Microsatellite development for the genus Guibourtia (Fabaceae, Caesalpinioideae) reveals diploid and polyploid species.

PREMISE OF THE STUDY: Nuclear microsatellites (nSSRs) were designed for Guibourtia tessmannii (Fabaceae, Caesalpinioideae), a highly exploited African timber tree, to study population genetic structure and gene flow. METHODS AND
RESULTS: We developed 16 polymorphic nSSRs from a genomic library tested in three populations of G. tessmannii and two populations of G. coleosperma. These nSSRs display three to 14 alleles per locus (mean 8.94) in G. tessmannii. Cross-amplification tests in nine congeneric species demonstrated that the genus Guibourtia contains diploid and polyploid species. Flow cytometry results combined with nSSR profiles suggest that G. tessmannii is octoploid.
CONCLUSIONS: nSSRs revealed that African Guibourtia species include both diploid and polyploid species. These markers will provide information on the mating system, patterns of gene flow, and genetic structure of African Guibourtia species.

The African tree Guibourtia tessmannii (Harms) J. Léonard (Fabaceae, Caesalpinioideae) is a hermaphrodite rainforest species distributed from Cameroon to Gabon (Fougère-Danezan et al., 2007; Tosso et al., 2015). Known as “bubinga” or “kevazingo,” it has high commercial and social value but is under significant threat due to illegal logging. The genus Guibourtia Benn. includes 13 African species distributed from Senegal to Mozambique in forest or savannah habitats. The genus was divided by Léonard (1949) into three main subgenera: (i) Pseudocopaiva: G. tessmannii, G. pellegriniana J. Léonard, G. coleosperma (Benth.) J. Léonard, G. leonensis J. Léonard; (ii) Guibourtia: G. carrissoana (M. A. Exell) J. Léonard, G. copallifera Benn., G. demeusei (Harms) J. Léonard, G. sousae J. Léonard; and (iii) Gorskia: G. arnoldiana (De Wild. & T. Durand) J. Léonard, G. conjugata (Bolle) J. Léonard, G. dinklagei (Harms) J. Léonard, G. ehie (A. Chev.) J. Léonard, G. schliebenii (Harms) J. Léonard. We developed polymorphic microsatellite markers for G. tessmannii and tested them on nine African congeneric species to verify species delimitation and document population genetic structure and gene flow patterns. Because microsatellite typing suggested that some species were polyploid, we used flow cytometry to compare the ploidy levels of two related species for which appropriate fresh material was available.

METHODS AND RESULTS

Microsatellite development

We extracted total DNA from 30 mg of dry leaf of G. tessmannii (FT0001; Appendix 1) using a cetyltrimethylammonium bromide (CTAB) method (Fu et al., 2005). We prepared a nonenriched DNA genomic library, following Mariac et al. (2014), and generated 150-bp-long paired-end reads on an Illumina MiSeq platform (San Diego, California, USA). We assembled the resulting 78,279 reads by pair with PANDAseq (Masella et al., 2012). Using the software QDD (Meglécz et al., 2014), we detected 2483 microsatellite loci. Of these, 149 had at least eight repeats and flanking regions appropriate to define pairs of PCR primers. We developed primers for 48 loci with at least eight di-, tri-, or tetranucleotide repeats and primer regions at least 20 bp distant from the microsatellite region. We added one of four possible linkers (Q1–Q4; Micheneau et al., 2011) to the 5′ end of the forward primer of each locus to label PCR products with fluorochromes FAM, NED, VIC, and PET (Table 1).

Table 1.

Characterization of 16 polymorphic and one monomorphic nuclear microsatellite loci isolated from Guibourtia tessmannii.

Primersa,b	Primer sequences (5′–3′)	Labeled primerc	Repeat motif	Allele range size (bp)	GenBank accession no.
R12-Seq10*	F: AGGACTTAAGAATGGTGATGCAA	Q1-6-FAM	(AT)10	150–200	KX086193
	R: TTTGGCTTCCCTCTCTTCCT
R12-Seq15*	F: CCTGATTGGAGTTACACCACC	Q1-6-FAM	(AG)13	98–124	KX086194
	R: AGGACAAGCTTGAGCGACAT
R12-Seq21*	F: TTTCATTCAAACAAACCGCA	Q2-NED	(ATA)11	176–218	KX086197
	R: CTGACACACAAACACAGCCA
R12-Seq35*	F: GACACTCCTCAGGTGGTTTCA	Q3-VIC	(AAT)20	123–165	KX086204
	R: GAGGTTAGATTCCAACATGTGC
R12-Seq29*	F: CCAAATTGCAGACGATGAAA	Q3-VIC	(TCT)11	205–247	KX086201
	R: AATTCGGACTTGAAGTTGCAG
R12-Seq08**	F: AACATGCATACTTTAACCGCAA	Q4-PET	(TTTC)9	148–172	KX086191
	R: TTTCAATCAACACTTATCCTTGG
R12-Seq06**	F: ATCTCCGCTTGTATCTGCGT	Q1-6-FAM	(GA)8	187–203	KX086190
	R: AATCAAGCCTCCGTAAAGCA
R12-Seq26**	F: CACAATACTAGAGCTGAAGAAACATGA	Q2-NED	(TCT)13	153–186	KX086200
	R: CACGAGAAAGGGAGGAAATG
R12-Seq34**	F: GACACTCCTCAGGTGGTTTCA	Q3-VIC	(TAT)13	150–186	KX086203
	R: GAGGTTAGATTCCAACATGTGC
R12-Seq16**	F: CCCATAATCAGCCTACAAACC	Q2-NED	(AG)11	226–262	KX086195
	R: CAGATGAGGTAGACATTGTGGG
R12-Seq09***	F: ACCTACGTTTGTGATTATGAATGG	Q1-6-FAM	(GA)8	166–196	KX086192
	R: TTTGGGTGATCTTTATGCTTTC
R12-Seq20***	F: AAATCCGGAGGAGAGGAAGA	Q2-NED	(AG)8	194–218	KX086196
	R: CTGACTCTGGCTTGACCCAT
R12-Seq22***	F: TTATGATGCGTGTCCCAAA	Q2-NED	(TA)21	157–177	KX086198
	R: GAATTGAATGCAGGGAGGAC
R12-Seq01****	F: CCTCATCATAACAATTCAAGTGC	Q1-6-FAM	(AT)20	201–241	KX086189
	R: GATGCCATGACTCTGGCTAAA
R12-Seq25****	F: CATAGACTTGGAGGGAGCCA	Q2-NED	(GA)9	174–196	KX086199
	R: TTGCTTCCTTGTATCTTTAACAATTT
R12-Seq31****	F: ATTCCTATCAGATGAACAGATTATCA	Q3-VIC	(AT)8	221–245	KX086202
	R: AGCTTGTTGCAAATTGGATTG
R12-Seq43**	F: GGCAGAATTTCCAGAAGCAA	Q4-PET	(TA)23	143	KX086205
	R: ACACAACCTTCCTTTCCTGC

* = Multiplex Mix 1, ** = Mix 2, *** = Mix 3, **** = Mix 4.

Optimal annealing temperature was 60°C for all loci.

Q1 = TGTAAAACGACGGCCAGT (Schuelke, 2000); Q2 = TAGGAGTGCAGCAAGCAT; Q3 = CACTGCTTAGAGCGATGC; Q4 = CTAGTTATTGCTCAGCGGT (Q2–Q4, after Culley et al., 2008).

We tested 48 primer pairs using two samples of G. tessmannii (FT0002 and FT0003; Appendix 1). PCR reactions (total volume of 15 μL) used 1.5 μL of buffer (10×), 0.6 μL MgCl2 (25 mM), 0.45 μL dNTPs (10 mM each), 0.3 μL of each primer (0.2 μM), 0.08 μL TopTaq DNA Polymerase (5 U/μL; QIAGEN, Venlo, The Netherlands), 1.5 μL of Coral Load, 1 μL of template DNA (of ca. 10–50 ng/μL), and 9.27 μL of water. PCR conditions were: 94°C (4 min); 30 cycles of 94°C (30 s), 55°C (45 s), and 72°C (1 min); and a final extension at 72°C (10 min). We visualized PCR products stained with SYBR Safe (Invitrogen, Merelbeke, Belgium) on a 1% agarose gel. Forty-two loci amplified consistently.

We assessed polymorphism on seven G. tessmannii individuals from Cameroon and Gabon (Appendix 1). We used fluorescent labeling by PCR amplification in a total volume of 15 μL, combining 0.15 μL of the reverse and 0.1 μL of the forward (0.2 μM for both) microsatellite primers, 0.15 μL of Q1–Q4 labeled primers (0.2 μM each), 3 μL of Type-it Microsatellite PCR Kit (QIAGEN), H2O, and 1 μL of DNA. PCR conditions were: 5-min initial denaturation at 95°C; followed by 30 cycles of (95°C for 30 s, 60°C for 90 s, 72°C for 1 min) and 10 cycles of (95°C for 30s, 55°C for 45 s, 72°C for 60 s, 72°C for 1 min); and a final elongation step at 60°C for 30 min. We mixed 1.1 μL of each PCR product with 12 μL of Hi-Di Formamide (Life Technologies, Carlsbad, California, USA) and 0.3 μL of MapMarker 500 labeled with DY-632 (Eurogentec, Seraing, Belgium). The preparation was genotyped on an ABI3730 sequencer (Applied Biosystems, Lennik, The Netherlands).

After excluding loci that did not amplify consistently or were unreadable, we combined 16 polymorphic loci (one locus [R12-Seq43] was monomorphic) in four multiplexed reactions (Table 1) using Multiplex Manager 1.0 software (Holleley and Geerts, 2009). Preliminary population genetic analyses were performed on three populations of G. tessmannii (35–58 individuals per population; Table 2 and Appendix 1). Multiplexed PCRs were as above except that 3 μL of the 5× Q-solution of the Type-it Microsatellite PCR Kit was added. The individuals of G. tessmannii studied revealed a high degree of polymorphism, with more than two alleles per individual, suggesting a polyploid genome (Table 2).

Table 2.

Results of initial primer screening of 17 nuclear microsatellite loci developed in Guibourtia tessmannii (three populations) and 10 that cross-amplified in G. coleosperma (two populations).

Locus	G. tessmannii (octoploid)									G. coleosperma (diploid)
	Gabon (Makokou; N = 35)			Gabon (Bambidie; N = 58)			Cameroon (Ma’an; N = 38)			DRC (Dilolo; N = 20)						Namibia (Rundu; N = 13)
	A	Arange	Aind	A	Arange	Aind	A	Arange	Aind	N	A	Ho	He	Fa	r	N	A	Ho	He	Fa	r
R12-Seq15	4	1–3	1.13	11	1–3	1.5	6	1–3	1.51	20	4	0.11	0.26	0.31	0.09 ± 0.08	12	2	0.08	0.08	0***	0.11 ± 0.09
R12-Seq10	14	1–5	2.34	18	1–4	2.02	20	1–6	2.13	18	14	0.67	0.91	0.23	0.07 ± 0.05	13	10	0.62	0.92	0.33	0.07 ± 0.05
R12-Seq35	6	1–4	1.85	13	1–5	2.69	8	1–3	2.12	20	4	0.5	0.71	0.12	0.06 ± 0.05	13	4	0.46	0.7	0.35	0.10 ± 0.07
R12-Seq08	6	1–4	2.45	5	1–3	1.28	5	1–3	1.89	20	2	0	0.09	1*	0.11 ± 0.09	13	1	—	—	—	0.12 ± 0.10
R12-Seq26	7	1–5	2.56	11	1–4	1.91	9	1–3	1.65	20	1	—	—	—	0.12 ± 0.09	13	1	—	—	—	0.13 ± 0.10
R12-Seq34	7	1–6	4.48	5	1–4	2	5	2–3	2.08	20	7	0.67	0.67	0	0.05 ± 0.04	13	5	0.15	0.73	0.79	0.20 ± 0.11
R12-Seq16	14	1–8	5.38	16	2–8	4.72	13	2–8	4.22	19	3	0.5	0.39	−0.07	0.05 ± 0.04	13	1	—	—	—	0.12 ± 0.12
R12-Seq09	10	1–5	2.95	12	2–6	3.55	12	2–6	4.06	19	2	0.06	0.11	0.49	0.29 ± 0.09	12	2	0	0.51	1	0.72 ± 0.11
R12-Seq20	9	1–5	2.63	5	1–3	1.51	2	1–2	1.46	20	3	0	0.3	1**	0.20 ± 0.36	12	—	—	—	—	1 ± 0.00
R12-Seq22	3	1–3	1.42	9	1–3	1.22	4	1	1	20	6	0.34	0.77	0.49**	0.16 ± 0.07	13	7	0.23	0.87	0.74	0.29 ± 0.11
R12-Seq01	11	1–6	2.83	14	1–7	2.98	17	1–7	2.94	—	—	—	—	—	—	—	—	—	—	—	—
R12-Seq25	7	1–4	2.03	7	1–4	2.25	7	1–4	2.26	—	—	—	—	—	—	—	—	—	—	—	—
R12-Seq31	13	1–5	2.31	10	1–4	2.26	7	1–6	2.88	—	—	—	—	—	—	—	—	—	—	—	—
R12-Seq21	10	1–4	2.44	12	1–3	2.07	11	1–3	1.68	—	—	—	—	—	—	—	—	—	—	—	—
R12-Seq29	6	1–4	2.16	4	1–3	1.76	10	1–3	1.94	—	—	—	—	—	—	—	—	—	—	—	—
R12-Seq06	5	1–3	2.03	4	1–4	2.14	5	1–3	2.11	—	—	—	—	—	—	—	—	—	—	—	—
R12-Seq43	1	1	1	1	1	1	1	1	1	—	—	—	—	—	—	—	—	—	—	—	—

Note: — = not applicable; A = number of alleles; Aind = mean number of alleles per individual; Arange = range of number of alleles per individual; DRC = Democratic Republic of Congo; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled; r = null allele frequency.

Significance of deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001.

Microsatellite marker data analysis in G. tessmannii and G. coleosperma

The three populations of G. tessmannii (Table 2 and Appendix 1) had three to 14 alleles per locus (mean 8.94 alleles per locus, Table 2). Single-locus genotypes had one to eight alleles (2.35 ± 0.94 alleles per locus) and no fixed heterozygosity, suggesting an autopolyploid.

For G. coleosperma, the diploid species in which cross-amplification was the most successful (see below), we considered two populations (Table 2). For each of the 10 amplifiable loci, we calculated allele size range, number of alleles (A) per locus, observed (Ho) and expected (He) heterozygosity, inbreeding coefficient (F), and null allele frequency (r) with INEst 1.0 (Chybicki and Burczyk, 2009). Deviation from Hardy–Weinberg equilibrium (HWE) was tested for each locus with SPAGeDi (Hardy and Vekemans, 2002). Loci exhibited one to 14 alleles (mean 4.5) with Ho (mean ± SE) of 0.28 ± 0.09 and He of 0.41 ± 0.11 for the Democratic Republic of Congo (DRC) population and one to 10 alleles (mean 3.67) with Ho of 0.17 ± 0.05 and He of 0.36 ± 0.10 for the Namibia population. Significant deviation from HWE was observed in at least one population for four primer pairs. Loci R12-Seq20 and R12-Seq22 for the DRC population exhibited a significant deficit of heterozygotes due to the presence of null alleles (Table 2).

Flow cytometry

We used flow cytometry to confirm the ploidy level of G. tessmannii and compare its genome size with G. coleosperma. We used fresh material from seeds collected in central Gabon (G. tessmannii) and northern Namibia (G. coleosperma) (Appendix 1). From 1 cm2 pieces of fresh leaves, we obtained suspensions of leaf cell nuclei by chopping them in a buffer solution using the CyStain UV Precise P Kit (Partec GmbH, Münster, Germany) with DAPI (4′,6-diamidino-2-phenylindole, dilactate). We ran samples with Ploidy Analyser equipment (Partec GmbH). We used tomato as an internal standard (Solanum lycopersicum L. “Montfavet 63-5” [2C = 1.99 pg, 40.0% GC; Marie and Brown, 1993]). Under the assumption that the GC content of our samples and the standard were similar, the genome size of G. coleosperma ranged from 3.20 to 3.70 pg (N = 3) and G. tessmannii from 11.87 to 15.78 pg (N = 3). Although these estimates should be considered with caution in the absence of information on the GC content, the genome size of G. tessmannii is nearly four times larger than that of G. coleosperma. Because the latter species displays microsatellite profiles typical of diploids, the flow cytometry results confirm that G. tessmannii is an octoploid species.

Cross-amplification in congeneric species and ploidy determination

Among the 17 loci selected from G. tessmannii, a majority successfully amplified in two other species from the subgenus Pseudocopaiva (Table 3). Less than six loci amplified in the other species, most of which belong to other subgenera (Table 3). In G. pellegriniana, all loci were polymorphic and the genotypes showed up to eight alleles per individual and locus, suggesting an octoploid genome. By contrast, in the other species individuals did not display more than two alleles per locus, suggesting diploid genomes.

Table 3.

Results of cross-amplification (allele size ranges) of microsatellite loci isolated from Guibourtia tessmannii and tested in nine additional taxa.

	Subg. Pseudocopaiva			Subg. Guibourtia			Subg. Gorskia
Species	G. pellegriniana (N = 14)	G. leonensis (N = 3)	G. coleosperma (N = 33)	G. carrissoana (N = 2)	G. copallifera (N = 7)	G. demeusei (N = 9)	G. arnoldiana (N = 2)	G. ehie (N = 20)	G. dinklagei (N = 1)
R12-Seq10	156–170	148–150	148–186	—	—	—	—	—	—
R12-Seq15	108–124	—	108–122	—	—	—	—	—	—
R12-Seq21	182–212	—	—	—	—	—	—	—	—
R12-Seq35	129–159	141–150	136–154	—	—	—	—	—	—
R12-Seq29	199–223	—	—	—	—	217	—	—	—
R12-Seq08	136–168	—	152–156	142–148	—	—	—	136–208	—
R12-Seq06	194–198	194	—	—	—	—	—	—	—
R12-Seq26	156–180	158–160	158*	—	—	158	—	138–198	—
R12-Seq34	150–174	150	150–160	150	—	—	—	150–174	154
R12-Seq16	226–250	202	224–266	236	226	228–252	232	232–252	—
R12-Seq09	200	—	168–170	—	—	—	—	—	—
R12-Seq20	205	—	203–223	—	203–205	203–207	—	—	—
R12-Seq22	169–173	—	168–172	—	164–172	162–166	—	—	—
R12-Seq01	205–231	—	—	—	—	—	—	—	—
R12-Seq25	180–190	—	—	—	—	—	—	180–192	—
R12-Seq31	221–231	—	—	—	—	—	—	—	—
R12-Seq43	143*	143*	—	—	—	—	—	143*	—

Monomorphic locus.

CONCLUSIONS

We developed 16 polymorphic microsatellite markers in G. tessmannii that amplified to varying degrees in nine congeneric species. The microsatellites and flow cytometry results showed for the first time that the genus Guibourtia includes diploid and polyploid species. These markers will be useful to assess the mating system and genetic structure of Guibourtia species.

Appendix 1.

Voucher and locality information for the samples used in this study.

Species	n	Voucher no.	Country	Latitude	Longitude
Guibourtia tessmannii (Harms) J. Léonardb	1	FT0001	Gabon	1.4286	11.5886
Guibourtia tessmanniic	3	FT0002, FT0635–FT0636	Cameroon	2.2236	10.3793
Guibourtia tessmanniic	4	FT0003, FT0800–FT0802	Gabon	−0.3802	12.5649
Guibourtia tessmanniid	35	FT0540–FT0545, FT0572–FT0600	Gabon	0.36	13.10
Guibourtia tessmanniid	58	FT0800–FT0849, FT0851–FT0856, FT0900–FT0902	Gabon	0.76	12.9
Guibourtia tessmanniid	38	FT0605–FT0636, OH4675, OH4679, OH4682, OH4683, OH4684, OH4685	Cameroon	2.37	10.63
Guibourtia pellegriniana J. Léonardd	14	FT0641–FT0654	Gabon	−2.53	9.77
Guibourtia coleosperma (Benth.) J. Léonardd	20	FT0698–FT0717	DRC	−10.48	22.45
Guibourtia coleospermad	13	FT0021–FT0024, FT0028–FT0031, FT0722–FT0726	Namibia	−18.05	19.62
Guibourtia leonensis J. Léonardd	3	BR0000013186371f, BR0000013186401f, BR0000013186388f	Liberia	7.66	−10.02
Guibourtia demeusei (Harms) J. Léonardd	9	FT0873–FT0879, OH3245, BR0000009459977f	DRC	−0.88	18.12
Guibourtia ehie (A. Chev.) J. Léonardd	10	FT0335–FT0344	Ivory Coast	6,28	−3,68
Guibourtia ehied	10	FT0163–FT0172	Ghana	7,02	−2,05
Guibourtia carrissoana (M. A. Exell) J. Léonardd	2	BR0000013186210f, BR0000013186418f	Angola	−8.83	13.25
Guibourtia copallifera Benn.d	7	FT0880–FT0886	Burkina-Faso	9.95	−4.67
Guibourtia arnoldiana (De Wild. & T. Durand) J. Léonardd	2	FT0638, GID2040	Gabon	−3.4098	11.4185
Guibourtia dinklagei (Harms) J. Léonardd	1	BR0000013186265f	Liberia	6.23084	−9.81249
Guibourtia tessmanniie	3	FT0007, FT006, FT008	Gabon	−0.42	12.58
Guibourtia coleospermae	3	FT0020, FT0024, FT0028	Namibia	−17.99	24.09

Note: DRC = Democratic Republic of Congo; n = number of individuals.

Vouchers are deposited at the Herbarium of the Université Libre de Bruxelles, Belgium (BRLU), silica gel collection of Dr. Olivier Hardy.

Individual used for DNA bank.

Individual used for tests of amplification and polymorphism.

Individuals used for cross-amplification.

Individuals used for flow cytometry (code for the mother tree).

Codes of specimens from which samples were collected in Botanic Garden Meise (BR), Belgium.