| Literature DB >> 27516962 |
Emily B Harrison1, Colleen G Hochfelder2, Benjamin G Lamberty1, Brittney M Meays1, Brenda M Morsey1, Matthew L Kelso3, Howard S Fox1, Sowmya V Yelamanchili1.
Abstract
Traumatic brain injury (TBI) is an important health concern and effective treatment strategies remain elusive. Understanding the complex multicellular response to TBI may provide new avenues for intervention. In the context of TBI, cell-cell communication is critical. One relatively unexplored form of cell-cell communication in TBI is extracellular vesicles (EVs). These membrane-bound vesicles can carry many different types of cargo between cells. Recently, miRNA in EVs have been shown to mediate neuroinflammation and neuronal injury. To explore the role of EV-associated miRNA in TBI, we isolated EVs from the brain of injured mice and controls, purified RNA from brain EVs, and performed miRNA sequencing. We found that the expression of miR-212 decreased, while miR-21, miR-146, miR-7a, and miR-7b were significantly increased with injury, with miR-21 showing the largest change between conditions. The expression of miR-21 in the brain was primarily localized to neurons near the lesion site. Interestingly, adjacent to these miR-21-expressing neurons were activated microglia. The concurrent increase in miR-21 in EVs with the elevation of miR-21 in neurons, suggests that miR-21 is secreted from neurons as potential EV cargo. Thus, this study reveals a new potential mechanism of cell-cell communication not previously described in TBI.Entities:
Keywords: controlled cortical impact; exosomes; microRNA; microglia; neuroinflammation; secondary injury
Year: 2016 PMID: 27516962 PMCID: PMC4971839 DOI: 10.1002/2211-5463.12092
Source DB: PubMed Journal: FEBS Open Bio ISSN: 2211-5463 Impact factor: 2.693
Figure 1Characterization of CCI model. (A) Motor function in the week after CCI measured by rotarod. Sham controls and CCI mice were tested three times per day and trained for 3 days prior to injury. The average time to fall of three trials for each day is shown. Day 0 corresponds to the final day of training and Day 1 corresponds to the first day after CCI. The mean ± SEM from 15 animals are shown. A two‐way ANOVA was used to determine statistical significance. *P < 0.001. (B) Histology performed on mice 7 days after injury or sham surgery. Shown are representative images of three replicates. Luxol fast blue and cresyl violet staining of myelin (blue) and Nissl substance (purple) showing gross histology of the lesion, indicated by an asterisk, after CCI compared with the normal anatomy of the sham surgery control. (C) Iba‐1 and GFAP immunohisochemisty (IHC) staining for microglia and astrocytes, respectively, in the left cortex of sham controls (SHAM), and the ipsilateral (IPSI) and contralateral (CONTRA) cortices of animals after CCI (TBI). Images of the ipsilateral cortex show cortical tissue adjacent to the lesion site, lesion cavity indicated by an asterisk. Shown are representative images of three replicates. Original magnification 10× (bars = 100 μm), and 40× (bars = 25 μm).
Figure 2Characterization of EVs from brain tissue. Transmission electron microscopy of brain derived EVs showing a heterogeneous population of vesicles.
Figure 3Sequencing of EV miRNA after CCI. (A) Heat map and hierarchical clustering depicting all differentially expressed miRNA (P < 0.05 by ANOVA). (B) Venn diagram showing differentially expressed miRNA in ipsilateral (IPSI) versus sham left and contralateral (CONTRA) versus sham right. Significance was determined by T‐test P < 0.05 (B). (C) miRNA that increase or decrease in the ipsilateral hemisphere (IPSI) relative to controls (log2 > 0.5) (C). Log2 values for the contralateral hemisphere (CONTRA) are also shown. The mean ± SEM from three replicates are shown. A one‐way ANOVA was used to determine statistical significance. *P < 0.05; **P < 0.01; ***P < 0.001.
Sequencing counts of miRNA significantly increased in the ipsilateral hemisphere (P < 0.05 with |log2 IPSA/Sham L)| > 0.5), average counts ± SD for three replicates, each pooled from three animals
| miRNA | IPSI | CONTRA | SHAM L | SHAM R | IPSI/SHAM L | log2 |
|---|---|---|---|---|---|---|
| miR‐21a‐5p | 9283 ± 3860 | 6610 ± 2736 | 3275 ± 295 | 4179 ± 618 | 2.8 | 1.5 |
| miR‐146a‐5p | 3648 ± 413 | 3707 ± 1067 | 2042 ± 318 | 2163 ± 444 | 1.8 | 0.84 |
| miR‐7a‐5p | 11 393 ± 1411 | 9631 ± 1313 | 7057 ± 1115 | 8330 ± 910 | 1.6 | 0.69 |
| miR‐7b‐5p | 8582 ± 1411 | 8067 ± 932 | 5764 ± 642 | 6827 ± 1176 | 1.5 | 0.57 |
| miR‐212‐5 | 2988 ± 666 | 4745 ± 594 | 4229 ± 115 | 4380 ± 931 | 0.71 | −0.50 |
Sequences of miRNA significantly increased in the ipsilateral hemisphere (P < 0.05 with |log2| > 0.5). GU‐rich sequences are shown in bold
| miRNA | Sequence |
|---|---|
| miR‐21a‐5p | UAGCUUAUCAGACUGA |
| miR‐146a‐5p | UGAGAACUGAAUUCCAUGGGUU |
| miR‐7a‐5p | UGGAAGACUAGUGAUUU |
| miR‐7b‐5p | UGGAAGACUUGUGAUUU |
| miR‐212‐5p | ACCUUGGCUCUAGACUGCUUACU |
Figure 4Localization of miR‐21 expression after CCI. Expression of miR‐21 was visualized by combined in situ hybridization and immunofluorescence. Staining for miR‐21 (magenta) and cell‐type markers (green), MAP2 (A) and Iba1 (B) were used to study neurons and microglia, respectively. Nuclei are stained with DAPI (blue). Original magnification 63× (bars = 100 μm), location of insets marked with an asterisk. Staining was performed in duplicate and representative images are shown.