| Literature DB >> 27391785 |
Dan-Dan Guo1, Fei Liu1, Yan-Hua Tu1, Bei-Xuan He1, Yue Gao1, Mei-Li Guo1.
Abstract
Safflower (Carthamus tinctorius L.) has received a significant amount of attention as a medicinal plant in China. Flavonoids are the dominant active medical compounds. UDP-glycosyltransferase plays an essential role in the biosynthesis and storage of flavonoids in safflower. In this study, 45 UGT unigenes were screened from our transcriptomic database of safflower. Among them, 27 UGT unigenes were predicted to own a complete open reading frame with various pI and Mw. The phylogenetic tree showed that CtUGT3 and CtUGT16 were classified under the UGT71 subfamily involved in metabolite process, whereas CtUGT25 has high identities with PoUGT both catalyzing the glycosylation of flavonoids and belonging to the UGT90 subfamily. cDNA microarray exhibited that the three UGT genes displayed temporal difference in two chemotype safflower lines. To functionally characterize UGT in safflower, CtUGT3, CtUGT16 and CtUGT25 were cloned and analyzed. Subcellular localization suggested that the three UGTs might be located in the cell cytoplasm and chloroplast. The expression pattern showed that the three UGTs were all suppressed in two lines responsive to methyl jasmonate induction. The co-expression relation of expression pattern and metabolite accumulation demonstrated that CtUGT3 and CtUGT25 were positively related to kaempferol-3-O-β-D-glucoside and CtUGT16 was positively related to quercetin-3-O-β-D-glucoside in yellow line, whereas CtUGT3 and CtUGT25 were positively related to quercetin-3-O-β-D-glucoside in white line. This study indicates that the three CtUGTs play a significant and multiple role in flavonoids biosynthesis with presenting different functional characterization in two safflower lines.Entities:
Mesh:
Substances:
Year: 2016 PMID: 27391785 PMCID: PMC4938162 DOI: 10.1371/journal.pone.0158159
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Primer of UGTs.
| Gene name | Primer sequence |
|---|---|
| CTTGTCGACTAGTTCCATGAAATCG | |
| AAGAGCCCATGGAGGAGAAAGTAG | |
| AAGCGGCCGCTTGATGAGATGTTC | |
| AATCCATGGCCCATGACTTCTTTCG | |
| TCTAGCCATGGCTTCCCTCACCTCATT | |
| ATAGGATTCTTCGATTCTTAGGAGGTGTA | |
| CCAAGAGACCATCAGACAA | |
| GGCACAGTTCCAATACCA | |
| GGAAGAGGAGTATGATGA | |
| AATGGCAGTTGAGATTAC | |
| CTACACCAACCTCAATCG | |
| AGTCACATCCACATTCAAG |
Identification of UGT genes in safflower by transcriptome sequencing.
| Gene name | unigene | CDS(bp) | ORF(aa) | PI | Mw(KDa) |
|---|---|---|---|---|---|
| Contig837 | 1416 | 471 | 5.51 | 51.99 | |
| Contig1071 | 783 | 260 | 6.6 | 29.16 | |
| Contig1097 | 1410 | 469 | 5.31 | 52.95 | |
| Contig1841 | 1368 | 455 | 6.34 | 51.20 | |
| Contig2153 | 729 | 242 | 5.3 | 26.76 | |
| Contig2267 | 267 | 88 | 5.47 | 10.20 | |
| Contig2457 | 741 | 246 | 5.33 | 26.80 | |
| Contig2737 | 1053 | 350 | 7.18 | 40.41 | |
| Contig2789 | 300 | 99 | 5.21 | 10.84 | |
| Contig2794 | 1380 | 459 | 5.91 | 51.39 | |
| Contig3171 | 798 | 265 | 4.97 | 29.53 | |
| Contig3742 | 696 | 231 | 7.06 | 26.72 | |
| Contig3776 | 1071 | 356 | 5.95 | 39.46 | |
| Contig3800 | 1440 | 479 | 5.55 | 53.72 | |
| Contig3889 | 234 | 77 | 7.85 | 8.51 | |
| A09-CS0907125834-R044-9-M13F(-20).ab1 | 1194 | 397 | 4.92 | 43.96 | |
| B05.CS090410701_7179.A2-80.M13F(-20).ab1 | 399 | 132 | 6.13 | 15.29 | |
| B11.CS090904_3135.S005-23.M13F(-20).ab1 | 690 | 229 | 6.05 | 25.79 | |
| B12-CS0909027-6681-R117-24-M13F(-20).ab1 | 270 | 89 | 9.9 | 9.93 | |
| CS090410709_3045.A4-46.M13F(-20)_E03.ab1 | 405 | 134 | 8.61 | 14.87 | |
| CS090415301_3195.A9-96.M13F(-20)_A01.ab1 | 309 | 102 | 5.42 | 11.37 | |
| CS090423305_3594.E4-95.M13F(-20)_A02.ab1 | 309 | 102 | 4.95 | 11.36 | |
| CS090519307_3752.L4-53.M13F_D08.ab1 | 642 | 213 | 4.9 | 24.03 | |
| CS090523704_7446.Q3-47.M13F_E02.ab1 | 195 | 64 | 9.35 | 7.35 | |
| D07-CS090907_6447-R58-043-M13F(-20).ab1 | 1497 | 498 | 5.84 | 56.01 | |
| G12.CS090410702_7212.A3-13.M13F(-20).ab1 | 159 | 52 | 6.57 | 5.95 | |
| H12-CS091005-6779-R169-96-M13F(-20).ab1 | 291 | 96 | 7.86 | 11.19 |
The full set of correlation coefficients between UGTs and flavone glycoside compounds.
| Pearson r | ||||||
|---|---|---|---|---|---|---|
| -0.6069 | 0.4374 | 0.3254 | ||||
| -0.5391 | 0.0350 | -0.2581 | ||||
| -0.5195 | -0.0665 | -0.3455 | ||||
| 0.8776 | -0.1470 | 0.6010 | ||||
| -0.2942 | 0.4945 | -0.1451 | ||||
| -0.1252 | -0.9595 | -0.3905 | ||||
| 0.2612 | 0.6969 | -0.4436 | ||||
| 0.0906 | 0.6000 | -0.4254 | ||||
| -0.6706 | -0.9258 | 0.1845 | ||||
| -0.8777 | -0.9899 | -0.7643 | ||||
| -0.4260 | -0.6677 | -0.1617 | ||||
| 0.5751 | 0.6168 | 0.1300 | ||||
| 0.8065 | 0.5452 | 0.6891 | ||||
| -0.3723 | -0.6639 | -0.2323 | ||||
| 0.9425 | 0.8307 | 0.9654 | ||||
| 0.8765 | 0.6988 | 0.9189 | ||||
| 0.9971 | 0.9508 | 0.8468 | ||||
| 0.5927 | 0.3256 | 0.7288 |