Literature DB >> 27350816

An active alternative splicing isoform of human mitochondrial 8-oxoguanine DNA glycosylase (OGG1).

Chie Furihata1.   

Abstract

Eight alternatively spliced isoforms of human 8-oxoguanine DNA glycosylase (OGG1) (OGG1-1a, -1b, -1c, -2a, -2b, -2c, -2d and -2e) are registered at the National Center for Biotechnology Information (NCBI). OGG1-1a is present in the nucleus, whereas the other seven isoforms are present in the mitochondria. Recombinant OGG1-1a has been purified and enzyme kinetics determined. OGG1(s) in mitochondria have not been fully characterized biochemically until recently. The major mitochondrial OGG1 isoform, OGG1-2a (also named β-OGG1), has also been expressed and purified; however, its activity is unresolved. Recently, we purified recombinant mitochondrial OGG1-1b and found that it was an active OGG1 enzyme. We reported its enzyme kinetics and compared the results with those of OGG1-1a. The reaction rate constant of OGG1-1b 8-oxoG glycosylase activity (k g) was 8-oxoG:C > > 8-oxoG:T > > 8-oxoG:G > 8-oxoG:A and was similar to that of OGG1-1a under single-turnover conditions ([E] > [S]). Both OGG1-1b and OGG1-1a showed high specificity towards 8-oxoG:C. The reaction rate constant of OGG1-1b N-glycosylase/DNA lyase activity (k gl) was 8-oxoG:C > 8-oxoG:T ≃ 8-oxoG:G > > 8-oxoG:A and that of OGG1-1a was 8-oxoG:C > 8-oxoG:T, 8-oxoG:G and 8-oxoG:A. The k gl of OGG1-1b and OGG1-1a is one order of magnitude lower than the corresponding k g value. OGG1-1b showed an especially low k gl towards 8-oxoG:A. Comparable expression of OGG1-1a and OGG1-1b was detected by RT-PCR in normal human lung tissue and lung cell lines. These results suggest that OGG1-1b is associated with 8-oxoG cleavage in human lung mitochondria and that the mechanism of this repair is similar to that of nuclear OGG1-1a. Currently, the other five mitochondrial OGG1 isoforms have not been isolated. I summarize information on OGG1 isoform mRNAs, coding DNA sequences and amino acid sequences that are archived by the National Center for Biotechnology Information.

Entities:  

Keywords:  Human 8-oxoguanine DNA glycosylase; Mitochondrial OGG1; OGG1; OGG1-1a; OGG1-1b; OGG1-2a

Year:  2015        PMID: 27350816      PMCID: PMC4917946          DOI: 10.1186/s41021-015-0021-9

Source DB:  PubMed          Journal:  Genes Environ        ISSN: 1880-7046


Introduction

According to the National Center for Biotechnology Information (NCBI), the human 8-oxoguanine DNA glycosylase (OGG1) gene encodes the enzyme responsible for the excision of 8-oxoguanine (8-oxoG), a mutagenic base byproduct that occurs as a result of exposure to reactive oxygen (http://www.ncbi.nlm.nih.gov/gene/4968). 8-oxoG was first described in 1984 by Kasai et al. [1] and is an abundant DNA adduct caused by oxidative stress [2]. The action of OGG1 includes lyase activity for chain cleavage. In 1997 Aburatani et al. described four isoforms (OGG1-1a, −1b, −1c and −2) [3], and then in 1999, Nishioka et al. described seven isoforms (−1a, −1b, −2a, −2b, −2c, −2d and −2e) [4]. They classified these isoforms into two groups based on their last exon: type 1 isoforms end with exon 7 and type 2 isoforms end with exon 8. At present, their type 1 nomenclature cannot be applied to OGG1-1b because it contains only exons 1–6 (NCBI: NM_016819). Now, type 1 and type 2 OGG1s can be grouped with or without exon 8. Eight alternatively spliced isoforms of OGG1 (OGG1-1a, −1b, −1c, −2a, −2b, −2c, −2d and −2e) are registered in the NCBI gene and nucleotide database. OGG1-1a is the only OGG1 present in the nucleus [4], whereas the other seven isoforms have been shown to be present in mitochondria [3-5]. Recombinant OGG1-1a has been purified and its enzyme kinetics determined [6-8]. Although mitochondrial OGG1 was suggested to have a crucial role against mitochondrial DNA damage [9], the responsible OGG1 splicing isoform(s) have not been described in detail. Recombinant production of the mitochondrial major OGG1 isoform, OGG1-2a (also named β-OGG1), has been carried out; however, the activity of this OGG1 was very low [9] or un-detectable [10]. Recently, we purified recombinant mitochondrial OGG1-1b and showed that it was an active OGG1 enzyme; we determined its enzyme kinetics, and compared these results with those of OGG1-1a [11]. Similar 8-oxoG glycosylase activity and N-glycosylase/DNA lyase activity was detected except for kgl (N-glycosylase/DNA lyase activity) against 8-oxoG:A. Currently, the other five mitochondrial OGG1 isoforms have not been purified. A review of all eight alternatively spliced isoforms has not been published; therefore, in this review I present the published data on mainly mitochondrial OGG1 isoforms and summarize the information on eight alternative splicing isoforms archived by the NCBI.

OGG1-1b

Human OGG1-1b was cloned as an alternatively spliced isoform of OGG1 by Abratani et al. in 1997 [3] and confirmed by Nishioka et al. [4]. They proposed that the OGG1-1b mRNA contained an extra 244 bp from intron 6 and the same exon 7 compared with the OGG1-1a mRNA. However, OGG1-1b mRNA is currently described in NCBI (NM_016819) as composed of 6 exons (exons 1–6) and does not possess exons 7 and 8. Localization of the OGG1-1b protein in mitochondria was published by Takao et al. [5]. They showed localization of a FLAG-tagged OGG1-1b in the mitochondria of COS-7 cells by immunofluorescence staining. The expression of OGG1-1b was demonstrated by RT-PCR in several human tissues, including lung [11, 12], colon [3], cerebrum [4], kidney [4], fetal brain [4], peripheral blood lymphocytes [13], and in human cell lines including normal-derived lung cell MRC-9, lung cancer cell lines, H23, H69, Lu65, Lu135, PC10 and PC13 [12], A549, ABC-1, EBC-1, LK-2, LU99 and RERF-LC-MA [11], Jurkat cells (a human T-cell leukemia cell line) [4], and an immortalized line of T-lymphocyte cells [14]. Recently, we purified recombinant OGG1-1b and OGG1-1a using commercial human lung total RNA as the starting material, and showed that OGG1-1b was an active OGG1 enzyme. We compared the enzyme kinetics of mitochondrial OGG1-1b with the nuclear OGG1-1a protein [11], as described in the next section.

Comparison of enzyme kinetics between OGG1-1b and OGG1-1a

The reaction rate constants for 8-oxoG glycosylase activity (kg) and N-glycosylase/AP activity (kgl) were determined under single-turnover conditions ([E] > [S]) of OGG1-1a and OGG1-1b with 100 nM enzyme and 20 nM substrate [11]. Alexa 555-labeled 36-mer oligonucleotide substrates (8OG_36_Alexa: [Alexa 555]GGAATTCCTCGAGGT[8-oxoG]GACGGTATCCGATGGCCGCT, c-16C: AGCGGCCATCGGATACCGTCCACCTCGAGGAATTCC, c-16A: AGCGGCCATCGGATACCGTCAACCTCGAGGAATTCC, c-16G: AGCGGCCATCGGATACCGTCGACCTCGAGGAATTCC and c-16 T: AGCGGCCATCGGATACCGTCTACCTCGAGGAATTCC) were used. The kg of the 8-oxoG glycosylase activity of both OGG1-1b and OGG1-1a was 8-oxoG:C > > 8-oxoG:T > > 8-oxoG:G > 8-oxoG:A (7.96, 0.805, 0.070, and 0.015 min−1, respectively for OGG1-1b, and 7.21, 1.37, 0.125, and 0.031 min−1, respectively for OGG1-1a). The enzymes show similar kinetic values. Both OGG1-1b and OGG1-1a showed high specificity towards 8-oxoG:C. The kgl of OGG1-1b N-glycosylase/DNA lyase activity was 8-oxoG:C > 8-oxoG:T ≃ 8-oxoG:G > > 8-oxoG:A (0.286, 0.079, 0.040, and ~0.00 min−1, respectively) and that of OGG1-1a was 8-oxoG:C > 8-oxoG:T, 8-oxoG:G and 8-oxoG:A (0.254, 0.083, 0.075, and 0.072 min−1, respectively). The reaction rate constant of kgl of OGG1-1b and OGG1-1a was one order of magnitude lower than that of their kg values. OGG1-1b showed a particularly small kgl towards 8-oxoG:A, and an exact numerical value of kgl for OGG1-1b could not be calculated from the experimental conditions employed [11]. Similar multiple-turnover kinetics data (A0, kobs and kss) under [S] > [E] for OGG1-1b and OGG1-1a against the 8-oxoG:C substrate were observed. Similar substrate specificity of OGG1-1b and OGG1-1a against 8-oxoG:C and 8-oxoG:A was observed. Product formation was higher against 8-oxoG:C than 8-oxoG:A for OGG1-1b and OGG1-1a. APEX nuclease 1 (APEX1; NM_001641) was required to promote DNA strand breakage by OGG1-1b. These results suggest that OGG1-1b is associated with 8-oxoG cleavage in human lung mitochondria and that the mechanism of this repair is similar to that of nuclear OGG1-1a.

Active site amino acids

Various amino acids in the active site of OGG1-1a have been proposed, including, Gly-42, Asn-149, An-150, Lys-249, Cys-253, Asp-268, Gln-315, Phe-319 [6], His-270, Gln-315, Asp-322 [15], Arg-154, Val-317, Phe-319 [10], Arg-46, Arg-131, and Arg-154 [16]. Hashiguchi et al. compared glycosylase activity of OGG1-1a and OGG1-2a by site-directed mutagenesis and suggested that Val-317 is a critical residue for glycosylase activity [10]. OGG1-1b protein is identical to OGG1-1a protein from amino acid 1 to 317, including Val-317, and is an active OGG1 [11] despite not possessing Phe-319 and Asp-322. OGG1-2a protein is identical to OGG1-1a protein from amino acid 1 to 316 but does not possess Val-317, Phe-319, or Asp-322 and its enzyme activity is low [9] or not detectable [10]. These results suggest that Val-317 is a critical residue for glycosylase activity. Other OGG1 isoforms have not been purified and their enzyme activities have not been determined.

OGG1-2a

Human OGG1-2 (now OGG1-2a) was cloned as an alternatively spliced isoform of OGG1 in 1997 by Abratani et al. [3] and Roldán-Arjona et al. [9]. Localization of OGG1-2a protein in mitochondria was demonstrated in COS-7 cells [4] and HeLa MR cells [3]. In addition, the expression of OGG1-2a was demonstrated by northern blot analysis and by RT-PCR in various tissues [3]. Inconsistent findings regarding OGG1-2a protein have been published. Hashiguchi et al. [10] purified recombinant OGG1-2a (β-OGG1) and reported that OGG1-2a did not show any significant OGG1 activity in vitro. They examined OGG1 activity with 100 nM OGG1-2a and 10 nM oligonucleotide as the substrate, and found no activity. In the control experiment, they examined 1 nM OGG1-1a and 10 nM oligonucleotide substrate and found active OGG1 activity. Roldán-Arjona et al. [9] reported the purification of recombinant OGG1-2a and showed OGG1 activity against 8-oxoG:C oligonucleotide with 1 μM enzyme and 5 nM substrate. The OGG1 activity of OGG1-2a in this experiment was very low, because they used an unusually high enzyme concentration. Recently, Su et al. suggested that OGG1-2a (written as β-OGG1) was an accessory factor in mitochondrial Complex I function and was related to mitochondrial base excision repair [17].

Other mitochondrial isoforms

OGG1-1c was cloned as an alternative splicing isoform of OGG1 in 1997 by Abratani et al. [3]. Expression of OGG1-1c was demonstrated by RT-PCR in some human tissues including the colon [3]. Localization was demonstrated by expressing epitope-tagged OGG1-1c in COS-7 cells [5]. The expression of OGG1-2b, −2c, −2d, and −2e was demonstrated by RT-PCR in a small number of human tissues including the cerebrum and kidney, and in the Jurkat cell line by Nishioka et al. [4]. These proteins have not been purified.

Analysis of information on the eight alternatively spliced isoforms of OGG1 archived with the NCBI

Table 1 summarizes the mRNA accession number, nucleotide (nt) length, position of the 5′-UTR, coding DNA sequence (CDS) and 3′-UTR, exons, position of exon 1, 2, 3, 4, 5, 6, 7, and 8 of the eight alternative splicing isoforms of OGG1, as derived from the gene and nucleotide database of the NCBI (http://www.ncbi.nlm.nih.gov/gene/4968). Table 2 summarizes alternative splicing isoforms of OGG1 CDS, nt length, identity to OGG1-1a CDS and identity to OGG1-2a CDS according to the NCBI and examined by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Table 3 summarizes the protein accession number, amino acid length, identity to the OGG1-1a protein, identity to the OGG1-2a protein (as determined by BLAST), position of mitochondrial and nuclear localization signals, and OGG1 activity.
Table 1

Alternative splicing isoforms of OGG1mRNA according to NCBI

TypeNamemRNAnt bp5′-UTRCDS3′-UTRExonsExon 1Exon 2Exon 3Exon 4Exon 5Exon 6Exon 7Exon 8
accession
1OGG1-1aNM_00254216521–343344–13811382–16521,2,3,4,5,6,71–480481–728729–908909–10901091–12411242–1291 12921638 No
1OGG1-1bNM_01681918961–343344–13181319–18961,2,3,4,5,61–480481–728729–908909–10901091–1241 12421882 NoNo
1OGG1-1cNM_01682016691–343344–15761577–16691,2,3,4,5,6,71–480481–728729–908909–10901091–12411242–1291 12921655 No
2OGG1-2aNM_01682121581–343344–16181619–21581,2,3,4,5,6,81–480481–728729–908909–10901091–12411242–1291No1292–2152
2OGG1-2bNM_01682619571–343344–14171418–19571,2,3,4,81–480481–728729–908909–1090NoNoNo1091–1951
2OGG1-2cNM_01682717751–343344–931932–17751,2,3,81–480481–728729–908NoNoNoNo909–1769
2OGG1-2dNM_01682822581–343344–14141415–22581,2,3,4,5,6,7,81–480481–728729–908909–10901091–12411242–1291 12921391 1392–2252
2OGG1-2eNM_01682922111–343344–13121313–22111,2,3,4,5,6,7,81–480481–728729–908909–10901091–12411242–1291 12921344 1345–2205

Bold columns show differences among isoforms

Table 2

Alternative splicing isoforms of OGG1 CDS to NCBI

TypeNamemRNACDS
CDS in mRNAFrom exon 1From exon 2From exon 3From exon 4From exon 5From exon 6From exon 7From exon 8nt length in CDSidentical to OGG1-1a CDSIdentical to OGG1-2a CDS
1OGG1-1a344-1381344-480481-728729-908909-10901091-12411242-1291 1292-1381 No10381-949
1OGG1-1b344-1318344-480481-728729-908909-10901091-1241 1242-1318 NoNo9751-9511-949
1OGG1-1c344-1576344-480481-728729-908909-10901091-12411242-1291 1292-1576 No12331-948, 966–1055 -1c: 949-1038-1a1-948
2OGG1-2a344-1618344-480481-728729-908909-10901091-12411242-1291No 1292-1618 12751-949
2OGG1-2b344-1417344-480481-728729-908909-1090NoNoNo 1091-1417 10741-7481-748, 749–1074 -2c: 950–1275 -2a
2OGG1-2c344-931344-480481-728729-908NoNoNoNo 909-931 5881-5691-569
2OGG1-2d344-1414344-480481-728729-908909-10901091-12411242-1291 1292-1391 1392-1414 10711-9481-948
2OGG1-2e344-1312344-480481-728729-908909-10901091-12411242-1291 1292-1312 No9691-9491-949

Bold columns show differences among isoforms

Table 3

Protein products of OGG1 isoforms according to NCBI

TypeNameProtein accessionAmino acidsFrom exon 1From exon 2From exon 3From exon 4From exon 5From exon 6From exon 7From exon 8Identical to OGG1-1aIdentical to OGG1-2aMTSNLSOGG1 activity
1OGG1-1aNP_00253334546a 83a 60a 6051a 1629No1-3169 to 26335-341Active [6]
1OGG1-1bNP_05821232446a 83a 60a 6051a 24NoNo1-3171-3169 to 26NoActive [11]
1OGG1-1cNP_05821341046a 83a 60a 6051a 1694No1-3161-3169 to 26NoND
2OGG1-2aNP_05821442446a 83a 60a 6051a 16No108a 1-3169 to 26NoUnresolved [9, 10]
2OGG1-2bNP_05843435746a 83a 60a 60NoNoNo108a 1-2491-249, 250–357 -2b: 317–424 -2a9 to 26NoND
2OGG1-2cNP_05843619546a 83a 60a NoNoNoNo6b 1-1901-1909 to 26NoND
2OGG1-2dNP_05843735646a 83a 60a 6051a 1634a 6b 1-3161-3169 to 26NoND
2OGG1-2eNP_05843832246a 83a 60a 6051a 166No1-3161-3169 to 26NoND

Bold columns show differences among isoforms

Abbreviations: MTS mitochondrial localization signal, RRMGHRTLASTPALWASI, NLS nuclear localization signal, KRRKGSK., ND not determined

a indicates amino acids encoded cross a splice junction. b the same amino acid sequence. c the same amino aid sequence

Alternative splicing isoforms of OGG1mRNA according to NCBI Bold columns show differences among isoforms Alternative splicing isoforms of OGG1 CDS to NCBI Bold columns show differences among isoforms Protein products of OGG1 isoforms according to NCBI Bold columns show differences among isoforms Abbreviations: MTS mitochondrial localization signal, RRMGHRTLASTPALWASI, NLS nuclear localization signal, KRRKGSK., ND not determined a indicates amino acids encoded cross a splice junction. b the same amino acid sequence. c the same amino aid sequence The OGG1-1a mRNA has exons 1–7 and no exon 8. The CDS begins at nt 344 in exon 1, and the nt sequence of 1292–1381 (90 bp) in exon7 is the last part of the CDS. The OGG1-1a CDS is composed of part of exon 1, all of exons 2, 3, 4, 5, 6 and part of exon 7. Exon 6 is the last exon of OGG1-1b mRNA. The nt sequence 1242–1318 (77 bp) in exon 6 is the last part of the CDS. Although the nt sequence of 1536–1882 (347 bp) in exon 6 of the OGG1-1b mRNA is the same as the entire exon 7 of the OGG1-1a mRNA (nt sequence 1292–1638, 347 bp), the former represents part of the 3′-UTR. As for the OGG1-1b CDS, the nt sequence of 1242–1291 from exon 6 of the OGG1-1b mRNA is identical to the whole exon 6 CDS of the OGG1-1a mRNA. The OGG1-1b mRNA nt sequence of 1292–1294 is identical to the first part of the exon 7 CDS of the OGG1-1a mRNA. The OGG1-1b mRNA 1295–1318 sequence (24 bp), which encodes seven amino acids and the stop codon, differs from the 1295–1318 sequence (CDS) from exon 7 of the OGG1-1a mRNA, resulting in a different amino acid sequence for the last seven amino acids of OGG1-1b when compared with the OGG1-1a sequence. The OGG1-1c mRNA has exon 7, but the nt sequence of this exon is different from that of OGG1-1a mRNA. It also has no exon 8. The nt sequence 1292–1576 (285 bp) from exon 7 of the OGG1-1c mRNA is the last part of the CDS, but differs from the 1292–1381 CDS (90 bp) from exon 7 of the OGG1-1a mRNA. The nt sequence of 1309–1398 (90 bp) of the OGG1-1c mRNA, a part of the CDS from exon 7, is identical to 1292–1381 (90 bp) of the OGG1-1a mRNA, the entire exon 7 nt sequence. Only type 2 OGG1 mRNAs have exon 8. All type 2 OGG1 mRNAs have the same exon 8 nt sequence (861 bp). The OGG1-2a mRNA has no exon 7. The nt sequence 1292–1618 (327 bp) in exon 8 of the OGG1-2a mRNA is the last part of the CDS and the sequence 1619–2158 (540 bp) is the 3′ UTR. The OGG1-2b mRNA has no exons 5–7. The nt sequence 1091–1417 (327 bp) in exon 8 of the OGG1-2b mRNA is the last part of the CDS and is identical to the OGG1-2a CDS, resulting in an identical amino acid sequence for the last 108 amino acids of OGG1-2a and OGG1-2b. The OGG1-2c mRNA has no exons 4–7. The nucleotide sequence 909–931 (23 bp: the first two nucleotides cross a splice junction from exon 3, plus six amino acids and the stop codon) from exon 8 of the OGG1-2c mRNA is the last part of the CDS, resulting in a different amino acid sequence from that of OGG1-2a and OGG1-2b. The nt sequence 932–1775 (844 bp) is the 3′-UTR and has a different length to the 3′-UTRs from the OGG1-2a (540 bp) and OGG1-2b mRNAs (540 bp). The OGG1-2d mRNA has exons 7–8. The whole nt sequence of exon 7, 1292–1391 (100 bp), in the OGG1-2d mRNA is a CDS. The nucleotide sequence of 1392–1414 (23 bp: the first two nucleotides cross a splice junction from exon 7, plus six amino acids and the stop codon) from exon 8 of the OGG1-2d mRNA is the last part of the CDS, and gives rise to the same six amino acid sequence as that of the OGG1-2c protein. The nt sequence of 1415–2258 (844 bp) is the 3′-UTR. The OGG1-2e mRNA has exons 7 and 8. The nucleotide sequence 1292–1312 (21 bp for six amino acids and the stop codon) from the first part of exon 7 of the OGG1-2e mRNA is the last part of the OGG1-2e CDS, resulting in an amino acid sequence that differs from the exon 7 CDS of OGG1-1a, OGG1-1c, and OGG1-2d. The nt sequence 1313–1344 is a part of the 3′-UTR. Exon 8 (861 bp) of the OGG1-2e mRNA is a continuous 3′-UTR. The whole exon 7 nt sequence 1292–1344 (53 bp) of the OGG1-2e mRNA is identical to part of the nt sequence 1339–1391 (53 bp) in exon 7 of the OGG1-2d mRNA.

Conclusions

Eight alternatively spliced isoforms of human 8-oxoguanine DNA glycosylase (OGG1) are registered with the NCBI. OGG1-1a is present in the nucleus, whereas the other seven isoforms are present in mitochondria. Recombinant OGG1-1a has been purified and its enzyme kinetics studied. The mitochondrial major OGG1 isoform, OGG1-2a (also named β-OGG1), has been purified; however, the OGG1 activity of this enzyme was unusual and has not been determined. Recently, we purified recombinant mitochondrial OGG1-1b and showed that it is an active OGG1 enzyme. We reported its enzyme kinetics and compared the results with the corresponding kinetics of OGG1-1a. The OGG1 activity of OGG1-1b was similar to that of OGG1-1a, except for the kgl against 8-oxoG:A. The OGG1-1b mRNA was detected by RT-PCR in normal human lung tissue and lung cells lines. These results suggest that OGG1-1b is associated with 8-oxoG cleavage at least in human lung mitochondria, and the repair mechanism is similar to that of nuclear OGG1-1a. Currently, the other five mitochondrial OGG1 isoforms have not been purified.
  17 in total

1.  Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase.

Authors:  T Roldán-Arjona; Y F Wei; K C Carter; A Klungland; C Anselmino; R P Wang; M Augustus; T Lindahl
Journal:  Proc Natl Acad Sci U S A       Date:  1997-07-22       Impact factor: 11.205

2.  Reciprocal "flipping" underlies substrate recognition and catalytic activation by the human 8-oxo-guanine DNA glycosylase.

Authors:  Magnar Bjørås; Erling Seeberg; Luisa Luna; Laurence H Pearl; Tracey E Barrett
Journal:  J Mol Biol       Date:  2002-03-22       Impact factor: 5.469

3.  DNA damage processing by human 8-oxoguanine-DNA glycosylase mutants with the occluded active site.

Authors:  Maria V Lukina; Alexander V Popov; Vladimir V Koval; Yuri N Vorobjev; Olga S Fedorova; Dmitry O Zharkov
Journal:  J Biol Chem       Date:  2013-08-17       Impact factor: 5.157

4.  Excision of 8-oxoguanine from methylated CpG dinucleotides by human 8-oxoguanine DNA glycosylase.

Authors:  Rustem D Kasymov; Inga R Grin; Anton V Endutkin; Serge L Smirnov; Alexander A Ishchenko; Murat K Saparbaev; Dmitry O Zharkov
Journal:  FEBS Lett       Date:  2013-08-13       Impact factor: 4.124

5.  DNA repair activity of 8-oxoguanine DNA glycosylase 1 (OGG1) in human lymphocytes is not dependent on genetic polymorphism Ser326/Cys326.

Authors:  K Janssen; K Schlink; W Götte; B Hippler; B Kaina; F Oesch
Journal:  Mutat Res       Date:  2001-08-09       Impact factor: 2.433

6.  Expression and differential intracellular localization of two major forms of human 8-oxoguanine DNA glycosylase encoded by alternatively spliced OGG1 mRNAs.

Authors:  K Nishioka; T Ohtsubo; H Oda; T Fujiwara; D Kang; K Sugimachi; Y Nakabeppu
Journal:  Mol Biol Cell       Date:  1999-05       Impact factor: 4.138

7.  The C-terminal alphaO helix of human Ogg1 is essential for 8-oxoguanine DNA glycosylase activity: the mitochondrial beta-Ogg1 lacks this domain and does not have glycosylase activity.

Authors:  K Hashiguchi; J A Stuart; N C de Souza-Pinto; V A Bohr
Journal:  Nucleic Acids Res       Date:  2004-10-19       Impact factor: 16.971

8.  Genetic polymorphisms and alternative splicing of the hOGG1 gene, that is involved in the repair of 8-hydroxyguanine in damaged DNA.

Authors:  T Kohno; K Shinmura; M Tosaka; M Tani; S R Kim; H Sugimura; T Nohmi; H Kasai; J Yokota
Journal:  Oncogene       Date:  1998-06-25       Impact factor: 9.867

9.  The R46Q, R131Q and R154H polymorphs of human DNA glycosylase/beta-lyase hOgg1 severely distort the active site and DNA recognition site but do not cause unfolding.

Authors:  Peter C Anderson; Valerie Daggett
Journal:  J Am Chem Soc       Date:  2009-07-15       Impact factor: 15.419

10.  Mitochondrial targeting of human DNA glycosylases for repair of oxidative DNA damage.

Authors:  M Takao; H Aburatani; K Kobayashi; A Yasui
Journal:  Nucleic Acids Res       Date:  1998-06-15       Impact factor: 16.971

View more
  8 in total

Review 1.  DNA repair and systemic lupus erythematosus.

Authors:  Rithy Meas; Matthew J Burak; Joann B Sweasy
Journal:  DNA Repair (Amst)       Date:  2017-06-09

Review 2.  Alternative splicing isoforms in health and disease.

Authors:  Hyoung Kyu Kim; Michael Huy Cuong Pham; Kyung Soo Ko; Byoung Doo Rhee; Jin Han
Journal:  Pflugers Arch       Date:  2018-03-13       Impact factor: 3.657

3.  Fluorescence Imaging of Mitochondrial DNA Base Excision Repair Reveals Dynamics of Oxidative Stress Responses.

Authors:  Yong Woong Jun; Eddy Albarran; David L Wilson; Jun Ding; Eric T Kool
Journal:  Angew Chem Int Ed Engl       Date:  2021-12-22       Impact factor: 15.336

4.  Identification of microRNA-mRNA regulatory network associated with oxidative DNA damage in human astrocytes.

Authors:  Chukwumaobim Daniel Nwokwu; Adam Y Xiao; Lynn Harrison; Gergana G Nestorova
Journal:  ASN Neuro       Date:  2022 Jan-Dec       Impact factor: 5.200

Review 5.  Generation, repair and replication of guanine oxidation products.

Authors:  Katsuhito Kino; Masayo Hirao-Suzuki; Masayuki Morikawa; Akane Sakaga; Hiroshi Miyazawa
Journal:  Genes Environ       Date:  2017-08-01

6.  Emerging Role of Oxidative Stress on EGFR and OGG1-BER Cross-Regulation: Implications in Thyroid Physiopathology.

Authors:  Carmelo Moscatello; Maria Carmela Di Marcantonio; Luca Savino; Emira D'Amico; Giordano Spacco; Pasquale Simeone; Paola Lanuti; Raffaella Muraro; Gabriella Mincione; Roberto Cotellese; Gitana Maria Aceto
Journal:  Cells       Date:  2022-02-26       Impact factor: 6.600

7.  miR-200a Modulates the Expression of the DNA Repair Protein OGG1 Playing a Role in Aging of Primary Human Keratinocytes.

Authors:  Lavinia Tinaburri; Mariarosaria D'Errico; Sara Sileno; Riccardo Maurelli; Paolo Degan; Alessandra Magenta; Elena Dellambra
Journal:  Oxid Med Cell Longev       Date:  2018-03-25       Impact factor: 6.543

8.  The DNA Repair Protein OGG1 Protects Against Obesity by Altering Mitochondrial Energetics in White Adipose Tissue.

Authors:  Sai Santosh Babu Komakula; Jana Tumova; Deeptha Kumaraswamy; Natalie Burchat; Vladimir Vartanian; Hong Ye; Agnieszka Dobrzyn; R Stephen Lloyd; Harini Sampath
Journal:  Sci Rep       Date:  2018-10-05       Impact factor: 4.379

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.