Literature DB >> 27470659

The mitochondrial genome of booklouse, Liposcelis sculptilis (Psocoptera: Liposcelididae) and the evolutionary timescale of Liposcelis.

Yan Shi1, Qing Chu1, Dan-Dan Wei1, Yuan-Jian Qiu1, Feng Shang1, Wei Dou1, Jin-Jun Wang1.   

Abstract

Bilateral animals are featured by an extremely compact mitochondrial (mt) genome with 37 genes on a single circular chromosome. To date, the complete mt genome has only been determined for four species of Liposcelis, a genus with economic importance, including L. entomophila, L. decolor, L. bostrychophila, and L. paeta. They belong to A, B, or D group of Liposcelis, respectively. Unlike most bilateral animals, L. bostrychophila, L. entomophila and L. paeta have a bitipartite mt genome with genes on two chromosomes. However, the mt genome of L. decolor has the typical mt chromosome of bilateral animals. Here, we sequenced the mt genome of L. sculptilis, and identified 35 genes, which were on a single chromosome. The mt genome fragmentation is not shared by the D group of Liposcelis and the single chromosome of L. sculptilis differed from those of booklice known in gene content and gene arrangement. We inferred that different evolutionary patterns and rate existed in Liposcelis. Further, we reconstructed the evolutionary history of 21 psocodean taxa with phylogenetic analyses, which suggested that Liposcelididae and Phthiraptera have evolved 134 Ma and the sucking lice diversified in the Late Cretaceous.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27470659      PMCID: PMC4965752          DOI: 10.1038/srep30660

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


During the last two decades, the booklice of the genus Liposcelis have emerged as serious pests of stored commodities worldwide1. Moreover, many microorganisms, such as rickettsial species have been found inside and on outside surfaces of booklice bodies, and these could be transferred to humans thereby posing a threat to human health23. Recently, several types of atypical mitochondrial (mt) genome organization have been reported in psocodean insects (superorder Psocodea). Psocodea contains two orders of insects: Psocoptera (booklice and barklice) and Phthiraptera (chewing and sucking lice). The mt genomes of human lice, Pediculus humanus, P. capitis and Pthirus pubis, consist of 14 to 20 mini-chromosomes, each is 1.8 to 4 kb in size and contains one to five genes45, while nad4 was unidentified in Pthirus pubis5. Haematomyzus elephantis from the suborder Rhynchophthirina was sequenced with ten minichromosomes6, and nad2 and three tRNA were unidentified. The chewing louse, Coloceras sp., has a typical mitochondrial chromosome with 37 genes and a circular mt DNA molecule that is approximately half the size of the typical mt chromosome7. The booklice, L. bostrychophila, has a bipartite mt genome with two chromosomes: one chromosome is <8 kb in size and has 16 genes and the other is <8.5 kb in size and has 22 genes8. The mt genome of L. decolor has the typical mitochondrial chromosome of bilateral animals, 14,405 bp long with 37 genes (13 PCGs, 22 tRNAs and 2 rRNAs). For L. entomophila and L. paeta, one mitochondrial chromosome has most of the mt genes whereas the other chromosome has largely pseudogenes and non-coding regions1. Intriguingly, nad4L was absent in L. entomophila1. L. entomophila and L. paeta differ substantially from each other and from L. bostrychophila in gene content and gene arrangement in their mt chromosomes, although they have evolved multipartite mt genomes. However, a recent influential study has discovered maternally transmitted sex ratio distortion in L. nr. bostrychophila that is associated with extraordinarily divergent mitochondria. Sequencing the mt genomes of distorter and normal individuals proved to be quite a surprise. Not only were they incredibly divergent, they also had radically different gene order and genome structure. Both distorter and normal individuals had multipartite mt genomes, consisting of at least five and seven minicircles, respectively9. Moreover, L. decolor, the arrangement of genes differs substantially from that observed in Liposcelis species and other insects10. The genus Liposcelis was classified into four groups (A, B, C and D) and has 126 known species worldwide11. The booklouse, L. sculptilis, investigated in the current study, belongs to D group. In present, L. bostrychophila and L. paeta of D group, bipartite mt genome with two chromosomes, have been sequenced. Do all the species from D group have the two mitochondrial chromosomes structure? Based on the hypothesis, we sequenced the mt genome of L. sculptilis. Despite being classified as Psocoptera, the suborder Psocomorpha is phylogenetically more closely related to the Phthiraptera than to the another suborder Trogiomorpha11012. Because the fossil record for lice is poor13, there was only few studies that attempted to the evolutionary history among Psocodea suborders and among Anoplura families1415. In addition, they only used the portion of the cox1, 18S and EF-1 gene sequences to reconstruct the phylogenetic relationship and evolutionary history1415. This study is the first attempt to use mt genome to elucidate the evolutionary history of this unique group.

Results

Mitochondrial genome of Liposcelis sculptilis

The mt genome of L. sculptilis has one typical circular chromosome (Fig. 1), unlike the other two species from D group of booklice, including L. bostrychophila and L. paeta. The size and the circular organization of the mt chromosome of L. sculptilis was confirmed by two overlapping PCR amplicons, 9.1 kb (S9–S10 from cob to rrnL) and 5.5 kb in size (S11–S12 from rrnL to cob), respectively (Fig. 1, S1; Table 1). The two amplicons overlapped by 42 bp in cob and 74 bp in rrnL. We found 35 of the 37 genes typically for bilateral animals in L. sculptilis mt genome, and it contains 12 protein-coding genes (atp6, atp8, cob, cox1-cox3, nad1-nad6), two rRNA genes (rrnL, rrnS) and 21 tRNA genes.
Figure 1

Mitochondrial genomes of Liposcelis sculptilis.

Circular maps were drawn with CGView55. Arrows indicate the orientation of gene transcription. Protein-coding genes are shown as blue arrows, rRNA genes as purple arrows, tRNA genes as brown arrows and non-coding regions as light green. Abbreviations of gene names are: atp6 and atp8 for ATP synthase subunits 6 and 8, cox1-3 for cytochrome oxidase subunits 1-3, cob for cytochrome b, nad1-6 for NADH dehydrogenase subunits 1-6, rrnL and rrnS for large and small rRNA subunits. tRNA genes are indicated with their one-letter corresponding amino acids; the two tRNA genes for leucine and serine have different anticodons: L1 (anticodon TAG), L2 (TAA), S1 (TCT) and S2 (TGA). The GC content is plotted using a black sliding window, as the deviation from the average GC content of the entire sequence. GC-skew is plotted as the deviation from the average GC-skew of the entire sequence. The inner cycle indicates the location of genes in the mitochondrial genome.

Table 1

PCR primers used for amplification of the mitochondrial genome of Liposcelis sculptilis.

GenePrimerPrimer sequence (5′–3′)Tm (°C)Amplicon size (bp)
cox1UEA3TATAGCATTCCCACGAATAAATAA58UEA3-UEA8:1016
cox1UEA8AAAAATGTTGAGGGAAAAATGTTA
cobCBF1TATGTACTACCATGAGGACAAATATC55CBF1-CBR1: 481
cobCBR1ATTACACCTCCTAATTTATTAGGAAT
rrnL16SarCGCCTGTTTAACAAAAACAT5116Sar-16Sbr: 513
rrnL16SbrCCGGTCTGAACTCAGATCACGT
nad5N5-F100GCTATAGCTGCTCCCACCCC60N5-F100-N5-R100: 311
nad5N5-R100ATAAATAAAAGAGCCTTGAATAAAGC
cox1S1ATCCAATTCTATTTCAACACCT62S1-S2:1987
nad5S2ATTCATCAACTCTTGTAACAGCCG
nad5S3CGGCTGTTACAAGAGTTGATGAAT62S3-S4: 4934
rrnLS4TCTTAGGGTCTTCTCGTCTTTTTAT
rrnLS5ATGGGTGGATGCCTTCTAATCTTTA56S5-S6: 4387
cobS6ATGTTAGGAACGGTTCAAGAG
cobS7TAGTCTTAGCCCTACCATCAA57S7-S8: 3344
cox1S8AAAATATACACTTCAGGATGACCGA
cobS9AGCCAACTATCATACGGTTTTTTTC61S9-S10: 9005
rrnLS10AAACTCGGCAAAATTATGAAGCA
rrnLS11CTACCCTGCTCTCTGATTTCAGTTT60S11-S12: 5631
cobS12CTTTTGAGGGGCTACAGTGATTAC

The variation structure of tRNA in L. sculptili

Most tRNAs of the L. sculptilis have the typical clover leaf shaped secondary structure. However, five tRNAs have atypical structures. For TΨC arm and DHU arm, tRNA-His, tRNA-Glu, tRNA-Met, and tRNA-Pro lack the TΨC arm, and tRNA-Ser1 lack DHU arm in the L. sculptilis (Fig. 2). In most insects, tRNA-Ser1 also lacks the DHU arm. In terms of anti-codon, 16 tRNAs use common antisense codons, however, five tRNAs (tRNA-Asn, tRNA-His, tRNA-Ile, tRNA-Lys, tRNA-Ser1) use uncommon antisense codons. UUU, AUG, GAU, UUU, and UCU replaced the traditional codons GUU, GUG, AAU, CUU, and GCU, respectively. Secondary structure of 19 tRNAs, 62 mismatches, have base mismatch. There are 38 G-U mismatches, five U-C mismatches, six G-A mismatches, four U-U mismatches, four A-A mismatches, and four A-C mismatches.
Figure 2

Putative secondary structures of the 21 tRNA genes identified in the mitochondrial genome of L. sculptilis.

Bars indicate Watson-Crick base pairings, and dots between G and U pairs mark canonical base pairings in RNA.

Mitochondrial gene codon usage of the booklice

To date, three mt genomes of L. bostrychophila, L. sculptilis and L. paeta from D group of Liposcelis have been sequenced. The A + T content of the L. sculptilis mt genome was 76.5%, which was higher than L. paeta (75.23%) and L. bostrychophila (68.63%), respectively. The higher A + T content of L. sculptilis was present in all regions, both genes and noncoding regions. Phe (F), Ile (I) and Leu (L) are most frequently used and the frequency used of the two codons of Leu are obviously different in the five Liposcelis species (Fig. 3). In these booklice, the frequency of L2 (UUA and UUG) was significantly higher than that of L1(CUN). However, this result was just the opposite in L. bostrychophila (Fig. 3). Moreover, the difference of A + T content between the five booklice were also reflected further in the codon usage: the relative synonymous codon usages (RSCU) of the five booklice showed that L. sculptilis used more NNA and NNT codon than L. paeta and L. bostrychophila. The nucleotide composition of mt genome is usually conserved within a group; however, it varied among L. sculptili, L. paeta and L. bostrychophila. This variation might be related to mt genome fragmentation, because all of the psocodean fragmented mt genomes have a lower A + T content10.
Figure 3

Relative synonymous codon usage (RSCU) for protein coding genes of five booklice.

Abbreviations of tRNA genes are according to the single letter according to the IPUC-IUB one-letter amino acid codes.

In total of 63 mt protein-coding genes in five Liposcelis species, the traditional codon ATN (60) were used as start codon. However, the cox1 of L. decolor and the cox3 of L. paeta use TTG and the atp8 of L. bostrychophila use GTG as start codon. In terms of the stop codon, the codon TAA and TAG were used as stop codon in 61 genes. However, incomplete stop codon was used for the nad1 of L. bostrychophila and the nad4L of L. paeta, respectively (Table 2).
Table 2

The start and stop codons of protein coding gene for Liposcelis species.

GeneL. decolorL. entomophilaL. paetaL. bostrychophilaL. sculptilis
atp6ATG/TAAATA/TAAATA/TAAATA/TAAATA/TAA
atp8ATA/TAGATA/TAAATA/TAGGTG/TAGATA/TAG
cobATA/TAAATA/TAAATA/TAAATT/TAAATA/TAA
cox1TTG/TAAATT/TAAATA/TAGATC/TAAATA/TAA
cox2ATT/TAAATA/TAAATA/TAGATA/TAAATA/TAA
cox3ATA/TAAATA/TAATTG/TAAATA/TAAATG/TAA
nad1ATA/TAAATA/TAAATT/TAAATC/TATT/TAA
nad2ATA/TAAATA/TAAATA/TAAATT/TAAATT/TAA
nad3ATG/TAAATA/TAAATA/TAAATG/TAGATG/TAA
nad4ATA/TAAATT/TAAATA/TAAATC/TAAATT/TAA
nad5ATA/TAAATT/TAAATT/TAAATT/TAGATA/TAA
nad6ATG/TAAATA/TAAATA/TAAATA/TAAATA/TAA
nad4LATA/TAA ATA/TATT/TAA 

Mitochondrial gene order of the Liposcelis

In the present work, the five Liposcelis species belong to three groups (A, B, and D). L. bostrychophila, L. paeta and L. sculptilis belong to D group, and their phylogenetic relationship has been demonstrated in our phylogenetic trees. However, they have huge differences in the size, gene content, gene order and architecture of the mt genome. The mt gene arrangement in Liposcelis differs substantially from that of the hypothetical ancestor of insects and from that of the barklice (Fig. 4). With the exception of L. entomophila, there is only atp8-atp6 gene block shared between booklice and barklice, even though these five booklice belong to the same genus. In D group of Liposcelis, we found that L. bostrychophila, L. paeta and L. sculptilis shared two gene blocks: atp8-atp6, cox3-cox1 (Fig. 4).
Figure 4

Arrangement of mitochondrial genes in Liposcelis and the hypothetical ancestor of the arthropods.

Circular genomes have been arbitrarily linearized for ease of comparison. Gene names are the standard abbreviations used in the present study. tRNA genes are designated by the single letter according to the IPUC-IUB one-letter amino acid codes. Genes which are underlined are encoded on the opposite strand to the majority of genes in that particular genome. Gray, and white boxes represent pseudogenes, and transfer RNA genes, respectively. The boxes in 15 colors represent 13 protein coding genes and 2 ribosomal RNA genes.

Phylogenetic relationships and divergence times of the Psocodea

We tested the phylogenetic relationships among the major lineages of the Psocodea together with the mt genome sequences of L. sculptilis, and twenty other psocodean species (Fig. 5). Based on the two different datasets, we recovered two major clades in the Psocodea with strong support values regardless the dataset and the method we used: 1) species of barklice in the suborders Psocomorpha were clustered together; 2) the booklice formed a clade with the parasitic lice (Fig. 5). The parasitic lice (Phthiraptera) are monophyletic with strong support; however, within the parasitic lice, the suborder Ischnocera is paraphyletic and the sister-group relationship between Anoplura and Rhyncophthirina was also strongly supported. For the divergence times of the Psocodea, our results showed that Liposcelididae and Phthiraptera have evolved 134 Ma and the sucking lice diversified in the Late Cretaceous, approximately 77 Ma. Moreover, the Anoplura and Rhynchophthirina have evolved 94 Ma (Fig. 6 and further details are shown in Fig. S2).
Figure 5

Phylogenetic relationships among major lineages of the Psocodea inferred from mitochondrial genome sequences.

Numbers close to the branching points are ML bootstrap support values (above) and Bayesian posterior probabilities (below) in percentages; only support above 50% is shown. Numbers from left to right are from PCG123R and AA alignments respectively.

Figure 6

Chronogram for the Psocodea.

Chronogram is the Bayesian topology resulting from analysis of the 11 genes (cox1, cox2, cox3, atp6, cob, nad1, nad3, nad5, nad6, rrnS and rrnL) data set in BEAST53. Divergence times were estimated using three calibrations (The potential ancient origin of lice considering the recently described 100–145 Ma book louse fossil; 94–101 Ma for the split between Rhynchophthirina and Anoplura; this ancestral to all human lice has been stable for at least 7 Ma), indicated by filled circles at nodes.

Discussion

The unidentified genes of the Psocodea

Mt genomes of bilaterians typically contain two rRNA, 22 tRNA, and 13 protein-coding genes (PCGs) and a control region on a single circular chromosome, with ~16 kb in size1617. This typical mt genome organization is conserved among most of the bilateral animals known from worms to insects, fish, and humans18192021. On the other hand, however, deviation from the typical mt genome organization has occurred in many bilateral animals. For instance, most nematodes lose atp8 gene and thus only have 36 mitochondrial genes2223, as well as in a tree frog species in which the nad5 gene is apparently missing24. So far, the reported species of the Psocodea, some PCG have not been identified in L. entomophila, L. sculptilis, Pthirus pubis, and Haematomyzus elephantis, i.e., nad4 and nad2 have not been found in the pubic louse and elephant louse, respectively56. Additional, nad4L has not been found in L. entomophila1. Intriguingly, we also did not find nad4L in L. sculptilis. However, nad4L is present in the other three species of Liposcelis (L. bostrychophila, L. decolor, and L. paeta)1810. There are many possibilities for lacking mitochondrial genes. Firstly, due to sequencing technology and sequencing method, a mini-chromosome contained nad4L (or nad4 or nad2) gene, which is not identified in L. sculptilis and L. entomophila (or Pthirus pubis and Haematomyzus elephantis). For example, the mt genome architecture in some thrips exhibit extreme chromosome size asymmetry that only nad6 and tRNA-Cys are on the 0.92 kb mini-circle chromosome25. Secondly, these missing genes are functionally replaced by nuclear genes or normally transferred to the nuclear genome. For instance, mt cox2 introgression into the nuclear genome has been reported26. Thirdly, the lacking genes have been lost in the long process of evolution. In fact, as some protein-coding genes of mt genes are essential in mt respiration and adenosine triphosphate production27, the loss of these genes would present serious metabolic challenges to cells. We inferred that the lacking of nad4L gene in L. sculptilis, more likely due to the first or the second possibilities. For the unidentified tRNA genes in the Liposcelis, eight tRNA genes have not been found in mt genome of L. entomophila or L. paeta. Additionally, two of 22 typical tRNA genes were also not found in L. bostrychophila18, and one tRNA was unidentified in the L. sculptilis. Lacking of tRNA genes is more diverse, and, for example, has been reported in one gekkonid28, in one caecilian amphibian29, and in isopod crustacean30. Moreover, among lower metazoans, a massive loss of tRNA was reported in cnidarians31. Altogether, it is unclear whether in these cases the gene loss is due to gene transfer to the nuclear genome or reflects loss of the protein function32.

The mitochondrial genome strand asymmetry and structure of the Liposcelis

Strand asymmetry is reflected by AT skew and GC skew. Positive AT skew values indicate more A than T on the target strand, and positive GC skew values indicate more G than C, and vice versa33. In terms of L. sculptilis, the A + T content is 76.5%, which was lower than the L. entomophila (78.6%) in Liposcelis. The AT skew is 0.018 and the CG skew is 0.047, and these results indicated a low degree of strand asymmetry of the base composition in the L. sculptilis mt genome. Generally, insect mt genomes, in terms of the structure, gene order, gene content, are very stable, however, this rule does not apply in the genus of Liposcelis. From the results of our studies in five Liposcelis species, the tremendous differences in these features were existed (Figs 3 and 4). Such differences among mt genomes, were first discovered within a genus in insects. Even some of the gene blocks are stable within a genus of Anoplura, which have highly fragmented mt genomes and violently gene rearrangement. For instance, the sucking lice, Pediculus humanus and P. capitis, have fragmented mt genomes with 20 minichromosomes, but the gene order of protein-coding genes and gene content, were identical across the corresponding minichromosomes45. The same example also appeared between the pig lice, Haematopinus apri and H. suis34. The phylogenetic relationships between booklice and Phthiraptera are close from gene rearrangement. However, three barklices (Lepidopsocid sp., Psococerastis albimaculata, and Longivalvus hyalospilus), have relatively conservative gene order1235, also belong to Psocoptera. They shared lots of gene blocks. For the convenience and accuracy of communication, our previous studies have introduced the concept of “mitochondrial karyotype” or “mitochondrial genome karyotypes” for describing the violent variation of mt genomes in sucking lice and booklice636.

Phylogenetic relationships among major lineages of the Liposcelis inferred from mitochondrial genome sequences

The phylogenetic tree showed a close relationship between the booklice (Liposcelis) and parasitic lice (sucking lice). Therefore, the order Psocoptera was paraphyletic, and this result was consistent with previous studies13171819. Mt gene rearrangement has been substantially faster in the lineage leading to the booklice and the parasitic lice than in the lineage leading to the barklice12. Lifestyle change of booklice appears to be associated with the contrasting rates in mt gene rearrangements between the two clades of the Psocodea373839. Within the genus Liposcelis, L. paeta and L. sculptilis formed a clade and then clustered with L. bostrychophila. These three species, from group D40, were most closely related to L. entomophila (group A). The current classification of genus Liposcelis included four groups (A, B, C, and D)1141, which have big difference in morphological, physiology and molecular biology aspects4142. Although the five Liposcelis species are different from each other in mt genome organization, they were clustered together with strong support in the phylogenetic tree. Then, these results suggest unusually fast evolution in mt genome organization in the booklice of the genus Liposcelis.

Estimation of divergence times

Fossil calibrations for lice are lacking1315. Based on a fossil calibration, previous study indicated that parasitic lice and booklice minimally have diverged 100 Ma13. For a basal calibration representing the split between Rhynchophthirina and Anoplura, we chose the time of basal diversification in placental mammals in a previous study43, because we believed it reasonable that sucking lice could not have diversified until they had appropriate hosts to colonize4344. It has been determined that time of basal diversification in placental mammals was 94–109 Ma; therefore, a calibration with a mean of 101 (and standard deviation of 3.5) was used to represent the basal split between the Rhychophthirina and Anoplura1443. Additionally, some studies have documented the most recent common ancestor of human lice (Pediculus humanus, Pediculus capitis, and Pthirus pubis) has been stable for at least 7 Ma5. Totally, these three calibration points were used in combination, as well as individually, to cross-check the other calibration points, in the divergence dating analyses. Our analyses indicated that the most recent common ancestor of Liposcelididae and Phthiraptera has been diversified in Late Jurassic to Early Cretaceous, approximately 134 Ma (Fig. 6). The estimated divergence time of Liposcelididae and Phthiraptera was largely consistent with a recent estimates45. Moreover, the results, sucking lice diversified in the Late Cretaceous, approximately 77 Ma; Anoplura and Rhynchophthirina have evolved 94 Ma (Fig. 6), were also consistent with a previous study14. However, another previous study reported that Liposcelididae and Amblycera were sister group and the Ischnocera was monophly, was inconsistent with the most recent research18101215.

Materials and Methods

Sample collection, DNA extraction and amplification of mitochondrial genome

L. sculptilis was collected at a grain storage in Gansu Province, China, and identified according to their morphological characteristics1144. Total genomic DNA was extracted from ~300 booklouse specimens (20 mg) using a TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China) and stored at −20 °C. Partial sequences of cox1, cob, nad5, and rrnL of L. sculptilis were amplified initially by PCR with primer pairs UEA3-UEA8 (1016 bp), CBF1-CBR1 (481 bp), N5-F100-N5-R100 (311 bp) and 16Sar-16Sbr (513 bp), respectively (Table 1). Four pairs of primers, S1-S2, S3-S4, S5-S6 and S7-S8, were designed from cox1, cob, nad5, and rrnL (Table 1). Four overlapping fragments were amplified by long PCR with S1-S2, S3-S4, S5-S6 and S7-S8, sequenced and assembled into contigs with SeqMan (DNAStar). To verify L. sculptilis chromosome and avoid the mistake might be caused by primers (S9-S10 and S11-S12) at cob and rrnL, a 9,005 bp fragment and a 5,631 bp fragment were amplified additionally with primers S9-S10 and S11-S12 (Table 1). LA Taq (5 U/μL, Takara) was used in long PCRs to amplify overlapping fragments. Each long PCR reaction is 25 μL in volume, containing 1.0 μL each of forward primer (10 μM) and reverse primer (10 μM), 4.0 μL of dNTPs mix (each 2.5 mM), 1.0 μL of template DNA, 2.5 μL MgCl2 (25 mM), 2.5 μL of 10 ×  LA PCR reaction buffer II, 12.75 μL ddH2O and 0.25 μL LA Taq DNA polymerase (5 U/μL, Takara). All reactions were carried out using C1000TM thermal cyclers (Bio-RAD, Hercules, CA, USA) with the following conditions: 2 min denaturation at 94 °C, 37 cycles of 94 °C for 20 s, 58 °C for 50 s, 68 °C for 5–10 min (depending on target size, 1 min/kb), followed by a final extension at 68 °C for 15 min. Positive and negative controls were always executed with each PCR experiment to detect DNA contamination and false positive amplifications. PCR products were checked by agarose gel (1%) electrophoresis. Gel-purified amplification products <3 kb in size were ligated into pGEM-T Easy vectors (Promega), and introduced into Escherichia coli (DH5α, Beijing TransGen Biotech, Beijing, China). Followed by ampicillin selection, plasmid DNAs from positive clones were sequenced with M13 primers. Longer PCR products (>3 kb) were directly sequenced with both forward and reverse PCR primers and internal primers by primer walking. All products were sequenced by Life Technologies in Guangzhou, China.

Sequence assembly, annotation and analysis

SeqMan (DNAStar) was used to assemble the four overlapping nucleotide sequences, which were further confirmed by manually inspection. The protein-coding and rRNA genes were identified using the program ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and BLAST searches against the GenBank database, respectively. Subsequently, all of these genes were further confirmed by alignment with homologous genes from those of other booklice and lice species. The transfer RNA genes were identified by their cloverleaf secondary structure using ARWEN46 with default parameters and tRNAscan-SE 1.2147 with Search Mode = EufindtRNA-Cove, Genetic Code = Invertebrate Mito and Cove score cutoff = 0.1. The base composition was analyzed with MEGA 548. Sequences of mt genomes of other booklice and lice were retrieved from GenBank (Table S1).

Sequence alignment and phylogenetic analysis

Eight species from the Psocoptera and thirteen species from the Phthiraptera were included in our phylogenetic analysis (Table S1). Two true bugs Alloeorhynchus bakeri and Halyomorpha halys were used as outgroups12. Sequences of all mt protein-coding genes and rRNA genes except nad4, nad4L, nad2, atp8 were used in phylogenetic analysis. nad4L and atp8 were excluded because they are too short to align among the Psocodean species. nad4 and nad2 was excluded because it was not identified in the human pubic louse, Pthirus pubis5 or in the elephant louse, Haematomyzus elephantis6. Two alignments were used for phylogenetic analyses: 1) a concatenated nucleotide sequence alignment of nine protein-coding genes and two rRNA genes; 2) a concatenated amino acid sequence alignment of nine protein-coding genes. Nucleotide sequences of all protein-coding genes and rRNA genes were aligned using the default settings in ClustalW as implemented in MEGA 548. Amino acid sequences of PCGs were also aligned in ClustalW. All of the alignments were then imported into the Gblocks server (http://molevol.cmima.csic.es/castresana/Gblocks_server.html) to remove poorly aligned sites49. Gblocks server was applied with the ‘codons’, ‘DNA’ and ‘protein’ mode for PCG nucleotide sequences, rRNA sequences and PCG amino acid sequences, respectively, and with all options for a stringent selection were chosen. Subsequent analyses were performed on the combined dataset using Maximum likelihood (ML) and Bayesian inference (BI). BI was performed using MrBayes 3.250 and ML was performed using RAxML 7.7.151. For ML, the GTRGAMMA model was selected for the concatenated datasets, with 1000 bootstrap replicates. For BI, the best-fitting nucleotides models were chosen using PartitionFinder V1.1.152 as follows: TIM + I + G: cox1; GTR + I + G: atp6, cob, cox2, cox3, nad1, nad3, nad5; HKY + I + G: nad6; TVM + I + G: rrnL, rrnS; the best-fitting amino acids models were chosen as follows: MtArt + I + G: cox1; MtArt + I + G + F: cox2, cox3, cob, atp6, nad1, nad3, nad5, and nad6. Two independent sets of Markov chains were run, each with one cold and three heated chains for 1 × 107 generations, and every 1000th generation was sampled. Convergence was inferred when a standard deviation of split frequencies <0.01 was completed. Sump and sumt burninfrac was set to 25% and contype was set to allcompat.

Divergence dating analysis

We performed divergence date analyses based on the combined 11 mt genes dataset of Psocodean (Table S1). The molecular clock was calibrated using three minimum age constraints based on one fossil and two conclusions (100–145 Ma for the split between lice and Liposcelididae, 94–101 Ma for the split between Rhynchophthirina and Anoplura, and the ancestor of three human lice has been stable for at least 7 Ma)51314. Analyses were performed using a relaxed molecular clock model in the Bayesian phylogenetic software BEAST 1.8.053. Rate variation was modeled among branches using uncorrelated lognormal relaxed clocks53. A Yule speciation process was used for the tree prior and posterior distributions of parameters, including the tree, were estimated using MCMC sampling54. We performed two replicate MCMC runs, with the tree and parameter values sampled every 5000 steps over a total of 50 million generations. A maximum clade credibility tree was obtained using Tree Annotator within the BEAST software package with a burn-in of 1000 trees. Acceptable sample sizes and convergence to the stationary distribution were checked using Tracer 1.553.

Additional Information

How to cite this article: Shi, Y. et al. The mitochondrial genome of booklouse, Liposcelis sculptilis (Psocoptera: Liposcelididae) and the evolutionary timescale of Liposcelis. Sci. Rep. 6, 30660; doi: 10.1038/srep30660 (2016).
  47 in total

1.  Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis.

Authors:  J Castresana
Journal:  Mol Biol Evol       Date:  2000-04       Impact factor: 16.240

2.  Multiple origins of parasitism in lice.

Authors:  Kevin P Johnson; Kazunori Yoshizawa; Vincent S Smith
Journal:  Proc Biol Sci       Date:  2004-09-07       Impact factor: 5.349

3.  Fossil Liposcelididae and the lice ages (Insecta: Psocodea).

Authors:  David Grimaldi; Michael S Engel
Journal:  Proc Biol Sci       Date:  2006-03-07       Impact factor: 5.349

4.  Key transitions in animal evolution: a mitochondrial DNA perspective.

Authors:  Dennis V Lavrov
Journal:  Integr Comp Biol       Date:  2007-06-13       Impact factor: 3.326

5.  Multiple lineages of lice pass through the K-Pg boundary.

Authors:  Vincent S Smith; Tom Ford; Kevin P Johnson; Paul C D Johnson; Kazunori Yoshizawa; Jessica E Light
Journal:  Biol Lett       Date:  2011-04-06       Impact factor: 3.703

Review 6.  Maternal transmission, sex ratio distortion, and mitochondria.

Authors:  Steve J Perlman; Christina N Hodson; Phineas T Hamilton; George P Opit; Brent E Gowen
Journal:  Proc Natl Acad Sci U S A       Date:  2015-04-13       Impact factor: 11.205

7.  Sequence and organization of the human mitochondrial genome.

Authors:  S Anderson; A T Bankier; B G Barrell; M H de Bruijn; A R Coulson; J Drouin; I C Eperon; D P Nierlich; B A Roe; F Sanger; P H Schreier; A J Smith; R Staden; I G Young
Journal:  Nature       Date:  1981-04-09       Impact factor: 49.962

8.  MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space.

Authors:  Fredrik Ronquist; Maxim Teslenko; Paul van der Mark; Daniel L Ayres; Aaron Darling; Sebastian Höhna; Bret Larget; Liang Liu; Marc A Suchard; John P Huelsenbeck
Journal:  Syst Biol       Date:  2012-02-22       Impact factor: 15.683

9.  The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda) bears a novel gene order and unusual control region features.

Authors:  Fabian Kilpert; Lars Podsiadlowski
Journal:  BMC Genomics       Date:  2006-09-20       Impact factor: 3.969

10.  A novel mitochondrial genome architecture in thrips (Insecta: Thysanoptera): extreme size asymmetry among chromosomes and possible recent control region duplication.

Authors:  Aaron M Dickey; Vivek Kumar; J Kent Morgan; Antonella Jara-Cavieres; Robert G Shatters; Cindy L McKenzie; Lance S Osborne
Journal:  BMC Genomics       Date:  2015-06-09       Impact factor: 3.969

View more
  9 in total

1.  Complete mitochondrial genome of Episymploce splendens (Blattodea: Ectobiidae): A large intergenic spacer and lacking of two tRNA genes.

Authors:  Lin Yan; Zhenzhen Hou; Jinnan Ma; Hongmei Wang; Jie Gao; Chenjuan Zeng; Qin Chen; Bisong Yue; Xiuyue Zhang
Journal:  PLoS One       Date:  2022-06-02       Impact factor: 3.752

2.  Independent evolution of highly variable, fragmented mitogenomes of parasitic lice.

Authors:  Andrew D Sweet; Kevin P Johnson; Stephen L Cameron
Journal:  Commun Biol       Date:  2022-07-08

3.  Comparative mitogenomics of Drosophilidae and the evolution of the Zygothrica genus group (Diptera, Drosophilidae).

Authors:  Maiara Hartwig Bessa; Francine Cenzi de Ré; Rafael Dias de Moura; Elgion Lucio Loreto; Lizandra Jaqueline Robe
Journal:  Genetica       Date:  2021-10-05       Impact factor: 1.082

4.  Novel insights into mitochondrial gene rearrangement in thrips (Insecta: Thysanoptera) from the grass thrips, Anaphothrips obscurus.

Authors:  Hangrui Liu; Hu Li; Fan Song; Wenyi Gu; Jinian Feng; Wanzhi Cai; Renfu Shao
Journal:  Sci Rep       Date:  2017-06-27       Impact factor: 4.379

5.  The Highly Divergent Mitochondrial Genomes Indicate That the Booklouse, Liposcelis bostrychophila (Psocoptera: Liposcelididae) Is a Cryptic Species.

Authors:  Shiqian Feng; Qianqian Yang; Hu Li; Fan Song; Václav Stejskal; George P Opit; Wanzhi Cai; Zhihong Li; Renfu Shao
Journal:  G3 (Bethesda)       Date:  2018-03-02       Impact factor: 3.154

6.  The Complete Mitogenome of the Wood-Feeding Cockroach Cryptocercus meridianus (Blattodea: Cryptocercidae) and Its Phylogenetic Relationship among Cockroach Families.

Authors:  Weijun Li; Zongqing Wang; Yanli Che
Journal:  Int J Mol Sci       Date:  2017-11-12       Impact factor: 5.923

7.  Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses.

Authors:  Yan Shi; Lin-Yu Li; Qin-Peng Liu; Muhammad Yasir Ali; Zhong-Lin Yuan; Guy Smagghe; Tong-Xian Liu
Journal:  PLoS One       Date:  2021-11-04       Impact factor: 3.240

8.  The First Mitogenomes of the Subfamily Odontiinae (Lepidoptera, Crambidae) and Phylogenetic Analysis of Pyraloidea.

Authors:  Mujie Qi; Huifeng Zhao; Fang Yu; Aibing Zhang; Houhun Li
Journal:  Insects       Date:  2021-05-24       Impact factor: 2.769

9.  The first mitochondrial genomes for Pyralinae (Pyralidae) and Glaphyriinae (Crambidae), with phylogenetic implications of Pyraloidea.

Authors:  Wenbo Zhu; Jun Yan; Jingrui Song; Ping You
Journal:  PLoS One       Date:  2018-03-27       Impact factor: 3.240

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.