bm IND1.

Names of species sharing the SNPs in canonical mannerNumber of SNPs
Bm 16M, Bm M28, Bm M5-90, Bm NI, B. abortus, Bm ATCC-23457, Bm Ether141
Bm 16M, Bm M28, Bm M5-90, B. abortus, Bm ATCC-23457, Bm Ether1
Bm 16M, Bm M28, Bm M5-90, Bm NI, Bm ATCC-23457, Bm Ether1
Bm 16M, Bm M28, Bm M5-90, B. abortus, Bm Ether1
B. abortus, Bm ATCC-23457, Bm Ether, Bm M28, Bm M5-904
Bm 16M, B. abortus, Bm ATCC-23457, Bm Ether2
Bm 16M, B. abortus, Bm Ether952
Bm 16M, B. abortus, Bm NI1
Bm 16M, Bm M28, Bm M5-901
Bm 16M, B. abortus 16
Bm 16M, Bm ATCC-234571
Bm 16M, Bm Ether16
Bm 16M, Bm M282
B. abortus, Bm Ether66
B. abortus, Bm NI1
Bm Ether, Bm NI2
Bm M28, Bm M5-90128
Bm 16M1426
B. abortus 4864
Bm ATCC-23457102
Bm Ether1540
Bm M5-9031
Bm M282
Bm NI205

Bm denoted as Brucella melitensis.

We also categorized the genes containing SNPs based on their functions assigned by RAST server (Supplementary Figure  3). The subsystem category, which has shown the highest proportion of genes containing SNPs, is nitrogen metabolism followed by phosphorous, carbohydrate, and amino acid metabolism. Our findings are in agreement with differential utilization of carbohydrates and amino acids by closely related Brucella species and biovars. A biotyping system has recently been developed to discriminate Brucella species and biovars based on their differential metabolic activity [45].

3.2.5. Indels

Indels refers to deletions or insertions of nucleotides in one genome with respect to another, which could be employed as sequence signatures to characterize evolution of diverged organisms [46]. Indels can have a drastic effect on a gene leading to frameshift, truncations, or extensions of an encoded protein. We have identified 51 Indels in the Bm IND1 genome with respect to B. melitensis ATCC 23457, of which 25 are located in the coding regions (Table 6). One noted INDEL is in the glycerol-3-phosphate dehydrogenase gene (glpD) of Bm IND1. Insertion of a guanosine residue in the 3′ end of glpD resulted in two amino acid mismatch followed by deletion of 69 amino acids from the C-terminus of this protein. We verified this Indel by PCR amplification and sequencing of corresponding regions from the glpD gene of B. melitensis IND strains including Bm IND1. Insertion of G was present in the glpD gene of all the four B. melitensis IND strains with respect to ATCC23457 and 16M (Figure 8). It has been reported that B. melitensis 16M deficient in glpD was attenuated in human and mouse macrophages [47, 48]. However, our preliminary infection studies did not indicate attenuation of Bm IND1 in mouse peripheral blood mononuclear cells. Our future studies will focus on in vitro and in vivo infections studies using Bm IND1 to analyse its virulence properties with the objective of developing novel live attenuated vaccines for livestock brucellosis.
Table 6

INDELs identified in Bm IND1 with respect to the B. melitensis ATCC 23457 in the coding region.

S. noGene IDATCC_23457Bm IND1Gene name
1BMEA_RS00885GTTTCGCGGAAGCTTTCGCGGAAGTTTCGCGGAAMethionine synthase
2BMEA_RS00935CGGGCGGGGGlycerol-3-phosphate dehydrogenase
3BMEA_RS00980GCCGCCCABC transporter permease
4BMEA_RS01770ATTTTTTATTTTTFAD-binding molybdopterin dehydrogenase
5BMEA_RS02325ATATATATTAT4-Hydroxy-3-methylbut-2-enyl diphosphate reductase
6BMEA_RS03470TGGGGGGTGGGGGGGHypothetical protein
7BMEA_RS04970GAAAAAAAGAAAAAAAAMechanosensitive ion channel protein MscS
8BMEA_RS06240ACCAGAAGCCCGGCCAGAAGCCCGGCACCAGAAGCCCGGCCobalt transporter
9BMEA_RS07030GCCGAspartyl-tRNA amidotransferase subunit B
10BMEA_RS07320GCGCGGCGGCTCTCGCGGCGGCTCTGCGCGGCGGCTCTMultidrug ABC transporter ATP-binding protein
11BMEA_RS07865AGCGGGTAAACGGGCGGGTAAACGGGC AGCGGGTAAACGGGCGGGTAAACGGGCGGGTAAACGGGCSensor histidine kinase
12BMEA_RS08810TCCTCTransporter
13BMEA_RS10105GTGAlanine acetyltransferase
14BMEA_RS10390TGCGTCTGCGTCACCTTTCATGGCGTCHypothetical protein
15BMEA_RS10570TGGTGGCGGGGGTGGCGGGGGTGGCGGGGGTGGCTGGTGGCGGGGGTGGCGGGGGTGGCType IV secretion protein VirB10
16BMEA_RS12000GCGCGTTCATCGCCGCGGCGCGTTCATCGCCGCGTTCATCGCCGCGBranched-chain amino acid ABC transporter ATP-binding protein
17BMEA_RS13145TGGGGGTGGGGGGHypothetical protein
18BMEA_RS13295TTAAminotransferase
19BMEA_RS13570TCCCCCCCCCCTCCCCCCCCCPyridine nucleotide-disulfide oxidoreductase
20BMEA_RS13580AGGGGGGGGGAGGGGGGGGGGN-formylglutamate amidohydrolase
21BMEA_RS13730CTTTTTTTCTTTTTTTTHypothetical protein
22BMEA_RS14825GAAAACGCCAAAAGAAAABC transporter permease
23BMEA_RS14895TCCCCCCCCCTCCCCCCCCCCCCAmidase
24BMEA_RS15830CAAACAAAAAmino acid ABC transporter substrate-binding protein
Figure 8

Sequence alignment of 3 terminus regions of glpD gene. (a) Insertion of “G” in the glpD gene (position 1286) of Bm IND strains in comparison to B. melitensis 16M (16M) and B. melitensis ATCC23457 (Bm ATCC). (b) Deletion of 69 nucleotides from the C-terminus of glpD of Bm IND1 as a result of the nucleotide insertion.

4. Conclusions

In conclusion, genomic characterization and comparative genome analysis of Bm IND1 revealed genetic structure of B. melitensis from India as well as from other geographical locations. Comparative genome analysis identified the sources of genetic variation in the form of SNPs, VNTRs, prophages, and Indels. These genetic markers could be employed for developing high-resolution epidemiological typing tools to understand the structure of Brucella population and for outbreak analysis. Information on prophage integration events and Indels in the virulence-associated genes will provide important leads for the further experimental characterization of virulence properties of Bm IND1. This may ultimately lead to the development of efficient therapeutic and preventive strategies to control animal and human brucellosis. Indels identified in the genome of Bm IND1 with respect to B. melitensis ATCC 23457. Indels were extracted using raw reads of Bm IND1 aligned to B. melitensis ATCC 23457 reference genome with the help of Bowtie2 and Samtools. SnpEFF was used to detect the occurrence indels and their impact on the genes.
  47 in total

Review 1.  Brucellosis.

Authors:  Georgios Pappas; Nikolaos Akritidis; Mile Bosilkovski; Epameinondas Tsianos
Journal:  N Engl J Med       Date:  2005-06-02       Impact factor: 91.245

Review 2.  Multilocus phylogeography and phylogenetics using sequence-based markers.

Authors:  Patrícia H Brito; Scott V Edwards
Journal:  Genetica       Date:  2008-07-24       Impact factor: 1.082

3.  The genome sequence of the facultative intracellular pathogen Brucella melitensis.

Authors:  Vito G DelVecchio; Vinayak Kapatral; Rajendra J Redkar; Guy Patra; Cesar Mujer; Tamara Los; Natalia Ivanova; Iain Anderson; Anamitra Bhattacharyya; Athanasios Lykidis; Gary Reznik; Lynn Jablonski; Niels Larsen; Mark D'Souza; Axel Bernal; Mikhail Mazur; Eugene Goltsman; Eugene Selkov; Philip H Elzer; Sue Hagius; David O'Callaghan; Jean-Jacques Letesson; Robert Haselkorn; Nikos Kyrpides; Ross Overbeek
Journal:  Proc Natl Acad Sci U S A       Date:  2001-12-26       Impact factor: 11.205

4.  Fast gapped-read alignment with Bowtie 2.

Authors:  Ben Langmead; Steven L Salzberg
Journal:  Nat Methods       Date:  2012-03-04       Impact factor: 28.547

Review 5.  Anthrax molecular epidemiology and forensics: using the appropriate marker for different evolutionary scales.

Authors:  Paul Keim; Matthew N Van Ert; Talima Pearson; Amy J Vogler; Lynn Y Huynh; David M Wagner
Journal:  Infect Genet Evol       Date:  2004-09       Impact factor: 3.342

6.  PHAST: a fast phage search tool.

Authors:  You Zhou; Yongjie Liang; Karlene H Lynch; Jonathan J Dennis; David S Wishart
Journal:  Nucleic Acids Res       Date:  2011-06-14       Impact factor: 16.971

7.  Full genome SNP-based phylogenetic analysis reveals the origin and global spread of Brucella melitensis.

Authors:  Kim-Kee Tan; Yung-Chie Tan; Li-Yen Chang; Kok Wei Lee; Siti Sarah Nore; Wai-Yan Yee; Mohd Noor Mat Isa; Faizatul Lela Jafar; Chee-Choong Hoh; Sazaly AbuBakar
Journal:  BMC Genomics       Date:  2015-02-18       Impact factor: 3.969

8.  SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler.

Authors:  Ruibang Luo; Binghang Liu; Yinlong Xie; Zhenyu Li; Weihua Huang; Jianying Yuan; Guangzhu He; Yanxiang Chen; Qi Pan; Yunjie Liu; Jingbo Tang; Gengxiong Wu; Hao Zhang; Yujian Shi; Yong Liu; Chang Yu; Bo Wang; Yao Lu; Changlei Han; David W Cheung; Siu-Ming Yiu; Shaoliang Peng; Zhu Xiaoqian; Guangming Liu; Xiangke Liao; Yingrui Li; Huanming Yang; Jian Wang; Tak-Wah Lam; Jun Wang
Journal:  Gigascience       Date:  2012-12-27       Impact factor: 6.524

9.  Characterisation of the genetic diversity of Brucella by multilocus sequencing.

Authors:  Adrian M Whatmore; Lorraine L Perrett; Alastair P MacMillan
Journal:  BMC Microbiol       Date:  2007-04-20       Impact factor: 3.605

10.  Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum.

Authors:  Jean Celli; Chantal de Chastellier; Don-Marc Franchini; Javier Pizarro-Cerda; Edgardo Moreno; Jean-Pierre Gorvel
Journal:  J Exp Med       Date:  2003-08-18       Impact factor: 14.307

View more
  6 in total

1.  Draft Genome Sequences of Five Clinical Strains of Brucella melitensis Isolated from Patients Residing in Kuwait.

Authors:  Mohd Wasif Khan; Nazima Habibi; Faraz Shaheed; Abu Salim Mustafa
Journal:  Genome Announc       Date:  2016-11-03

2.  Whole genome sequencing of Brucella melitensis isolated from 57 patients in Germany reveals high diversity in strains from Middle East.

Authors:  Enrico Georgi; Mathias C Walter; Marie-Theres Pfalzgraf; Bernd H Northoff; Lesca M Holdt; Holger C Scholz; Lothar Zoeller; Sabine Zange; Markus H Antwerpen
Journal:  PLoS One       Date:  2017-04-07       Impact factor: 3.240

3.  Genomic analysis of the original Elberg Brucella melitensis Rev.1 vaccine strain reveals insights into virulence attenuation.

Authors:  Mali Salmon-Divon; Adva Yeheskel; David Kornspan
Journal:  Virulence       Date:  2018       Impact factor: 5.882

4.  Brucella species-induced brucellosis: Antimicrobial effects, potential resistance and toxicity of silver and gold nanosized particles.

Authors:  Ayman Elbehiry; Musaad Aldubaib; Osamah Al Rugaie; Eman Marzouk; Ihab Moussa; Mohamed El-Husseiny; Mai Ibrahem; Adil Abalkhail; Mohammed Rawway
Journal:  PLoS One       Date:  2022-07-14       Impact factor: 3.752

5.  Risk factors for Brucella spp. and Coxiella burnetii infection among small ruminants in Eastern India.

Authors:  Eithne Leahy; Rajeswari Shome; Ram Pratim Deka; Swati Sahay; Delia Grace; Stella Mazeri; Johanna F Lindahl
Journal:  Infect Ecol Epidemiol       Date:  2020-06-23

6.  Genome-scale approach to study the genetic relatedness among Brucella melitensis strains.

Authors:  Ana Pelerito; Alexandra Nunes; Maria Sofia Núncio; João Paulo Gomes
Journal:  PLoS One       Date:  2020-03-09       Impact factor: 3.240

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.