| Literature DB >> 27446039 |
Patricia Fajardo-Cavazos1, Wayne L Nicholson1.
Abstract
Bacteria of the genus Staphylococcus are persistent inhabitants of human spaceflight habitats and represent potential opportunistic pathogens. The effect of the human spaceflight environment on the growth and the frequency of mutations to antibiotic resistance in the model organism Staphylococcus epidermidis strain ATCC12228 was investigated. Six cultures of the test organism were cultivated in biological research in canisters-Petri dish fixation units for 122 h on orbit in the International Space Station (ISS) as part of the SpaceX-3 resupply mission. Asynchronous ground controls (GCs) consisted of identical sets of cultures cultivated for 122 h in the ISS Environmental Simulator at Kennedy Space Center. S. epidermidis exhibited significantly lower viable counts but significantly higher frequencies of mutation to rifampicin (Rif) resistance in space vs. GC cultures. The spectrum of mutations in the rpoB gene leading to Rif(R) was altered in S. epidermidis isolates cultivated in the ISS compared to GCs. The results suggest that the human spaceflight environment induces unique physiologic stresses on growing bacterial cells leading to changes in mutagenic potential.Entities:
Keywords: Staphylococcus epidermidis; antibiotic resistance; mutation; rifampicin; rpoB; space flight
Year: 2016 PMID: 27446039 PMCID: PMC4923109 DOI: 10.3389/fmicb.2016.00999
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Oligonucleotide primers used for amplification of rpoB regions in Staphylococcus epidermidis.
| Primer name | Sequence 5′ → 3′ | |
|---|---|---|
| Sep rpoB – 13F | GTAAGGGTGAACACACAA | N-cluster |
| Sep rpoB + 685R | CTCTAATAAAGCCTGTTCTG | N-cluster |
| Sep rpoB + 1322F | CTATTACGCCACAACAACTC | Clusters I, II, III |
| Sep rpoB + 2023R | GCGTCCTCTATGCTTAGC | Clusters I, II, III |
Summary of rpoB mutations leading to RifR in S. epidermidis flight (FL) vs. ground control (GC) samples.
| PDFU | 1 | 2 | 3 | 4 | 5 | 6 | Total | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mutation | FL | GC | FL | GC | FL | GC | FL | GC | FL | GC | FL | GC | FL | GC |
| Q469K | 1 | 3 | 3 | 3 | 4 | |||||||||
| Q469L | 1 | 1 | 1 | 3 | 0 | |||||||||
| Q469R | 2 | 2 | 0 | |||||||||||
| H482D | 1 | 1 | 1 | 1 | 2 | |||||||||
| H482R | 1 | 1 | 0 | |||||||||||
| H482Y | 2 | 1 | 7 | 8 | 8 | 4 | 3 | 4 | 4 | 33 | ||||
| R485H | 2 | 3 | 1 | 1 | 1 | 1 | 1 | 3 | 6 | |||||
| S487F | 12 | 1 | 4 | 1 | 7 | 1 | 10 | 1 | 6 | 3 | 4 | 42 | 8 | |
| S487Y | 2 | 1 | 2 | 1 | 1 | 5 | 2 | |||||||
| E460Q+Q469K | 1 | 1 | 0 | |||||||||||
| D472Y + S487C | 1 | 1 | 0 | |||||||||||
| No mutation found | 1 | 1 | 1 | 1 | ||||||||||
| Total sequenced | 17 | 7 | 10 | 10 | 10 | 10 | 10 | 10 | 10 | 10 | 10 | 10 | 67 | 57 |
Distribution of classes of RifR rpoB mutations appearing at least once in FL and GC samplesa.
| FL | GC | No. of PDFUs | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| PDFU number: | 1 | 2 | 3 | 4 | 5 | 6 | 1 | 2 | 3 | 4 | 5 | 6 | FL | GC |
| Amino acid change | ||||||||||||||
| Q469K | X | X | X | 1 | 2 | |||||||||
| Q469L | X | X | X | 3 | 0 | |||||||||
| Q469R | X | 1 | 0 | |||||||||||
| H482D | X | X | X | 1 | 2 | |||||||||
| H482R | X | 1 | 0 | |||||||||||
| H482Y | X | X | X | X | X | X | X | X | 2 | 6 | ||||
| R485H | X | X | X | X | X | X | X | 2 | 5 | |||||
| S487F | X | X | X | X | X | X | X | X | X | X | X | 6 | 5 | |
| S487Y | X | X | X | X | X | 3 | 2 | |||||||
| E460Q + Q469K | X | 1 | 0 | |||||||||||
| D472Y + S487C | X | 1 | 0 | |||||||||||