| Literature DB >> 27437142 |
A A Kuznetsov1, N R Maksimova1, V S Kaimonov1, G N Alexandrov1, S A Smagulova1.
Abstract
Development of new methods for the diagnosis of point mutations is a pressing issue. We have developed a new approach to the design of graphene oxide-based test systems for the diagnosis of point mutations in native DNA. This new approach is based on the use of graphene oxide for the adsorption and quenching of fluorescently labeled primers in a post-amplification PCR mixture followed by detection of fluorescently labeled PCR products. It is possible to detect fluorescently labelled amplicons in the presence of an excess of primers in a PCR product solution due to the different affinities of single-stranded and double-stranded DNA molecules to graphene oxide, as well as the ability of graphene oxide to act as a quencher of the fluorophores adsorbed on its surface. The new approach was tested by designing a graphene oxide-based test system for the DNA diagnosis of the point mutation associated with the development of the 3M syndrome in Yakuts. The developed approach enables one to design graphene oxide-based test systems suitable for the diagnosis of any point mutations in native DNA.Entities:
Keywords: diagnosis; graphene oxide; point mutations; test system
Year: 2016 PMID: 27437142 PMCID: PMC4947991
Source DB: PubMed Journal: Acta Naturae ISSN: 2075-8251 Impact factor: 1.845
Primers for real-time PCR analysis of the material obtained by chromatin immunoprecipitation
| Designation | Primer type | Nucleotide sequence, 5’–3’ |
|---|---|---|
| R | Reverse | GATGAGGCAGTTCAGAAGATTCC |
| F-FAM | FAM-labeled forward | FAM-CAGGGGTCCTCAAGATTTCG |
| F-ROX | ROX-labeled forward | ROX-CAGGGGTCCTCAAGATTCG |