Literature DB >> 28791206

Characterization of microsatellite markers in the African tropical tree species Guibourtia ehie (Fabaceae, Detarioideae).

Félicien Tosso1,2, Jean-Louis Doucet1, Jérémy Migliore2, Kasso Daïnou1,3,4,5, Esra Kaymak2, Franck S Monthe Kameni2, Olivier J Hardy2.   

Abstract

PREMISE OF THE STUDY: Microsatellite primers (simple sequence repeats [SSRs]) were developed in Guibourtia ehie (Fabaceae, Detarioideae) to study population genetic structure and the history of African vegetation. METHODS AND
RESULTS: We isolated 18 polymorphic SSRs from a nonenriched genomic library. This set of primer pairs was tested on four populations, and the results showed two to 16 alleles per locus with mean observed and expected heterozygosities of 0.27 ± 0.05 and 0.57 ± 0.05, respectively. Cross-amplification tests in 13 congeneric species were successful for the four taxa belonging to the subgenus Gorskia.
CONCLUSIONS: This set of microsatellite markers will be useful to investigate the phylogeography and population genetics of G. ehie, a key representative of African semideciduous moist forests.

Entities:  

Keywords:  Fabaceae; Guibourtia ehie; microsatellites; next-generation sequencing

Year:  2017        PMID: 28791206      PMCID: PMC5546166          DOI: 10.3732/apps.1700023

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Guibourtia ehie (A. Chev.) J. Léonard (Fabaceae, Detarioideae) is a timber species found in evergreen and semideciduous moist forests from Liberia to Gabon (Tosso et al., 2015). It is distributed on both sides of the Dahomey Gap, a portion of forest–savanna mosaic separating the Upper and Lower Guinean rainforest blocks (Salzmann and Hoelzmann, 2005). Guibourtia ehie is an insect-pollinated and wind-dispersed species (Tosso et al., 2015) exhibiting an abundant natural regeneration around the mother plant (Lemmens et al., 2008). Known as ovengkol in Gabon and amazakoué in Ivory Coast, it produces wood of high economic value. The major threat to this species (registered as vulnerable on the IUCN Red List) is logging, which causes local population declines (Hawthorne, 1995). Guibourtia ehie is therefore a good candidate to assess the impact of logging on gene flow (pollen and seed dispersal) and to study spatial genetic diversity issues before considering conservation plans. In addition, the wide spatial distribution of this species will likely be useful to better understand the history of African vegetation and the role of the Dahomey Gap in relation to successive past environmental changes. Because only a few of the microsatellites (simple sequence repeats [SSRs]) previously developed for G. tessmannii (Harms) J. Léonard (a central African species) cross-amplified in G. ehie (Tosso et al., 2016), we developed here a new set of polymorphic SSRs.

METHODS AND RESULTS

Development of microsatellites

To identify and characterize SSRs, total genomic DNA was extracted (from G. ehie dry leaf, voucher FT0272; Appendix 1) following the cetyltrimethylammonium bromide (CTAB) protocol described in Fu et al. (2005). We used the Illumina MiSeq platform (GIGA platform, Liège, Belgium; Illumina, San Diego, California, USA) to construct a nonenriched genomic DNA library following Mariac et al. (2014), generating 255,460 paired-end reads 145 ± 3 bp long, which were pair-assembled with PANDAseq (Masella et al., 2012). The software QDD with the default settings (Meglécz et al., 2014) was used to identify 3597 microsatellite loci following the three classical steps: (i) SSR detection, (ii) elimination of similar sequences, and (iii) primer design. Among the 3597 loci, we selected a subset of 64 loci according to the following criteria: (i) having at least eight di- or trinucleotide repeats, (ii) having primers located at least 20 bp from the SSR motif, and (iii) characterized by PCR products 130–300 bp long. To have a good distribution of loci sizes and to facilitate multiplexing in the next steps, we then selected 48 loci for amplification tests. Each locus was labeled with the fluorochromes FAM, NED, VIC, or PET by adding one of four possible linkers (Q1–Q4; Micheneau et al., 2011) to the 5′ end of the forward primer (Table 1).
Table 1.

Characteristics of 19 nuclear microsatellite markers developed for Guibourtia ehie.

LocusaPrimer sequences (5′–3′)Fluorescent labelbRepeat motifAllele size range (bp)GenBank accession no.
Multiplex 1
 GuiE-ssr39F: CACTGCTTAGAGCGATGCTCGGTTAGTGAAATGGTTGTTGQ3-VIC(AT)14132–156KY929303
R: ATTAGTTCCATGATCATTACTTCAAA
 GuiE-ssr34F: TAGGAGTGCAGCAAGCATGCATTGTTGGAATGATAAATTCACQ2-NED(AT)10152–180KY929300
R: GGATTCAACTATGAAAGGAAACA
 GuiE-ssr18F: TAGGAGTGCAGCAAGCATCAAGTGGGTTCATTGCGTTAQ2-NED(AG)14180–190KY929294
R: CGTTGGCTGTGAAGAGAAAGT
 GuiE-ssr05F: TGTAAAACGACGGCCAGTTGACCCAACATATAGAGCATGAGQ1-6-FAM(TC)9262–264KY929289
R: CCCTATGGGTGATTGTATGC
 GuiE-ssr33F: TGTAAAACGACGGCCAGTTTAAACCCTAAAGCACAATCAAAQ1-6-FAM(AG)11142–153KY929299
R: CCAAGGCATCCACATGAACTA
Multiplex 2
 GuiE-ssr36F: TAGGAGTGCAGCAAGCATCAAAGGACCTTCCTGCAACTQ2-NED(CT)13147–163KY929301
R: TCAAGTACGATCCTCAGAAATCTT
 GuiE-ssr03F: CTAGTTATTGCTCAGCGGTAATGAGGCAGCTTGCATTGQ4-PET(TG)13219–283KY929287
R: CGCTAATTAGTTGATACTATGCTCG
 GuiE-ssr02F: CACTGCTTAGAGCGATGCTTAGTAGCTGAATTTCTCATGCAAQ3-VIC(ATT)10262–294KY929286
R: CGCTAATTAGTTGATACTATGCTCG
 GuiE-ssr06F: CACTGCTTAGAGCGATGCCCTAAAGCCAAGTGATCCCAQ3-VIC(TA)14232–294KY929290
R: GAATTGAAGAATGAGATGCCAA
 GuiE-ssr31F: TGTAAAACGACGGCCAGTTTAAACCCTAAAGCACAATCAAAQ1-6-FAM(AG)11143–153KY929298
R: CCAAGGCATCCACATGAAC
Multiplex 3
 GuiE-ssr01F: TGTAAAACGACGGCCAGTCATGGATCACAAACCCGTTAQ1-6-FAM(AG)11308–316KY929285
R: GTGCTAAATTCCTATTTGGTCTTACTG
 GuiE-ssr04cF: CTAGTTATTGCTCAGCGGTAATGCCTAATGGGTAAAGCCQ4-PET(CAT)8267KY929288
R: TCCAAGTTTAGAACTTTAAATAGGTTG
 GuiE-ssr15F: CACTGCTTAGAGCGATGCTGGACTCAGATGATCCATTGTTQ3-VIC(CT)14200–230KY929293
R: TGCATACACTAGGAAGGAACGA
 GuiE-ssr21F: TGTAAAACGACGGCCAGTCCCACGAGTGAGAGTGAAGGQ1-6-FAM(TC)22141–189KY929295
R: TCACATTACCAGTCTTCCTTGTC
 GuiE-ssr38F: TAGGAGTGCAGCAAGCATTGTGCCAAAGATACTCCCAAQ2-NED(AG)10143–152KY929302
R: TGTGGTAGTCAAGCACCCAA
Multiplex 4
 GuiE-ssr08F: CTAGTTATTGCTCAGCGGTACATGGCTTCTGGTGACGTTQ4-PET(TA)21222–260KY929291
R: GAACGGCCTTACAAACGAAA
 GuiE-ssr11F: CTAGTTATTGCTCAGCGGTTTCTCACGTCTACTTTCAAATCATTGQ3-VIC(AT)14205–245KY929292
R: CAAATTGCCTGTTGGGTTCT
 GuiE-ssr28F: CTAGTTATTGCTCAGCGGTTTCTCACGTCTACTTTCAAATCATTGQ4-PET(TA)10159–167KY929296
R: AAACAAATTTAGTTAAAGGAAGAGGG
 GuiE-ssr30F: TAGGAGTGCAGCAAGCATATTGATTTCGACAAACACAACAQ2-NED(AG)14145–157KY929297
R: CTGAGATATCCTTTGCACATCG

Optimal annealing temperature was 57°C and 53°C, respectively, for PCR cycles 1 and 2.

The linkers (Q1, Q2, Q3, Q4) attached to the forward primers are underlined in the forward primer sequences.

Monomorphic locus.

Characteristics of 19 nuclear microsatellite markers developed for Guibourtia ehie. Optimal annealing temperature was 57°C and 53°C, respectively, for PCR cycles 1 and 2. The linkers (Q1, Q2, Q3, Q4) attached to the forward primers are underlined in the forward primer sequences. Monomorphic locus.

Microsatellite screening

Amplification tests of 48 primer pairs were performed using two individuals of G. ehie (FT0288 and FT0478; Appendix 1) in 15-μL PCR reactions with the following conditions: 1.5 μL of buffer (10×), 0.6 μL of MgCl2 (25 mM), 0.45 μL of dNTPs (10 mM each), 0.3 μL of each primer (0.2 μM), 0.08 μL of TopTaq DNA Polymerase (5 U/μL; QIAGEN, Venlo, The Netherlands), 1.5 μL of Coral Load, 1 μL of template DNA (of ca. 10–50 ng/μL), and 9.27 μL of water. PCR conditions were: 94°C (4 min); 30 cycles of 94°C (30 s), 57°C (45 s), and 72°C (1 min); and a final extension at 72°C (10 min). Amplification products stained with 9 μL of TE 1× were examined using the QIAxcel DNA Screening Kit (method AL420; alignment marker 15–5000 bp; size marker 100–2500 bp; QIAGEN). Thirty loci amplified the expected target fragments out of the 48 primer pairs selected for the initial trial. These 30 loci were further tested in eight individuals from Ghana and Cameroon (Appendix 1). PCR reactions were performed for each of the 30 loci in 15-μL total volumes: 0.15 μL of the reverse and 0.1 μL of the forward (0.2 μM for both) microsatellite primers, 0.15 μL of Q1–Q4 labeled primers (0.2 μM each), 7.5 μL of Type-it Microsatellite PCR Kit (QIAGEN), 3 μL of 5× Q-solution, 3.1 μL of H2O, and 1 μL of DNA. PCR conditions were: 5-min initial denaturation at 95°C; followed by 25 cycles of 95°C for 30 s, 57°C for 90 s, and 72°C for 1 min; 10 cycles of 94°C for 30 s, 53°C for 45 s, and 72°C for 60 s; and a final elongation step at 60°C for 30 min. All individuals were genotyped on an ABI3730 sequencer (Applied Biosystems, Lennik, The Netherlands) at the Department of Evolutionary Biology and Ecology, Université Libre de Bruxelles (Brussels, Belgium) using 1.1 μL of each PCR product, 12 μL of Hi-Di Formamide (Life Technologies, Carlsbad, California, USA), and 0.3 μL of MapMarker 500 labeled with DY-632 (Eurogentec, Seraing, Belgium). We selected 19 primer pairs exhibiting clear chromatograms with no ambiguity in allele size determination. Eighteen primer pairs were polymorphic, and one locus (GuiE-ssr04) was monomorphic. These loci were included in four multiplexed reactions (Table 1) using Multiplex Manager 1.0 software (Holleley and Geerts, 2009). To assess their polymorphism level, we genotyped between 15 and 23 individuals in each of four populations from Ghana, Ivory Coast, Liberia, and Cameroon, totaling 78 samples (Table 2, Appendix 1). We conducted multiplexed PCR reactions with the conditions as previously described, except that we readjusted the quantity of H2O to obtain a total volume of 15 μL.
Table 2.

Genetic characterization of 19 newly developed microsatellite markers in four populations of Guibourtia ehie.

Ghana (N = 20)Ivory Coast (N = 23)Cameroon (N = 15)Liberia (N = 20)
LocusAHoHeFbAHoHeFbAHoHeFbAHoHeFb
Multiplex 1
 GuiE-ssr3920.100.190.4720.040.330.8720.070.300.7870.650.770.16
 GuiE-ssr3430.450.660.3230.090.640.86***50.070.740.91***30.300.550.46**
 GuiE-ssr1830.000.681.00***30.390.750.4830.670.690.0320.050.500.90***
 GuiE-ssr0510.000.001.0010.000.231.0010.000.241.0020.050.140.65
 GuiE-ssr3310.000.001.0010.000.091.0010.000.001.0010.000.001.00
Multiplex 2
 GuiE-ssr3630.100.530.81***70.220.720.70***80.670.710.0740.100.380.74
 GuiE-ssr0330.500.47−0.0770.260.650.60**80.670.870.2330.100.410.75
 GuiE-ssr0250.150.490.69***20.000.541.00***00.000.001.0010.000.431.00
 GuiE-ssr0690.600.880.32***70.260.700.63**70.330.860.61***70.500.840.41
 GuiE-ssr3110.000.001.0030.090.440.80**10.000.001.0010.000.181.00
Multiplex 3
 GuiE-ssr0120.050.050.0010.000.431.0010.000.241.0010.000.261.00
 GuiE-ssr0410.000.001.0010.000.501.0010.000.241.0010.000.261.00
 GuiE-ssr1510.000.001.0020.000.511.0040.200.310.3520.000.191.00*
 GuiE-ssr2150.850.78−0.0980.480.860.4540.130.360.63*40.400.570.30
 GuiE-ssr3820.250.22−0.1120.260.650.6030.000.681.00***20.400.580.31
Multiplex 4
 GuiE-ssr08110.750.920.18*110.390.880.55***20.000.571.00**70.500.820.39
 GuiE-ssr1180.400.720.44***100.430.840.48100.270.880.69***30.200.720.72*
 GuiE-ssr2840.500.48−0.0330.260.680.6110.000.241.0020.450.670.33
 GuiE-ssr3030.650.660.0130.260.750.65**50.530.770.3140.450.770.41

Note: A = number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled.

Locality and voucher information are available in Appendix 1.

Significance of deviation from Hardy–Weinberg equilibrium: *P < 0.05; **P < 0.01; ***P < 0.001.

Genetic characterization of 19 newly developed microsatellite markers in four populations of Guibourtia ehie. Note: A = number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled. Locality and voucher information are available in Appendix 1. Significance of deviation from Hardy–Weinberg equilibrium: *P < 0.05; **P < 0.01; ***P < 0.001.

Data analysis

INEst 1.0 (Chybicki and Burczyk, 2009) was used to calculate the following indices on each of the four populations: number of alleles per locus, observed and expected heterozygosities, and inbreeding coefficient. We also tested deviation from Hardy–Weinberg equilibrium for each locus with SPAGeDi (Hardy and Vekemans, 2002). The mean number of alleles per locus among the four populations was seven (range 1–11). The observed heterozygosity (mean ± SE) was 0.28 ± 0.10 (range 0–0.85), 0.18 ± 0.17 (range 0–0.48), 0.19 ± 0.09 (range 0–0.67), and 0.22 ± 0.07 (range 0–0.65) for the Ghana, Ivory Coast, Cameroon, and Liberia populations, respectively. The expected heterozygosity was 0.41 ± 0.11 (range 0–0.92), 0.59 ± 0.07 (range 0–0.88), 0.46 ± 0.10 (range 0–0.88), and 0.48 ± 0.08 (range 0–0.84) for the Ghana, Ivory Coast, Cameroon, and Liberia populations, respectively. Significant deviation from Hardy–Weinberg equilibrium was observed for 13 loci at least in one population, in part due to the presence of null alleles (Table 2). All these SSR sequences have been deposited in GenBank (Table 1).

Cross-amplification in other Guibourtia species

We tested the 19 loci on 13 congeneric species using the PCR conditions described above. Three to eight of the 19 loci successfully amplified in four species from subgenus Gorskia J. Léonard (to which G. ehie belongs), whereas two to six amplified for subgenus Pseudocopaiva J. Léonard and two to three amplified for subgenus Guibourtia (Table 3). The locus GuiE-ssr15 amplified in all species. The limited transferability of G. ehie SSRs, which was also observed for G. tessmannii SSRs (Tosso et al., 2016), indicates a rather deep molecular divergence among Guibourtia species.
Table 3.

Cross-amplification results of 19 microsatellite markers isolated from Guibourtia ehie and tested in 13 congeneric species belonging to three Guibourtia subgenera.

LocusSubgenus GorskiaSubgenus PseudocopaivaSubgenus Guibourtia
G. arnoldiana (N = 3)G. schliebenii (N = 3)G. conjugata (N = 1)G. dinklagei (N = 1)G. tessmannii (N = 10)G. pellegriniana (N = 7)G. coleosperma (N = 6)G. leonensis (N = 1)G. hymenaefolia (N = 1)G. carrissoana (N = 2)G. copallifera (N = 5)G. demeusei (N = 6)G. sousae (N = 1)
Multiplex 1
 GuiE-ssr39122–136130154–156130130–136118118132
 GuiE-ssr34
 GuiE-ssr18180196–198
 GuiE-ssr05268–274248–266262–270
 GuiE-ssr33
Multiplex 2
 GuiE-ssr36153–155136–154148–172154–156144–156182–206
 GuiE-ssr03
 GuiE-ssr02278–280
 GuiE-ssr06200
 GuiE-ssr31
Multiplex 3
 GuiE-ssr01314266–272
 GuiE-ssr04
 GuiE-ssr15242200–266200210–224204194–206174–206204214208160208–240206
 GuiE-ssr21146148156–168141–146141144
 GuiE-ssr38
Multiplex 4
 GuiE-ssr08
 GuiE-ssr11174–182182182
 GuiE-ssr28
 GuiE-ssr30150–160157

Note: — = not applicable; N = number of individuals sampled.

Locality and voucher information are available in Appendix 1.

Cross-amplification results of 19 microsatellite markers isolated from Guibourtia ehie and tested in 13 congeneric species belonging to three Guibourtia subgenera. Note: — = not applicable; N = number of individuals sampled. Locality and voucher information are available in Appendix 1.

CONCLUSIONS

In this study, we developed 18 polymorphic microsatellite markers in G. ehie. These microsatellite markers will be useful to study intraspecific diversity and gene flow. They are also suitable to study the demographic history of G. ehie and provide insights into the past changes in African moist forest cover.
Appendix 1.

Voucher information for the Guibourtia samples used in this study.

SpeciesNVoucher no.CountryLatitudeLongitude
Guibourtia ehie (A. Chev.) J. Léonardb1FT0272Ghana7.09241−2.11953
Guibourtia ehiec1FT0288Ghana7.08999−2.11845
Guibourtia ehiec1FT0478Ivory Coast6.30892−5.28866
Guibourtia ehied5FT0497, FT0491, FT0515, FT0510, FT0521Ivory Coast6.21−3.41
Guibourtia ehied3FT0241, FT0261, FT0241Ghana7.07−2.08
Guibourtia ehied8OH4661–OH4668Cameroon2.319.96
Guibourtia ehied20FT0029, FT0038, FT0059, FT0078, FT0087, FT0095, FT0102, FT0104, FT0115, FT0125, FT0137, FT0146, FT0158, FT0163, FT0169, FT0180, FT0192, FT0192a, FT0193, FT0197Ghana7.06−2.08
Guibourtia ehied23FT0398–FT0400, FT0336, FT0355, FT0363, FT0373, FT0382, FT0384, FT0389, FT0411, FT0430, FT0465, FT0489, FT0491, FT0497, FT0498, FT0510, FT0515, FT0519, FT0521, FT0858, FT0859Ivory Coast6.21−2.42
Guibourtia ehied15FT0398, FT0336, FT0355, FT0363, FT0373, FT0382, FT0384, FT0389, FT0411, FT0430, FT0465, FT0489, FT0491, FT0497, FT0498, FT0510, FT0515, FT0519, FT0521, FT0858, FT0859Cameroon2.449.92
Guibourtia ehied20NB116, NB389, NB391, NB395, NB399, NB401, NB402, NB403, NB405, NB408, NB413, NB414, NB415, NB417, NB418, NB419, NB423, NB424, NB425, NB91Liberia7.56−8.64
Guibourtia arnoldiana (De Wild. & T. Durand) J. Léonarde3HB00527556Gabon−1.34659.7232
HB00253056Congo−4.512.23
GiD2040Gabon−3.409811.4185
Guibourtia schliebenii (Harms) J. Léonarde3B23-HB10151Mozambique−11.152939.7343
B50-HB3015138Mozambique−11.817540.34167
B51-HB6893814Mozambique−11.000539.7358
Guibourtia conjugata (Bolle) J. Léonarde1B33-HB3499528Mozambique−23.654832.1746
Guibourtia dinklagei (Harms) J. Léonarde1B21-HB11235Liberia6.279−10.7603
Guibourtia tessmannii (Harms) J. Léonarde10FT0607–FT0613, FT0635–FT0636Cameroon2.223610.3793
FT0001Gabon1.428611.5886
Guibourtia pellegriniana J. Léonarde7B11-HB1578Congo−1.944729.86578
FT0641–FT0646Gabon−2.539.77
Guibourtia coleosperma (Benth.) Léonarde6FT0021–FT0025, FT0028Namibia−17.8519.67
Guibourtia leonensis J. Léonarde1B45-HB3015140Sierra Leone8.9852−11.7169
Guibourtia hymenaefolia (Moric.) J. Léonarde1B44-HB252852Cuba22.1315−80.3382
Guibourtia carrissoana (M. A. Exell) J. Léonarde2B19-HB10458Angola−8.934113.1864
B20-HB11322Angola−8.83613.2593
Guibourtia copallifera Benn.e5FT0880–FT0884Burkina-Faso9.95−4.67
Guibourtia demeusei (Harms) J. Léonarde6FT0873–FT0875, OH3245Congo−0.883118.123
B15-HB0069Gabon−2.24879.5929
B38-HB527577DRC0.80724.4529
Guibourtia sousae J. Léonarde1B52-HB892206Mozambique−24.625433.9579

Note: DRC = Democratic Republic of the Congo; N = number of individuals.

Vouchers are deposited at the Herbarium of the Université Libre de Bruxelles, Brussels, Belgium (BRLU), silica gel collection of Dr. Olivier Hardy.

Individual used for genomic library.

Individuals used for amplification tests.

Individuals used for polymorphism tests.

Individuals used for cross-amplification tests.

  7 in total

1.  Development and characterization of microsatellite loci in Pericopsis elata (Fabaceae) using a cost-efficient approach.

Authors:  Claire Micheneau; Gilles Dauby; Nils Bourland; Jean-Louis Doucet; Olivier J Hardy
Journal:  Am J Bot       Date:  2011-09-16       Impact factor: 3.844

2.  Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR.

Authors:  Clare E Holleley; Paul G Geerts
Journal:  Biotechniques       Date:  2009-06       Impact factor: 1.993

3.  QDD version 3.1: a user-friendly computer program for microsatellite selection and primer design revisited: experimental validation of variables determining genotyping success rate.

Authors:  Emese Meglécz; Nicolas Pech; André Gilles; Vincent Dubut; Pascal Hingamp; Aurélie Trilles; Rémi Grenier; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2014-05-26       Impact factor: 7.090

4.  Simultaneous estimation of null alleles and inbreeding coefficients.

Authors:  Igor J Chybicki; Jaroslaw Burczyk
Journal:  J Hered       Date:  2008-10-20       Impact factor: 2.645

5.  Cost-effective enrichment hybridization capture of chloroplast genomes at deep multiplexing levels for population genetics and phylogeography studies.

Authors:  Cédric Mariac; Nora Scarcelli; Juliette Pouzadou; Adeline Barnaud; Claire Billot; Adama Faye; Ayite Kougbeadjo; Vincent Maillol; Guillaume Martin; François Sabot; Sylvain Santoni; Yves Vigouroux; Thomas L P Couvreur
Journal:  Mol Ecol Resour       Date:  2014-04-23       Impact factor: 7.090

6.  PANDAseq: paired-end assembler for illumina sequences.

Authors:  Andre P Masella; Andrea K Bartram; Jakub M Truszkowski; Daniel G Brown; Josh D Neufeld
Journal:  BMC Bioinformatics       Date:  2012-02-14       Impact factor: 3.169

7.  Microsatellite development for the genus Guibourtia (Fabaceae, Caesalpinioideae) reveals diploid and polyploid species.

Authors:  Felicien Tosso; Jean-Louis Doucet; Esra Kaymak; Kasso Daïnou; Jérôme Duminil; Olivier J Hardy
Journal:  Appl Plant Sci       Date:  2016-07-13       Impact factor: 1.936

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.