Andrea Strakova1, Máire Ní Leathlobhair1, Guo-Dong Wang2, Ting-Ting Yin2, Ilona Airikkala-Otter3, Janice L Allen4, Karen M Allum5, Leontine Bansse-Issa6, Jocelyn L Bisson1, Artemio Castillo Domracheva7, Karina F de Castro8, Anne M Corrigan9, Hugh R Cran10, Jane T Crawford11, Stephen M Cutter4, Laura Delgadillo Keenan12, Edward M Donelan4, Ibikunle A Faramade13, Erika Flores Reynoso14, Eleni Fotopoulou15, Skye N Fruean16, Fanny Gallardo-Arrieta17, Olga Glebova18, Rodrigo F Häfelin Manrique19, Joaquim Jgp Henriques20, Natalia Ignatenko21, Debbie Koenig5, Marta Lanza-Perea9, Remo Lobetti22, Adriana M Lopez Quintana23, Thibault Losfelt24, Gabriele Marino25, Inigo Martincorena26, Simón Martínez Castañeda27, Mayra F Martínez-López28, Michael Meyer29, Berna Nakanwagi30, Andrigo B De Nardi8, Winifred Neunzig5, Sally J Nixon31, Marsden M Onsare32, Antonio Ortega-Pacheco33, Maria C Peleteiro34, Ruth J Pye31, John F Reece35, Jose Rojas Gutierrez36, Haleema Sadia37, Sheila K Schmeling38, Olga Shamanova39, Richard K Ssuna40, Audrey E Steenland-Smit6, Alla Svitich41, Ismail Thoya Ngoka42, Bogdan A Vițălaru43, Anna P de Vos44, Johan P de Vos45, Oliver Walkinton31, David C Wedge26, Alvaro S Wehrle-Martinez46, Mirjam G van der Wel47, Sophie Ae Widdowson40, Elizabeth P Murchison1. 1. Department of Veterinary Medicine, University of Cambridge, Cambridge, United Kingdom. 2. State Key Laboratory of Genetic Resources and Evolution, Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China. 3. International Training Center, Worldwide Veterinary Service, Aruvankadu, India. 4. Animal Management in Rural and Remote Indigenous Communities, Darwin, Australia. 5. World Vets, Fargo, United States. 6. Stichting Dierenbescherming Suriname, Paramaribo, Suriname. 7. Corozal Veterinary Hospital, University of Panama, Panama City, Panama. 8. Department of Clinical and Veterinary Surgery, São Paulo State University, São Paulo, Brazil. 9. St. George's University, True Blue, Grenada. 10. The Nakuru District Veterinary Scheme Ltd, Nakuru, Kenya. 11. Animal Medical Centre, Belize City, Belize. 12. Veterinary clinic Sr. Dog's, Guadalajara, Mexico. 13. National Veterinary Research Institute, Vom, Nigeria. 14. International Fund for Animal Welfare, Quintana Roo, Mexico. 15. Intermunicipal Stray Animals Care Centre, Perama, Greece. 16. Animal Protection Society of Samoa, Apia, Samoa. 17. Faculty of Veterinary Science, University of Zulia, Maracaibo, Venezuela. 18. Veterinary clinic BIOCONTROL, Moscow, Russia. 19. Veterinary clinic El Roble, Santiago de Chile, Chile. 20. OnevetGroup, Centro Veterinário Berna, Lisboa, Portugal. 21. Veterinary clinic Zoovetservis, Kiev, Ukraine. 22. Bryanston Veterinary Hospital, Bryanston, South Africa. 23. Veterinary Clinic Lopez Quintana, Maldonado, Uruguay. 24. Clinique Veterinaire de Grand Fond, Saint Gilles les Bains, France. 25. Department of Veterinary Sciences, University of Messina, Messina, Italy. 26. Wellcome Trust Sanger Institute, Hinxton, United Kingdom. 27. Facultad de Medicina Veterinaria y Zootecnia, Universidad Autónoma del Estado de México, Toluca, Mexico. 28. School of Veterinary Medicine, Universidad de las Américas, Quito, Ecuador. 29. Touray & Meyer Vet Clinic, Serrekunda, Gambia. 30. The Kampala Veterinary Surgery, Kampala, Uganda. 31. Vets Beyond Borders, The Rocks, Australia. 32. Aniworld veterinary clinic, Kisumu, Kenya. 33. Faculty of Veterinary Medicine, Autonomous University of Yucatan, Merida, Mexico. 34. Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine, University of Lisbon, Lisboa, Portugal. 35. Help in Suffering, Jaipur, India. 36. Veterinary clinic Dr José Rojas, Los Andes, Chile. 37. University of Veterinary and Animal Sciences, Lahore, Pakistan. 38. Corozal Veterinary Clinic, Corozal Town, Belize. 39. Veterinary clinic Vetmaster, Ramenskoye, Russia. 40. Lilongwe Society for Protection and Care of Animals, Lilongwe, Malawi. 41. State Hospital of Veterinary Medicine, Dniprodzerzhynsk, Ukraine. 42. Kenya Society for Protection and Care of Animals, Nairobi, Kenya. 43. Clinical Sciences Department, Faculty of Veterinary Medicine, Bucharest, Romania. 44. Ladybrand Animal Clinic, Ladybrand, South Africa. 45. Veterinary Oncology Referral Centre De Ottenhorst, Terneuzen, Netherlands. 46. Faculty of Veterinary Sciences, National University of Asuncion, San Lorenzo, Paraguay. 47. Animal Anti Cruelty League, Port Elizabeth, South Africa.
Abstract
Canine transmissible venereal tumour (CTVT) is a clonally transmissible cancer that originated approximately 11,000 years ago and affects dogs worldwide. Despite the clonal origin of the CTVT nuclear genome, CTVT mitochondrial genomes (mtDNAs) have been acquired by periodic capture from transient hosts. We sequenced 449 complete mtDNAs from a global population of CTVTs, and show that mtDNA horizontal transfer has occurred at least five times, delineating five tumour clades whose distributions track two millennia of dog global migration. Negative selection has operated to prevent accumulation of deleterious mutations in captured mtDNA, and recombination has caused occasional mtDNA re-assortment. These findings implicate functional mtDNA as a driver of CTVT global metastatic spread, further highlighting the important role of mtDNA in cancer evolution.
Canine transmissible venereal tumour (CTVT) is a clonally transmissible cancer that originated approximately 11,000 years ago and affects dogs worldwide. Despite the clonal origin of the CTVT nuclear genome, CTVT mitochondrial genomes (mtDNAs) have been acquired by periodic capture from transient hosts. We sequenced 449 complete mtDNAs from a global population of CTVTs, and show that mtDNA horizontal transfer has occurred at least five times, delineating five tumour clades whose distributions track two millennia of dog global migration. Negative selection has operated to prevent accumulation of deleterious mutations in captured mtDNA, and recombination has caused occasional mtDNA re-assortment. These findings implicate functional mtDNA as a driver of CTVT global metastatic spread, further highlighting the important role of mtDNA in cancer evolution.
Entities:
Keywords:
Dog; cancer biology; canine transmissible venereal tumour; evolutionary biology; genomics; mitochondria; transmissible cancer
The canine transmissible venereal tumour (CTVT) is a transmissible cancer that is contagious between dogs via the transfer of living cancer cells during coitus. The disease usually manifests as localised tumours involving the genital mucosa in both male and female domestic dogs. CTVT first arose from the somatic cells of an individual dog that lived approximately 11,000 years ago; it subsequently survived beyond the death of this original animal by metastasising to new hosts (Murgia et al., 2006; Rebbeck et al., 2009; Murchison et al., 2014; Decker et al., 2015). CTVT is found in dog populations worldwide, and is the oldest and most prolific cancer lineage known in nature (Murchison et al., 2014; Strakova and Murchison, 2014; Strakova and Murchison, 2015). The clonal evolution of CTVT renders this lineage a unique genetic tag with which to trace historical global dispersals of dogs together with their human companions. Furthermore, the extreme longevity of this lineage, its serial colonisation of genetically distinct allogeneic hosts and its occasional uptake of host mitochondrial DNA (mtDNA) by horizontal transfer (Rebbeck et al., 2011), provide opportunities to probe genetic vulnerabilities in cancer and to identify novel host-tumour interactions. We analysed 449 complete mtDNAs in CTVT and used these to investigate the frequency and timing of mtDNA horizontal transfer in this lineage; furthermore, we assessed the contribution of selection to CTVT mtDNA evolution and searched for evidence of mtDNA recombination.
Results and discussion
To investigate the global CTVT population structure and estimate the frequency and timing of mtDNA horizontal transfer, we performed low-coverage whole genome sequencing (~0.3X whole genome coverage) on 449 CTVT tumours and 338 matched hosts collected from 39 countries across six continents (Materials and methods) (Figure 1—figure supplement 1, Supplementary file 1). MtDNA was sequenced at ~70X coverage, indicating that each CTVT cell carries approximately 470 mtDNA copies (Figure 1—figure supplement 2, Supplementary file 2, Materials and methods). CTVT was confirmed by identification of a characteristic rearrangement involving a long interspersed nuclear element (LINE) near the MYC locus (Katzir et al., 1985; 1987) (Supplementary file 3).
Figure 1—figure supplement 1.
Geographical locations and mtDNA clades for CTVT tumours and hosts.
Each dot represents the location of (A) CTVT tumours, coloured by CTVT mtDNA clade; or (B) CTVT hosts, coloured by dog mtDNA clade.
DOI:
http://dx.doi.org/10.7554/eLife.14552.006
Figure 1—figure supplement 2.
mtDNA copy number in CTVT.
MtDNA copy number was estimated by normalising mtDNA sequence coverage to whole genome sequence coverage (Supplementary file 2A). Each point represents an individual tumour (labelled by clade) or host. MtDNA copy number in tumours was not normalised for host contamination. Host and tumour samples with average MT coverage >300X (see Supplementary file 2A) were excluded from the analysis and from calculation of average number of mtDNA copies per cell.
DOI:
http://dx.doi.org/10.7554/eLife.14552.007
We identified 1005 single point substitution variants and 27 short insertions and deletions (indels) in the CTVT mtDNA population (Supplementary files 4, 5, 6, 7, 12, 13). CTVT mtDNA somatic substitution mutations (see Materials and methods) had the characteristic profile that is observed in humancancers, dominated by C>T and T>C mutations showing a striking strand bias (Ju et al., 2014) (Figure 2—figure supplement 1). This mutational process is probably replication-coupled, and mutations associated with this process appear to accumulate at a roughly constant rate in humancancers (Ju et al., 2014). A maximum likelihood phylogenetic tree constructed with mtDNA sequences from CTVT, matched hosts and 252 additional dogs (see Supplementary file 8) revealed that CTVT mtDNAs cluster in five distinct groups within dog mtDNA haplogroup A1 (Figure 1A, Figure 1—figure supplement 3, Figure 1—source data 1). These data suggest that CTVT mtDNAs have at least five independent origins, demarcating five groups that we have named CTVT clades 1 to 5.
Figure 2—figure supplement 1.
CTVT mtDNA somatic mutation spectrum.
CTVT somatic mutations displayed by mutation type (in pyrimidine context) with 5’ and 3’ context and strand. Each of 96 mutation classes is displayed on the horizontal axis, with mutations occurring on the heavy strand displayed in red on the positive axis, and light strand mutations displayed in blue on the negative axis. The normalised substitution rate represents the (number of observed)/(number of expected) mutations, given mtDNA genome triplet content. Distinctive peaks are individually labelled. Only mutations on the 'conservative somatic list' were used (see Materials and methods and Supplementary file 4C).
DOI:
http://dx.doi.org/10.7554/eLife.14552.012
Figure 1.
CTVT has acquired mtDNA by horizontal transfer at least five times.
(A) Maximum likelihood phylogenetic tree constructed with complete mtDNA sequences from 449 CTVT tumours and 590 dogs. Coloured and black dots represent CTVT and dog mtDNA respectively. Scale bar indicates base substitutions per site. (B) Number of somatic substitution mutations per CTVT tumour. Coloured bars indicate somatic mutations acquired by each tumour since mtDNA capture. Grey bars indicate substitutions absent from normal dog mtDNA haplotypes but common to all tumours within a clade; thus the early somatic or rare germline status of these variants is unknown. (C) Geographical distribution of clades. Coloured dots represent locations from which one or more CTVT tumours were collected. (D) Simplified representation of maximum likelihood phylogenetic trees for each clade. Trees illustrate nodes with bootstrap support >60, and shaded triangles represent coalescence of individual branches within each group. Two tumours were collected in the United States and the Netherlands respectively from dogs imported from Guatemala and Romania. Discontinuous grey lines represent contributions of substitutions absent from normal dog mtDNA haplotypes but common to all tumours within a clade. Assuming a constant accumulation of mutations within and between clades, approximate number of somatic mutations and estimated timing is shown. Maximum likelihood trees upon which these representations are based are found in Figure 1—source data 2.
DOI:
http://dx.doi.org/10.7554/eLife.14552.003
Maximum likelihood phylogenetic tree constructed using 449 complete CTVT mitochondrial genomes and 590 complete dog mitochondrial genomes. All sequences are labelled with sample identifier, country, breed and haplotype name. The sample identifier for CTVT hosts is the sample name (Supplementary file 1), the sample identifier for the publicly available dogs is the accession number. Scale bar indicates base substitutions per site.
DOI:
http://dx.doi.org/10.7554/eLife.14552.004
Maximum likelihood phylogenetic trees for CTVT mtDNA in (A) clade 1 (n = 170) (B) clade 2 (n = 252) (C) clade 3 (n = 22) (D) clade 4 (n = 3) and (E) clade 5 (n = 2), rooted with haplotypes CTVT1 to CTVT5 respectively, which contain clade-defining germline and potential somatic substitutions specific to each clade (Figure 1—figure supplement 4). Bootstrap values were calculated from 100 bootstrap replicates and are shown where bootstrap values ≥60. Scale bars indicate base substitutions per site. Clade 5 contains only two tumours, which are identical both to each other and to the CTVT5 haplotype; thus the tree for this clade was created separately and does not have a scale bar.
DOI:
http://dx.doi.org/10.7554/eLife.14552.005
Each dot represents the location of (A) CTVT tumours, coloured by CTVT mtDNA clade; or (B) CTVT hosts, coloured by dog mtDNA clade.
DOI:
http://dx.doi.org/10.7554/eLife.14552.006
MtDNA copy number was estimated by normalising mtDNA sequence coverage to whole genome sequence coverage (Supplementary file 2A). Each point represents an individual tumour (labelled by clade) or host. MtDNA copy number in tumours was not normalised for host contamination. Host and tumour samples with average MT coverage >300X (see Supplementary file 2A) were excluded from the analysis and from calculation of average number of mtDNA copies per cell.
DOI:
http://dx.doi.org/10.7554/eLife.14552.007
Maximum likelihood phylogenetic tree constructed with complete mtDNA sequences from 449 CTVT tumours and 590 dogs. Coloured and black dots represent CTVT and dog mtDNA respectively (CTVT mtDNA clade colours are represented as in Figure 1A). Dog mtDNA clades A to E are labelled (Savolainen et al., 2002; Vila et al., 1997). Scale bar indicates base substitutions per site.
DOI:
http://dx.doi.org/10.7554/eLife.14552.008
Diagrams representing the likely donor haplotype for each of the CTVT mtDNA clades 1 to 5. The coordinates for each substitution variant position are shown, and substitutions are colour-coded either as 'germline' (i.e. they are present in all tumours within a clade and are found in the most closely related dog mtDNA haplotype, which is represented below each of the clade diagrams or they are found in the most closely related dog mtDNA haplotype only); or 'potential somatic' (i.e. they are present in all tumours within a clade but are not found in the most closely related dog mtDNA haplotype).
DOI:
http://dx.doi.org/10.7554/eLife.14552.009
Sequence read depth across the MT genome for a representative CTVT tumour (146T) and host (100H1) sequenced in this study to ~0.3X whole genome average coverage. This is compared with sequence read depth for simulated reads from CanFam3.1 (excluding the MT chromosome); reads were simulated to ~0.3X whole genome average coverage.
DOI:
http://dx.doi.org/10.7554/eLife.14552.010
Figure 1—figure supplement 3.
CTVT mtDNA clades 1 to 5 all arose from dog mtDNA clade A.
Maximum likelihood phylogenetic tree constructed with complete mtDNA sequences from 449 CTVT tumours and 590 dogs. Coloured and black dots represent CTVT and dog mtDNA respectively (CTVT mtDNA clade colours are represented as in Figure 1A). Dog mtDNA clades A to E are labelled (Savolainen et al., 2002; Vila et al., 1997). Scale bar indicates base substitutions per site.
DOI:
http://dx.doi.org/10.7554/eLife.14552.008
CTVT has acquired mtDNA by horizontal transfer at least five times.
(A) Maximum likelihood phylogenetic tree constructed with complete mtDNA sequences from 449 CTVT tumours and 590 dogs. Coloured and black dots represent CTVT and dog mtDNA respectively. Scale bar indicates base substitutions per site. (B) Number of somatic substitution mutations per CTVT tumour. Coloured bars indicate somatic mutations acquired by each tumour since mtDNA capture. Grey bars indicate substitutions absent from normal dog mtDNA haplotypes but common to all tumours within a clade; thus the early somatic or rare germline status of these variants is unknown. (C) Geographical distribution of clades. Coloured dots represent locations from which one or more CTVT tumours were collected. (D) Simplified representation of maximum likelihood phylogenetic trees for each clade. Trees illustrate nodes with bootstrap support >60, and shaded triangles represent coalescence of individual branches within each group. Two tumours were collected in the United States and the Netherlands respectively from dogs imported from Guatemala and Romania. Discontinuous grey lines represent contributions of substitutions absent from normal dog mtDNA haplotypes but common to all tumours within a clade. Assuming a constant accumulation of mutations within and between clades, approximate number of somatic mutations and estimated timing is shown. Maximum likelihood trees upon which these representations are based are found in Figure 1—source data 2.DOI:
http://dx.doi.org/10.7554/eLife.14552.003
Maximum likelihood phylogenetic tree of CTVT mtDNA.
Maximum likelihood phylogenetic tree constructed using 449 complete CTVT mitochondrial genomes and 590 complete dog mitochondrial genomes. All sequences are labelled with sample identifier, country, breed and haplotype name. The sample identifier for CTVT hosts is the sample name (Supplementary file 1), the sample identifier for the publicly available dogs is the accession number. Scale bar indicates base substitutions per site.DOI:
http://dx.doi.org/10.7554/eLife.14552.004
Maximum likelihood phylogenetic trees for CTVT clades 1 to 5.
Maximum likelihood phylogenetic trees for CTVT mtDNA in (A) clade 1 (n = 170) (B) clade 2 (n = 252) (C) clade 3 (n = 22) (D) clade 4 (n = 3) and (E) clade 5 (n = 2), rooted with haplotypes CTVT1 to CTVT5 respectively, which contain clade-defining germline and potential somatic substitutions specific to each clade (Figure 1—figure supplement 4). Bootstrap values were calculated from 100 bootstrap replicates and are shown where bootstrap values ≥60. Scale bars indicate base substitutions per site. Clade 5 contains only two tumours, which are identical both to each other and to the CTVT5 haplotype; thus the tree for this clade was created separately and does not have a scale bar.
Figure 1—figure supplement 4.
Reconstructed donor haplotypes for CTVT mtDNA clades 1 to 5.
Diagrams representing the likely donor haplotype for each of the CTVT mtDNA clades 1 to 5. The coordinates for each substitution variant position are shown, and substitutions are colour-coded either as 'germline' (i.e. they are present in all tumours within a clade and are found in the most closely related dog mtDNA haplotype, which is represented below each of the clade diagrams or they are found in the most closely related dog mtDNA haplotype only); or 'potential somatic' (i.e. they are present in all tumours within a clade but are not found in the most closely related dog mtDNA haplotype).
DOI:
http://dx.doi.org/10.7554/eLife.14552.009
DOI:
http://dx.doi.org/10.7554/eLife.14552.005
Geographical locations and mtDNA clades for CTVT tumours and hosts.
Each dot represents the location of (A) CTVT tumours, coloured by CTVT mtDNA clade; or (B) CTVT hosts, coloured by dog mtDNA clade.DOI:
http://dx.doi.org/10.7554/eLife.14552.006
mtDNA copy number in CTVT.
MtDNA copy number was estimated by normalising mtDNA sequence coverage to whole genome sequence coverage (Supplementary file 2A). Each point represents an individual tumour (labelled by clade) or host. MtDNA copy number in tumours was not normalised for host contamination. Host and tumour samples with average MT coverage >300X (see Supplementary file 2A) were excluded from the analysis and from calculation of average number of mtDNA copies per cell.DOI:
http://dx.doi.org/10.7554/eLife.14552.007
CTVT mtDNA clades 1 to 5 all arose from dog mtDNA clade A.
Maximum likelihood phylogenetic tree constructed with complete mtDNA sequences from 449 CTVT tumours and 590 dogs. Coloured and black dots represent CTVT and dog mtDNA respectively (CTVT mtDNA clade colours are represented as in Figure 1A). Dog mtDNA clades A to E are labelled (Savolainen et al., 2002; Vila et al., 1997). Scale bar indicates base substitutions per site.DOI:
http://dx.doi.org/10.7554/eLife.14552.008
Reconstructed donor haplotypes for CTVT mtDNA clades 1 to 5.
Diagrams representing the likely donor haplotype for each of the CTVT mtDNA clades 1 to 5. The coordinates for each substitution variant position are shown, and substitutions are colour-coded either as 'germline' (i.e. they are present in all tumours within a clade and are found in the most closely related dog mtDNA haplotype, which is represented below each of the clade diagrams or they are found in the most closely related dog mtDNA haplotype only); or 'potential somatic' (i.e. they are present in all tumours within a clade but are not found in the most closely related dog mtDNA haplotype).DOI:
http://dx.doi.org/10.7554/eLife.14552.009
Sequence contribution of nuclear-encoded mtDNA (NuMTs).
Sequence read depth across the MT genome for a representative CTVT tumour (146T) and host (100H1) sequenced in this study to ~0.3X whole genome average coverage. This is compared with sequence read depth for simulated reads from CanFam3.1 (excluding the MT chromosome); reads were simulated to ~0.3X whole genome average coverage.DOI:
http://dx.doi.org/10.7554/eLife.14552.010Although CTVT originated about 11,000 years ago, whole genome sequences of two CTVT tumours derived from clades 1 and 2 indicated that these two clades shared a common ancestor approximately 460 years ago (Murchison et al., 2014). We investigated the relative time since each CTVT mtDNA horizontal transfer event by estimating the number of mtDNA somatic mutations acquired by each clade since mtDNA capture (Figure 1B). This analysis revealed that clade 1 mtDNA carry more than double the number of mtDNA somatic mutations (22.5 mutations average) compared with clade 2 mtDNA (9.4 mutations average). By inferring that the clade 2 mtDNA horizontal transfer event occurred no more than 460 years ago, this analysis suggests a maximum time since mtDNA uptake of 1097 years for clade 1, 244 years for clade 3, 1690 years for clade 4 and 585 years for clade 5, assuming a constant somatic accumulation of mutations in CTVT mtDNA (Materials and methods). Importantly, two additional mutation rate estimates, derived using human data (Ju et al., 2014), suggested similar timing for CTVT clade origins (Materials and methods, Supplementary file 9). Thus, this analysis suggests that the original mtDNA, that was present in the founder dog that first spawned CTVT, is not detectable in tumours that we have analysed, and indicates that CTVT cells have captured mtDNA from transient hosts at least five times within the last two thousand years.The geographic distribution and phylogenies of the five CTVT clades reveal the dynamic recent history of the CTVT lineage (Figure 1C, Figure 1D, Figure 1—figure supplement 1 and Figure 1—source data 2). Clades 1 and 2, which occur most frequently in the CTVT population that we analysed, both have a global distribution. Tumours that diverged early in the clade 1 lineage occur in Russia, Ukraine, China and India, suggesting an Old World origin for this clade (Figure 1D). Clade 1 tumours in Central and South America share a single common ancestor that probably existed no more than 511 years ago, suggesting introduction of CTVT to the Americas with colonial contact; similarly, our data suggest a single introduction of CTVT to Australia after European arrival (maximum 116 years ago) (Figure 1D, Supplementary file 9, see Materials and methods). The distribution pattern and timing of clade 2 suggest that this clade may have been transported between continents via trans-Atlantic and Indian Ocean trade routes (Figure 1C and 1D). The more recent clade 3 lineage was found in Central and South America and India, and the less frequent clades 4 and 5 occurred only in India and Nigeria respectively (Figure 1C and 1D). The extensive and recent global expansion detected in the CTVT lineage is consistent with signals of widespread admixture observed in worldwide populations of domestic dogs (Shannon et al., 2015), highlighting the extent to which canine companions accompanied human travellers on their global explorations.Most somatic mutations in cancer are believed to be selectively neutral, and there is little evidence in humancancers for negative selection operating to safeguard essential cellular processes (Stratton et al., 2009). We searched for evidence of mtDNA functionality in CTVT cells by examining CTVT mtDNA for signals of negative selection. If present, negative selection would be expected to operate on mtDNA to prevent homoplasmy of deleterious mutations. Consistent with this prediction, the variant allele fraction (VAF) of nonsense substitutions and frameshift indels was significantly lower than VAF for other substitutions and indels (Figure 2A and B, p=0.00019 and p=3.03x10-05 respectively, two-sample Kolmogorov-Smirnov test). Furthermore, dN/dS for somatic mtDNA mutations in CTVT showed significant deviation from neutrality both for nonsense (0.187, p=1.02x10-07) and missense (0.748, p=4.18x10-03) mutations (Figure 2C). Together with evidence of reduced VAF for truncating mtDNA mutations in humancancers (Ju et al., 2014; Stewart et al., 2015), these findings provide evidence for the activity of negative selection operating to preserve mtDNA function in CTVT and indicate that, at least in some cancers, functional mtDNA contributes to driving cancer.
Figure 2.
Negative selection operates to prevent the accumulation of gene-disrupting mutations in CTVT.
Cumulative distribution functions for variant allele fraction (VAF) for gene-disrupting (A) substitutions and (B) indels. P-values were calculated using two-sample Kolmogorov-Smirnov tests. (C) dN/dS for somatic nonsense and missense substitutions. P-values were calculated using a likelihood ratio test with parameters estimated using a Poisson model. Error bars indicate 95 percent confidence intervals.
DOI:
http://dx.doi.org/10.7554/eLife.14552.011
CTVT somatic mutations displayed by mutation type (in pyrimidine context) with 5’ and 3’ context and strand. Each of 96 mutation classes is displayed on the horizontal axis, with mutations occurring on the heavy strand displayed in red on the positive axis, and light strand mutations displayed in blue on the negative axis. The normalised substitution rate represents the (number of observed)/(number of expected) mutations, given mtDNA genome triplet content. Distinctive peaks are individually labelled. Only mutations on the 'conservative somatic list' were used (see Materials and methods and Supplementary file 4C).
DOI:
http://dx.doi.org/10.7554/eLife.14552.012
Negative selection operates to prevent the accumulation of gene-disrupting mutations in CTVT.
Cumulative distribution functions for variant allele fraction (VAF) for gene-disrupting (A) substitutions and (B) indels. P-values were calculated using two-sample Kolmogorov-Smirnov tests. (C) dN/dS for somatic nonsense and missense substitutions. P-values were calculated using a likelihood ratio test with parameters estimated using a Poisson model. Error bars indicate 95 percent confidence intervals.DOI:
http://dx.doi.org/10.7554/eLife.14552.011
CTVT mtDNA somatic mutation spectrum.
CTVT somatic mutations displayed by mutation type (in pyrimidine context) with 5’ and 3’ context and strand. Each of 96 mutation classes is displayed on the horizontal axis, with mutations occurring on the heavy strand displayed in red on the positive axis, and light strand mutations displayed in blue on the negative axis. The normalised substitution rate represents the (number of observed)/(number of expected) mutations, given mtDNA genome triplet content. Distinctive peaks are individually labelled. Only mutations on the 'conservative somatic list' were used (see Materials and methods and Supplementary file 4C).DOI:
http://dx.doi.org/10.7554/eLife.14552.012MtDNA is usually assumed to be clonally inherited and recombinationally inert. However, mtDNA recombination has been directly observed in various eukaryotes (Lunt and Hyman, 1997; Hoarau et al., 2002; Ladoukakis and Zouros, 2001; Gantenbein et al., 2005; Ujvari et al., 2007; Bergthorsson et al., 2003) and has been proposed as a mechanism for mtDNA repair (Thyagarajan et al., 1996). Recombination of maternal and paternal mtDNA haplotypes has been observed in rare cases of human biparental mtDNA inheritance (Kraytsberg et al., 2004; Zsurka et al., 2005), and mtDNA recombination activity is present in human cell extracts (Thyagarajan et al., 1996). However, mtDNA recombination has not, to our knowledge, been previously detected in cancer. Given the possibility for coexistence of two distinct mtDNA haplotypes in CTVT cells, we searched for evidence of mtDNA recombination in CTVT using recombination-detection algorithms 3seq and SiScan (Boni et al., 2007; Gibbs et al., 2000). Remarkably, these algorithms detected significant evidence for mtDNA recombination in CTVT clade 1, detecting recombination breakpoints at around MT:5430 and MT:16176. Maximum likelihood phylogenetic trees constructed using segments MT:1–5429 and MT:5430–16176 derived from clade 1 mtDNA produced distinct topologies (Figure 3A, Figure 3—source data 1). Further inspection of clade 1 mtDNA haplotypes suggested that recombination replaced MT:1–5429 in a clade 1 mtDNA haplotype that diverged from Central American clade 1 CTVTs and that subsequently colonised areas of South and Central America (Chile, Colombia, Ecuador, Panama, Paraguay) (Figure 3B).
Figure 3.
Ancient and modern mtDNA recombination in CTVT.
(A) Maximum likelihood phylogenetic trees constructed using segments MT:1–5429 and MT:5430–16176 from clade 1 CTVT mtDNAs. Three clade 1 mtDNA haplotype groups are represented by coloured dog silhouettes, and their geographical distributions are colour-coded on the map. Bootstrap values were calculated from 100 iterations. Maximum likelihood trees upon which these representations are based are found in Figure 3—source data 1. (B) Simplified haplotype diagrams for clade 1 CTVT mtDNAs derived from groups shown in (A). Germline variants were present in the donor mtDNA that founded clade 1, represented by the A1/A1c/A1e dog haplotype (see Figure 1—figure supplement 4). Region putatively replaced by recombination is outlined with orange box. (C) Recombination detected in tumour 559T (Nicaragua). The estimated per cent contribution of each recombined haplotype to the mtDNA population within 559T CTVT cells is shown, and grey arrows indicate likely sites of recombination.
DOI:
http://dx.doi.org/10.7554/eLife.14552.013
Maximum likelihood cladograms constructed using clade 1 mtDNA positions (A) 1-5429bp and (B) 5430-16176bp (see Materials and methods). Trees were constructed with 153 clade 1 CTVT mtDNAs rooted with the CTVT1 haplotype, which contains clade 1 clade-defining germline and potential somatic substitutions (Materials and methods, Figure 1—figure supplement 4). Bootstrap values were calculated from 100 bootstrap replicates and are shown where bootstrap values ≥60.
DOI:
http://dx.doi.org/10.7554/eLife.14552.014
Ancient and modern mtDNA recombination in CTVT.
(A) Maximum likelihood phylogenetic trees constructed using segments MT:1–5429 and MT:5430–16176 from clade 1 CTVT mtDNAs. Three clade 1 mtDNA haplotype groups are represented by coloured dog silhouettes, and their geographical distributions are colour-coded on the map. Bootstrap values were calculated from 100 iterations. Maximum likelihood trees upon which these representations are based are found in Figure 3—source data 1. (B) Simplified haplotype diagrams for clade 1 CTVT mtDNAs derived from groups shown in (A). Germline variants were present in the donor mtDNA that founded clade 1, represented by the A1/A1c/A1e dog haplotype (see Figure 1—figure supplement 4). Region putatively replaced by recombination is outlined with orange box. (C) Recombination detected in tumour 559T (Nicaragua). The estimated per cent contribution of each recombined haplotype to the mtDNA population within 559T CTVT cells is shown, and grey arrows indicate likely sites of recombination.DOI:
http://dx.doi.org/10.7554/eLife.14552.013
Ancient mtDNA recombination in CTVT clade 1.
Maximum likelihood cladograms constructed using clade 1 mtDNA positions (A) 1-5429bp and (B) 5430-16176bp (see Materials and methods). Trees were constructed with 153 clade 1 CTVT mtDNAs rooted with the CTVT1 haplotype, which contains clade 1 clade-defining germline and potential somatic substitutions (Materials and methods, Figure 1—figure supplement 4). Bootstrap values were calculated from 100 bootstrap replicates and are shown where bootstrap values ≥60.DOI:
http://dx.doi.org/10.7554/eLife.14552.014These data provide evidence of an mtDNA recombination event in an ancestral CTVT lineage. We searched for evidence of more recent mtDNA recombination by examining outliers on CTVT mtDNA phylogenetic trees (Figure 1—source data 2, Supplementary file 10). This analysis identified 559T, a CTVT tumour derived from a male dog in Nicaragua (Figure 3C). Further investigation of mtDNA in 559T revealed what appeared to be a CTVT clade 1 mtDNA haplotype (CTVT_1B2b1_29) superimposed upon a dog mtDNA haplotype (A1d1a_1), neither of which resembled the mtDNA haplotype found in normal tissues from this host dog, 559H (B1_1 haplotype). Phasing of mtDNA variants in 559T using long sequence reads indicated the presence of at least three distinct mtDNA haplotypes in this tumour, each representing a recombination product apparently derived from mtDNA haplotypes CTVT_1B2b1_29 and A1d1a_1 (Figure 3C). These data suggest that a tumour antecedent of 559T captured haplotype A1d1a_1 mtDNA from its host. Recombination was initiated between mtDNA haplotypes CTVT_1B2b1_29 and A1d1a_1, and cells containing these recombination products were passed to host 559H. Alternatively it is possible that 559H received a mixture of both normal and CTVT cells from its CTVT donor animal, and mtDNA capture and recombination occurred within 559H. It must also be mentioned that the A1d1a_1 haplotype resembles the CTVT clade 3 donor haplotype (Figure 1—figure supplement 4); thus we cannot exclude the possibility that the recombination that we observe in 559T involved horizontal transfer between clade 1 and clade 3 CTVT tumours that occurred within the same animal.Our analysis provides evidence for occasional mtDNA recombination activity in CTVT cells. The mechanism whereby distinct mtDNA molecules are able to interact within the cell, and the nature of the signals that trigger onset of mtDNA recombination are not clear. Further analysis will determine if DNA damage signalling is involved, and it is interesting to observe that a truncating nonsense mutation in COX3 was found in some 559T haplotypes (Figure 3C). Although we could not find evidence of mtDNA recombination in CTVT beyond those described, we cannot exclude the possibility that recombination is more widespread in CTVT mtDNA than detected. It is possible, therefore, that our phylogenetic, mutation rate and selection analyses (Figure 1, 2) have been influenced by an undetected recombination signal. However, the presence in all (non-recombining) CTVT mtDNAs of a set of clade-specific markers (Figure 1—figure supplement 4), the absence (beyond 559T) of distinctive phylogenetic outliers (Figure 1—source data 2), the very low frequency of back-mutation (Supplementary file 10), the strong somatic signal identified in the CTVT mtDNA mutational spectrum (Figure 2—figure supplement 1), and the failure of recombination-detection algorithms to detect further recombination, suggest that, if such a signal is present, it is at a low level.CTVT is the world’s oldest known cancer whose metastatic spread through its global host population provides unique insights into evolutionary processes operating in cancer. Our analysis of CTVT mtDNA has illuminated five mtDNA horizontal transfer events which trace two millennia of CTVT global spread. Negative selection has operated on CTVT to maintain mtDNA integrity at the level of nonsense and missense mutations, and occasional mtDNA recombination has occurred, possibly to repair damaged mtDNA. Evidence of negative selection demonstrates that maintenance of functional mtDNA is important for the biology of CTVT; and the observation of multiple mtDNA horizontal transfer events further supports the possibility that mtDNA capture from hosts is a positively selected adaptive mechanism (Rebbeck et al., 2011; Tan et al., 2015; Spees et al., 2006). This study highlights the important role of functional mtDNA in cancer and reveals unexpected biological mechanisms that have operated in an ancient mammalian somatic cell lineage.
Materials and methods
Sample collection and DNA extraction
This study was approved by the Department of Veterinary Medicine, University of Cambridge, Ethics and Welfare Committee (reference number CR174). Tumour and host (gonad, skin, blood or liver) tissue samples were collected into RNAlater solution and stored at 4°C until processing. Genomic DNA was extracted using the Qiagen DNeasy Blood and Tissue extraction kit. Sample information is presented in Supplementary file 1.
Confirmation of canine transmissible venereal tumour (CTVT) diagnosis
Quantitative PCR (qPCR) assays were performed to confirm CTVT diagnosis (Supplementary file 3) by detection of the CTVT-specific LINE-MYC genomic rearrangement (Murgia et al., 2006; Rebbeck et al., 2009; Murchison et al., 2014; Katzir et al., 1985; 1987). Each qPCR was performed in triplicate with SYBR Select Master Mix (Life Technologies, Carlsbad, CA) using an Applied Biosystems 7900HT Fast Real-Time PCR system instrument (Applied Biosystems, Foster City, CA) with conditions and primers specified below.Standard curves were constructed for each primer set using CTVT tumour 29T1 as reference. Relative DNA input was calculated using standard curves as follows: (Ct = m(log10(iA)) + b), with each of the parameters defined as follows: Ct = threshold cycle, m = slope of the standard curve, iA = input amount, b = y-intercept of the standard curve. Relative DNA input for LINE-MYC was then normalised to ACTB. LINE-MYC and ACTB are present in three and two copies respectively in 24T and 79T CTVT tumours (Murchison et al., 2014); however, it is possible that copy number at these loci differs between tumours in the current dataset.
DNA sequencing
Whole genome sequencing libraries with insert size 100 to 400 base pairs (bp) were constructed using standard methods according to manufacturer’s instructions and sequenced with 75bp paired end reads on an Illumina HiSeq2000 instrument (Illumina, San Diego, CA) to an average whole genome depth of 0.3X; average mitochondrial DNA (mtDNA) coverage was ~70X. Reads were aligned with the CanFam3.1 dog reference genome (Lindblad-Toh et al., 2005) (http://www.ensembl.org/Canis_familiaris/Info/Index) using the BWA alignment tool (Li and Durbin, 2009). To calculate the mitochondrial copy number, we used the following equation: (mtCOV/nuclCOV)*P, where mtCOV = average coverage across the mitochondria, nuclCOV = average coverage across the nuclear genome and P = ploidy. The ploidy used in our calculations was 2 for both CTVT tumours and CTVT hosts (Murchison et al., 2014). Host and tumour samples with average MT coverage >300X were excluded from the copy number calculations (see Supplementary file 2A).Samples 1380T and 1381T were sequenced separately, based on the methods described in Pang et al (Pang et al., 2009). Complete mitochondrial genomes were amplified using the primers listed in Pang et al (Pang et al., 2009) with a number of additional primers listed below. The PCR conditions are specified below.The PCR products were purified using a 1.0% agarose gel and sequenced on a 3730xl DNA analyser (Applied Biosystems) with a Big Dye Terminator v3.1 Sequencing Kit (Applied Biosystems). The sequenced fragments were assembled by Seqman (DNASTAR, Madison, WI) and the complete mitochondrial genomes were aligned with the CanFam3.1 dog mitochondrial reference genome (Lindblad-Toh et al., 2005).
Nuclear copies of mtDNA (NuMT) analysis
Nuclear copies of mtDNA (NuMTs) are mtDNA fragments that have been incorporated into the nuclear genome. Over 150 NuMTs have been identified in the canine genome (Verscheure et al., 2015). Somatically acquired NuMTs have also been described in humancancer (Ju et al., 2015).Given that our study design did not involve purification of cytoplasmic mtDNA genomes, we assessed the possibility that our mtDNA variant analysis has been influenced by NuMTs.
NuMTs in CanFam3.1
We first assessed the potential contribution of NuMTs present within the CanFam3.1 assembly to our variant calling. We used wgsim (https://github.com/lh3/wgsim) to simulate sequence reads from CanFam3.1 (excluding the MT chromosome) to a coverage of 0.3X (i.e. the average nuclear genome coverage sequenced as part of this study). We then used BWA (Li and Durbin, 2009) to align the reads to the CanFam3.1 MT reference and used Samtools depth (Li et al., 2009; Li, 2011) to assess the MT genome coverage. Any MT genome coverage detected from this analysis would be expected to arise from NuMTs. The average MT genome coverage from this analysis was 0 (Figure 1—figure supplement 5), indicating that the NuMTs known to be present within CanFam3.1 are at insufficient copy number and/or are too divergent to map to the MT reference genome using the alignment parameters used in this study.
Figure 1—figure supplement 5.
Sequence contribution of nuclear-encoded mtDNA (NuMTs).
Sequence read depth across the MT genome for a representative CTVT tumour (146T) and host (100H1) sequenced in this study to ~0.3X whole genome average coverage. This is compared with sequence read depth for simulated reads from CanFam3.1 (excluding the MT chromosome); reads were simulated to ~0.3X whole genome average coverage.
DOI:
http://dx.doi.org/10.7554/eLife.14552.010
Somatically acquired NuMTs
The analysis described above confirms that NuMTs that form part of the CanFam3.1 assembly have not impacted on the variant analysis performed in this study. However, it is possible that somatically acquired NuMTs that are not captured in the CanFam3.1 assembly could confound our variant analysis.The following observations argue against the possibility that NuMT-derived variants have had a significant impact on our tumour variant calling:As CTVT is a clonal lineage, somatically acquired NuMT-derived variants would be expected to present as stable low-VAF variants across all tumours within a phylogenetic group. Variants with these features were not observed.The mutation spectrum that we observed in CTVT mtDNA has the distinctive profile characteristic of the known somatic mtDNA mutational process (Figure 2—figure supplement 1 and Ju et al., 2014). As this mutational process is specific to cytoplasmic mtDNA, this observation suggests that the majority of variants within our set are of cytoplasmic origin.
Substitution calling
Extraction and filtering
Substitutions were called using CaVEMan (Cancer Variants through Expectation Maximisation), an in-house variant calling algorithm, as previously described (Nik-Zainal et al., 2012) (http://cancerit.github.io/CaVEMan/). As CaVEMan is designed for matched tumour-normal data, and CTVT tumours and normals are unmatched (i.e. they are different individuals), we used simulated reads derived from the reference genome as the 'normal', and called all substitution variants relative to this. A variant allele fraction (VAF value, i.e. number of reads supporting the substitution variant as a fraction of the total number of reads covering the substitution variant position) was reported for each substitution detected. The following list of in-built post-processing filters was used to improve the specificity and sensitivity of substitution calls:At least one third of mutant alleles must have base quality >25.Mean mapping quality of reads supporting a substitution variant call must be ≥21.Substitution variant calls supported only by the first or last 15bp of reads were discarded.Substitution variants were discarded if they occurred 10bp upstream or downstream of an unfiltered indel called in the same sample (as detected by the indel-detecting algorithm cgpPindel see 'Indel calling-Extraction and filtering'). The 10bp range was extended by the REP value for samples where an indel had been called with REP>0; REP represents the number of times the inserted/deleted base(s) occurs in the sequence directly 5’ or 3’ of the putative indel.Substitution variant calls were discarded if they occurred within region MT:16129-16430 inclusive; this is a simple repeat region as defined by the UCSC (http://genome.ucsc.edu/) table browser (Dog, CanFam3.1).If the reference allele was supported by at least one read on both strands (forward and reverse), then we required that the mutant allele should be supported by at least one read on both strands.Substitutions in 1380T and 1381T were called using MEGA (Molecular Evolutionary Genetics Analysis) (Tamura et al., 2013).
Post processing
Somatic substitutions in tumours with matched hosts
To remove tumour substitutions caused by host contamination, substitutions that were called in both tumour and matched host, but had VAF<0.9 in the tumour, were discarded. Substitutions with VAF>0.9 in both tumour and matched host were considered to be likely germline substitutions shared between host and tumour, and were retained. Low coverage hosts (defined as average coverage <20X, Supplementary file 2A) were additionally checked for evidence of substitutions at positions where substitutions were called in the corresponding tumour, and the substitution was discarded in the tumour if at least one read supporting the substitution was found in the low coverage host. All tumour substitutions with VAF<0.5 were discarded if the matched host was of low coverage. Low-level tumour-contaminated hosts were additionally checked for the presence of substitutions identified in other tumours (see Supplementary file 4A) and any substitutions arising due to contamination were discarded.
Somatic substitutions in tumours without matched hosts
VAF value was used to identify substitutions likely arising due to host contamination in tumours for which matched hosts were not available (see Supplementary file 1 for tumours without matched hosts). We used VAF plots, which display VAF value versus genomic position, to identify the level of host contamination in each tumour. We then discarded any substitution below a VAF cutoff, specified uniquely for each tumour based on its estimated level of host contamination (for most tumours, the VAF cutoff was 0.5 or 0.6). If VAF plots did not show clear distinctions between tumour substitutions and host contamination (i.e. host contamination was greater than~40%; this category included 9 tumours), we identified likely tumour substitutions as those which were present in phylogenetically-related tumours. Remaining substitutions were removed if they were also found in normal dogs (see 'CTVT host and published dog genome germline substitutions list', Supplementary file 4F); those substitutions that were not found either in phylogenetically-related tumours or in normal dogs were kept as putative somatic substitutions (total of 11 substitutions).
Germline substitutions in hosts
Substitutions in hosts were filtered using filters described in 'Substitution calling-Extraction and filtering'. Low coverage hosts (defined as average coverage <20X, Supplementary file 2A) were further checked for evidence of substitutions at positions where a substitution was called in the corresponding tumour as described in 'Somatic substitutions in tumours with matched hosts'.Caution should be taken when considering substitution lists for low coverage hosts and hosts with regions of low coverage (see Supplementary file 2A for average coverage per sample and Supplementary file 2B for list of samples with low coverage mtDNA regions), as these may contain false negatives due to low coverage.
Additional quality checks and validation
Additional quality filtering was performed in low coverage regions, regions with low-mapping quality, and regions containing variable-length polyC homopolymer tracts (Fregel et al., 2015). Substitutions that were subsequently completely excluded from the analysis as a part of this check are listed in the table below.Substitutions that were discarded due to proximity to an indel (see 'Substitution calling-Extraction and filtering' above) were visually inspected in Integrative Genomics Viewer (IGV) (Robinson et al., 2011; Thorvaldsdottir et al., 2013). A subset of these substitutions had substantial support and were rescued (listed below).
Host contamination
Host contamination levels in each tumour were estimated from VAF plots (see 'Somatic substitutions in tumours without matched hosts' above). Substitutions that were present in tumours but not in matched host were identified, and their average VAF used to estimate the proportion of tumour mtDNA (see Supplementary file 2C for estimated tumour cell fraction in each tumour). Substitution VAFs were normalised to take account of host contamination in Figure 2A and Supplementary files 4B,C. Tumour variants with normalised VAF<1 most likely represent heteroplasmic variants; however, we cannot exclude that these represent cellular subclones harbouring distinct homoplasmic mtDNA populations.
Recurrent mutations and back mutations
Back mutations and recurrent mutations occurring in tumours were identified by inspecting positions of tumours carrying each substitution on phylogenetic trees (Figure 1—source data 2).
Predicted functional consequences of substitutions
Variant effect predictor (VEP) (McLaren et al., 2010) was used to predict the functional consequences of single point substitutions, as annotated in Supplementary file 6.
Extracting substitution variants from publicly available dog sequences
In order to enrich our panel of germline substitutions created from 338 CTVT hosts, we included an additional set of 252 publicly available complete dog mtDNA genomes (see Supplementary file 8). To extract substitution variants from available fasta files, sequences were aligned with the CanFam3.1 dog mitochondrial reference genome using Clustal Omega (Sievers et al., 2011). Alignment errors in the multiple sequence alignment, usually due to miscalls caused by closely mapped indels, were inspected manually and corrected to minimise gaps. Substitutions were extracted using snp-sites (https://github.com/sanger-pathogens/snp_sites). For those samples missing data in regions MT: 15510–15532 and MT: 16040–16550 we substituted the most likely substitution at polymorphic sites based on phylogenetic position. Our filtering rules were applied to the substitution set where applicable (see 'Substitution calling-Extraction and filtering' and 'Additional quality checks and validation') and substitutions called before MT position 48 or after MT position 16671 were excluded due to low coverage in these regions in our sequencing data. Substitutions represented by International Union of Pure and Applied Chemistry (IUPAC) codes R, Y, S, W, K or M where one of the two possible calls was the same as the reference were changed to the base which was different to the reference. In cases where the IUPAC code represented >2 bases (B, D, H, V, or N), the reference base was substituted.
Indel calling
Small insertions and deletions (indels) were extracted from the sequencing data using cgpPindel (https://github.com/cancerit/cgpPindel). The following list of in-built filters was used to improve the specificity and sensitivity of indel calls:Indels were required to have ≥3 supporting reads on either the forward or reverse strands or ≥2 supporting reads on both the forward and reverse strandsIndel calls with at least 4 supporting pindel-mapped reads were required to have at least 1 supporting BWA-mapped read or, failing that, if REP= 0 (see 'Substitution calling-Extraction and filtering'), then at least one supporting pindel-mapped read on both strands.Indels called within the simple repeat region MT:16129–16430 inclusive were excluded.Samples with very high coverage of the mitochondrial genome (24T-Dog, 24H-Dog, 1T-Dog, 2T-Dog, 3T-Dog, 4T-Dog, 4H-Dog, 498H-Dog, 432T-Dog, 455T1-Dog, 231T-Dog, 79H-Dog, 79T-Dog), see Supplementary file 2A, were excluded from this analysis due to frequent false positives, together with samples 1380T-Dog and 1381T-Dog.
Somatic indels
Indels called in tumours that were also called in at least one host were discarded as possibly arising due to host contamination. Indels that were uniquely called in tumours without matched hosts were discarded, as we could not rule out the possibility that they were caused by host contamination. All remaining indels were visually validated using IGV (Robinson et al., 2011; Thorvaldsdottir et al., 2013). The indels listed in the table below were discarded from the analysis as miscalls. In total 27 somatic indels were included in the analysis (see Supplementary file 5A).
Germline indels
The indels found on the host variant lists (Supplementary files 5B and 7B, Supplementary file 13) include only those which were considered homoplasmic (VAF≥0.9) and which passed a visual validation performed using IGV (Robinson et al., 2011; Thorvaldsdottir et al., 2013).
Recurrent indels
Recurrent indels occurring in tumours were identified by inspecting phylogenetic positions of tumours carrying each indel (Figure 1—source data 2).
Variant Allele Fraction calculation for indels
Although primary indel calling was carried out using cgpPindel, indel allele fraction for wild type and mutant indels was calculated using vcfCommons (unpublished in-house software developed at the Wellcome Trust Sanger Institute; for additional information please contact cgp@sanger.ac.uk). The algorithm takes all mapped and unmapped reads in the region of an indel and performs an alignment of the reference and the predicted mutated path using Exonerate (Slater and Birney, 2005). The predicted mutated path is the reference with the change predicted by cgpPindel applied to it. Based on this alignment, reads are classified into 3 categories:aligns to reference pathaligns to mutated pathambiguous; a read sequence aligns to the reference and mutated path with identical scores which makes it impossible to determine the true pathIndel VAF values were normalised to take account of host contamination in Figure 2B.
Predicted functional consequences of indels
Variant effect predictor (VEP) (McLaren et al., 2010) was used to predict the functional effects of indels, as listed in Supplementary file 7.
Phylogenetic analyses
Phylogenetic trees
Phylogenetic trees were constructed using a maximum likelihood (ML) method implemented in PhyML 3.0 (Guindon et al., 2010) using the General Time Reversible (GTR) + G + I nucleotide substitution model with transition/transversion (ts/tv) ratio, gamma distribution shape parameter and proportion of invariant sites estimated in PhyML for each dataset. Phylogenetic trees constructed using RAxML 8.2.6 with a rapid climbing algorithm and identical model specification were consistent with the phylogenetic trees obtained using PhyML. Prior to tree construction jModelTest2 (Darriba et al., 2012) (https://code.google.com/p/jmodeltest2) was used to determine the best fitting substitution model for the alignment, inferred using the Akaike Information Criteria (AIC). The tree topology was estimated using a combination of Nearest Neighbor Interchange (NNI) and Subtree Pruning and Regrafting (SPR) (Hordijk and Gascuel, 2005) algorithms. Trees were visualised using Dendrocope (Huson and Scornavacca, 2012). Bootstrap support values were obtained from 100 bootstrap replicates. Nodes with ≥60% support are labelled in Figure 1—source data 2 and Figure 3—source data 1. The long branch-lengths in CTVT clade 4 were further investigated by visually validating sequence alignments involving these samples.
Confirmation of individual horizontal transfer events
Classification of tumour substitutions
CTVT tumour substitutions were classified as follows:1) Tumour germline clade-defining substitutions (see Supplementary file 4D for the full list)Inferred to be present on the donor mtDNA haplotype which founded each of the five horizontal transfer eventsPresent within the pool of substitutions in the current dog population (see Supplementary file 4F)Shared by all tumours within each clade derived from the original CTVT cell which received the horizontally transferred donated mtDNA (see Figure 1—figure supplement 4)2) Tumour somatic substitutions (see Supplementary file 4B for the full list)Inferred to have arisen after the clade-defining horizontal transfer eventVariable and phylogenetically informative within the set of tumours in one cladeAny substitutions which were associated with inferred recombination event (present uniquely) in 559T were discarded (see 'Mitochondrial recombination analysis')3) Tumour somatic substitutions - conservative list (see Supplementary file 4C for the full list)Inferred to have arisen after the clade-defining horizontal transfer eventVariable and phylogenetically informative within the set of tumours in one cladeAny substitutions which were classed as somatic but had the potential to be germline were excluded from this list. Exclusions were based on:Inferred recombination eventsOccurrence in clade 3; clade 3 tumours carry very few somatic mutations, and so the possibility that clade 3 tumours arose from several independent mtDNA horizontal transfer events cannot be excludedOccurrence on ancestral trunks; these include trunks defining CTVT_1A, CTVT_1B1, CTVT_2A haplogroups; due to their ancestral divergence, it cannot be excluded that these haplotypes are derived from independent mtDNA horizontal transfer eventsOccurrence as a putative somatic mutation in tumours without hosts (see 'Somastic substitutions in tumours without matched hosts')This list was used for the analysis in Figure 2A,C and Figure 2—figure supplement 1.4) Tumour potential somatic substitutions (see Supplementary file 4E for the full list)Substitutions present within all tumours within one clade but not represented in the set of 590 normal dogs analysed as part of this study (Supplementary file 4F)It cannot be determined if these substitutions are germline substitutions which were present on the mtDNA genome that founded each clade, or if they are early somatic substitutions that occurred after the clade-defining horizontal transfer event, but prior to the divergence of tumours analysed in our study.
Definition of a CTVT clade
A CTVT clade is defined as a group of tumours arising from an individual horizontal transfer event. Each clade is defined with respect to the tumour substitution classification (see 'Classification of tumour substitutions') as follows:CTVT tumours from the same clade cluster together on phylogenetic tree represented in Figure 1A.CTVT tumours from the same clade arose from a single donor mtDNA haplotype and therefore share the same set of germline substitutions which was inferred to be originally present on the donor mtDNA haplotype (germline clade-defining substitutions, see Figure 1—figure supplement 4, 'Classification of tumour substitutions').The reconstructed donor mtDNA haplotype for each clade has a phylogenetically closely related/identical haplotype in the current dog population (see Figure 1—figure supplement 4).
Estimated timing of clade divergence
Average number of somatic mutations (i.e. mutations arising after the horizontal transfer event) within each clade was calculated for each of the five clades (see Supplementary file 9). For potential somatic mutations (shown in grey in Figure 1B and D), we were unable to determine whether they occurred before or after the horizontal transfer event, as they are present in all samples from the same clade, but not in the pool of germline substitutions (see Supplementary file 4F). As the number of somatic mutations influences the time of divergence, we included estimates both with and without potential somatic mutations in our analysis (see Supplementary file 9). Presence of mitochondrial recombination in haplogroup CTVT_1B2b2 (clade 1) was taken into account when calculating the average number of mutations per clade (see 'Mitochondrial recombination analysis'). The timing of clade divergence was estimated independently based on the following three methods, as explained below: timing based on nuclear DNA (Murchison et al., 2014; Alexandrov et al., 2013), timing based on number of cell divisions per homoplasmic mitochondrial mutation (Ju et al., 2014; Cohen and Steel, 1972), and timing based on number of mitochondrial mutations per year (Ju et al., 2014). All estimates of CTVT dates assume a constant rate of accumulation of somatic mtDNA mutations both within and between clades, including constant activity of selection (Figure 2).
Timing based on nuclear DNA
Based on the most recent common ancestor of samples 24T (CTVT clade 1) and 79T (CTVT clade 2) which is estimated to have existed approximately 460 years ago (Murchison et al., 2014), we can assume that the maximum age of clade 2 (i.e. the more recent clade) is 460 years. Calibrated according to this dating (Murchison et al., 2014; Alexandrov et al., 2013), and assuming a constant rate of accumulation of mutations with time, the maximum number of CTVT somatic mtDNA mutations per year is 0.0205 (calculated using average number of mutations in clade 2 = 9.437). The calculated maximum time since origin of clades 1, 3, 4 and 5, is shown in Figure 1D and Supplementary file 9.
Timing based on number of cell divisions
A study of mtDNA mutations in humancancers estimated that one homoplasmic somatic mtDNA mutation arises every ~1000 cell generations in humancancers (Ju et al., 2014). An experimental study estimated CTVT cell generation times to be 4 days for first stage tumours and >20 days for second stage tumours (Cohen and Steel, 1972). Using 4 days and 20 days as a minimum and maximum generation time, and assuming a constant mtDNA somatic mutation rate in CTVT, we estimated a minimum and maximum mutation rate of ~0.0183 and ~0.0913 mutations/year respectively. See Supplementary file 9 for corresponding calculations of minimum and maximum time since clade origins.
Timing based on number of mutations per year
A previous study correlated somatic mtDNA mutation accumulation in humancancers with patient age (Ju et al., 2014). This suggested an approximate rate of ~0.025 mutations per year. Assuming a similar rate in CTVT somatic mtDNA mutations and a constant CTVT somatic mtDNA mutation rate, we estimated time since mtDNA horizontal transfer events (Supplementary file 9).
Haplotype analysis
Haplotype nomenclature
Host haplotypes
The host haplotype naming system was adapted from the cladistic canine mitochondrial DNA phylogeny nomenclature proposed by Fregel et al (Fregel et al., 2015). See Supplementary files 1 and 11 for all host haplotype names. Corresponding CTVT normal dog host samples were assigned into one of the major clades (A, B, C, D, E and F). For subsequent levels, haplogroups were defined by specific diagnostic variants, as defined by Fregel et al (Fregel et al., 2015). A unique number, following an underscore after the haplogroup name, distinguished distinct haplotypes within each haplogroup. Haplogroup-defining variants 15632 C>T, 15639 T>A and 15639 T>G were excluded from our analysis ('Additional quality checks and validation') and therefore we were unable to distinguish between haplogroups A1c and A1e. Haplotypes which did not fit into any haplogroup were classified as 'unassigned'.
Tumour haplotypes
We devised a CTVT mtDNA haplotype naming system adapted from the cladistic canine mtDNA phylogeny nomenclature proposed by Fregel et al (Fregel et al., 2015). See Supplementary file 1 and 11 for all CTVT tumour haplotype names. Each CTVT haplotype has a prefix 'CTVT_', indicating a tumour haplotype. Distinct CTVT clades are numbered (CTVT_1, CTVT_2, CTVT_3, CTVT_4 and CTVT_5). For subsequent levels, hierarchical notation was used, where subsequent haplogroups were named by alternating letters and numbers and the maximum number of levels included in the hierarchical notation was five – i.e. 3 numbers and 2 letters (e.g. 1A1a1). The first letter is a Roman capital; subsequently-used letters are lower case Roman letters. Any haplogroups beyond the maximum number of levels were considered as a single subgroup, in which individual haplotypes were distinguished using a non-hierarchical numbering system - an underscore followed by a number (e.g. 1A1a1_1, 1A1a1_2, etc.). Underscores were only used to distinguish individual haplotypes after the haplotype has been assigned to all 5 hierarchical levels (e.g. 1A_1 does not exist, as this haplotype would be classified as 1A1 instead).
Reconstructed donor haplotypes
A 'donor haplotype' was reconstructed for each of the clades, representing the inferred donor mtDNA haplotype in each horizontal transfer event, and was used to root the trees for each clade in Figure 1—source data 2. Donor haplotypes were reconstructed from the clade-defining germline substitutions and the clade-defining potential somatic substitutions (see 'Classifications of tumour substitutions' above) and are shown in Figure 1—figure supplement 4. The phylogenetically closest haplotype present in the current dog population is shown in the same figure.
Mitochondrial recombination analysis
Automated recombination analysis
The RDP4 package (Martin et al., 2015) was used to detect recombination events within the complete sample set (i.e. 449 CTVT tumours, 338 CTVT hosts and 252 additional dogs) using a Bonferroni corrected p-value cutoff of 0.05. Default parameters were used for the following programs implemented within the RDP package: RDP (Martin and Rybicki, 2000), MaxChi (Smith, 1992), Chimaera (Posada and Crandall, 2001), 3Seq (Boni et al., 2007) and SiScan (Gibbs et al., 2000).
Long read sequencing
A genomic library was created directly using 5µg of genomic DNA from sample 559T, not utilizing shearing or amplification techniques, as previously described (Coupland et al., 2012). The library was sequenced using two PacBio SMRT cells using the Pacific Biosciences RS sequencer (Pacific Biosciences, Menlo Park, CA). Each SMRT cell yielded ~1Gb of sequence data with mean read length 11,421bp and N50 read length 19,382bp. Average sequence coverage across the mitochondrial genome was 111.3X.
PacBio data analysis
PacBio sequence reads aligning to mtDNA were viewed in SMRT view (Pacific Biosciences) as well as in Integrative Genomics Viewer (IGV) (Robinson et al., 2011; Thorvaldsdottir et al., 2013) and used to phase the mitochondrial substitutions previously called in 559T (Nicaragua). The three most common recombinant haplotypes were completely phased, as shown in Figure 3C. Additional haplotypes, which we were unable to phase completely and which were present at very low level (less than 5%), were also identified. Reads derived from 559H, the host of 559T (haplotype B1_1), were also identified. The reads used to phase the substitutions in the three most common haplotypes are shown in the table below:
Mutation spectrum
The two strands of the mtDNA are known as the heavy and light strands, and the light strand is the reference strand in CanFam3.1. Each mutation on the conservative somatic list (n=835, 'Classification of tumour substitutions', Supplementary file 4C) was classified as one of six possible substitutions in the pyrimidine context (C>A, C>G, C>T, T>A, T>C, T>G) and assigned to a strand relative to the reference (i.e. pyrimidine mutations (i.e. C>, T>) with respect to the reference were defined as light strand mutations; purine mutations (i.e. A>, G>) with respect to the reference were defined as heavy strand mutations). The immediate 5’ and 3’ sequence contexts for each CTVT mutation was extracted from the dog mitochondrial reference genome for mutations on the heavy and light strands, yielding a maximum of 96 mutation types (6 possible substitutions x 4 possible 5’ bases x 4 possible 3’ bases).The number of observations of each substitution type was normalised to the triplet frequency extracted from the canine mitochondrial genome. The following example illustrates how to calculate the observed/expected ratio for T[C>T]G occurring on the heavy strand. We observed a total of 835 substitutions occurring across the MT genome; given that the TCG triplet is observed 117 times in the dog mitochondrial reference genome heavy strand, the frequency of TCG triplets occurring in the dog mtDNA heavy strand is 117/16727 = 0.007, where 16,727 bp is the length of the dog mitochondrial genome. Using the frequency of TCG triplets in the reference genome, we can calculate the expected number of T[C>T]G substitution types on the heavy strand as (total number of mutations) x (TCG frequency on the heavy strand) / 3 (as there are 3 possible C>N substitutions) i.e. expected number of T[C>T]G substitutions on the heavy strand = 835 x 0.007/ 3 ≈ 1.95. As we observed 22 T[C>T]G mutations on the heavy strand, the observed/expected ratio for this mutation type was 22/1.95 = 11.28.Triplets within region MT:16129–16430 inclusive ('Substitution calling-Extraction and filtering'), as well as a set of specific excluded sites ('Additional quality checks and validation') were excluded from our analysis. This was accounted for during the calculation of expected substitutions described above.
Selection analyses
VAF
Substitutions
Normalised VAF values for somatic substitutions were calculated as described in 'Host contamination'. Cumulative distribution functions for VAF scores (normalised to take into account host contamination, see 'Host contamination' above) were plotted for nonsense substitutions (n = 10) and missense and synonymous substitutions (n = 610), using the conservative somatic list (see 'Classification of tumour substitutions' above and Supplementary file 4C). Statistical significance was tested using the two-sample Kolmogorov-Smirnov test implemented in R (R Development Core Team, 2013).
Indels
Normalised VAF for somatic indels was calculated as described in 'Predicted functional consequences on indels'. Cumulative distribution functions of normalised variant allele fractions were plotted for frameshift (n = 18) and non-frameshift (n = 9) indels. Statistical significance was tested using the two-sample Kolmogorov-Smirnov test implemented in R (R Development Core Team, 2013).
dN/dS
dN/dS was estimated using a method adapted from Martincorena et al. (2015). Briefly, a context-dependent model with 192 substitution rates (12 possible substitution types C>A, C>G, C>T, T>A, T>C, T>G, A>C, A>G, A>T, G>A, G>C, G>T x 4 possible 5’ bases x 4 possible 3’ bases) was used, thus accounting for any confounding context-dependent effects. The substitution rate was modelled as a Poisson process where the product of the underlying mutation rate and the impact of selection give the rate. A likelihood ratio test was used to test the deviation from neutrality (wMIS=1 or wNON=1), giving a p-value for the evidence of selection. To avoid any confounding effects due to the highly strand-biased CTVT mtDNA mutation spectrum (Figure 2—figure supplement 1), we excluded ND6, the only mitochondrially-encoded gene transcribed from the light strand, from this analysis.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Elaine Ostrander as the Reviewing Editor and Mark McCarthy as the Senior Editor.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:This is a well-written and concise paper that addressed the next natural step in unraveling the mystery of CTVT in the dog. The figures are clear (and attractive). Overall the paper does an outstanding job documenting, through low-coverage sequencing and phylogenetic analysis, the frequent transfer of mitochondrial DNA from the affected host to the canine transmissible venereal tumor (CTVT). Sequencing reveals that acquisition of host mtDNA has occurred at least five times during the worldwide spread of the clonal tumor, and that these five clades acquired their mtDNAs around 1,000 years ago. The sequences further suggest that there has been retention of ORFs, suggesting selection for function in the acquired DNAs. The data for the five clade hypothesis and horizontal transfer is convincing. The paper can be strengthened however in a few ways.Essential revisions:The reviewers felt this was a strong and important contribution to an interesting field. They identified several issues, however, that need to be addressed. These include:1) Two reviewers raised the issue of the Indian-CTVT clade (IV), which implies highly non-clock-like evolutionary rates within the ancestor of the lineage. It is found at the end of fairly long branches and it may not be accurately placed within the phylogeny. One possibility is that this observation may be the result of the ML search that was performed [(Phyml with rudimentary branch swapping – a "combination of NNI and SPR")]. This approach may be insufficient to search treespace with such a large number of OTUs. The reviewers ask that the analysis be repeated with the newest version of RAxML which has more thorough search options. Alternatively, the authors should closely check the sequences or alignment as this could be due to minor alignment errors.2) Two reviewers also raised the issue of the full-length mitochondrial NUMT that is found in the dog genome. The reviewers state that NuMTs are a major confounder in many species, and it was well-served to be addressed. However, over 150 NuMTs have been discovered in the canine genome. It is unclear how the wgsim recreation of reduced CTVT reads aligned to the canine genome would demonstrate how NuMTs are unlikely to contribute significantly to mtDNA variant calling. During CTVT evolution, particularly in an organism purported to engage in mictochondrial capture, it is likely that novel NuMTs were introduced that diverge from the canine genome. While the authors are likely correct that current mtDNA assemblies have not been compromised by NuMTs, if the NuMT is tandemly arrayed (as they are in many mammalian genomes) it could be highly multicopy and approach the read depth of the true cytoplasmic copies. The authors should check this by estimating read depth of the dog NuMT insertion within the nuclear genome and see if is collapsed and determine the expected depth based on this measurement, rather than assuming one copy. This will certainly raise the caliber of the paper.3) The time estimate of 11,000 years cited in this work was estimated using a subset of extant canine variation to isolate ~1.9 million somatic mutations, and perform a strict clock approach based on the mutation signature of humanmedulloblastoma. Subsequent work used a more comprehensive catalog of canine variation resulting in a 50% reduction in total somatic mutations. A reanalysis of the timing of CTVT origin may be warranted and particularly useful for the field.4) The authors discuss the phenomenon of mitochondrial recombination, but do not discuss the likelihood of heteroplasmy. If mitocapture is a mechanism prevalent in CTVT, it is likely that these tumors are heteroplasmic. Are the authors indicating that mitochondria from the original CTVT founder, or a subsequent host prior to Clade A is no longer present, and has been supplanted completely by now homoplastic horizontal transfer? The issue of tumor clonality / subclonality is not addressed.5) The authors use an in-house variant caller that is based on paired tumor-normal samples. Since CTVT by its nature does not have a normal sample, why was another caller that did not rely on tumor /simulated normal used? Please explain.6) Why was ploidy estimated to be 1.5 for CTVT and 2.0 for host? The reference indicates that CTVT is diploid.7) Importantly, there is no indication of where the mtDNA alignments or variants, and low coverage nuclear data is deposited for future replication. This must be done prior to acceptance of the paper for publication.Essential revisions:The reviewers felt this was a strong and important contribution to an interesting field. They identified several issues, however, that need to be addressed. These include: 1) Two reviewers raised the issue of the Indian-CTVT clade (IV), which implies highly non-clock-like evolutionary rates within the ancestor of the lineage. It is found at the end of fairly long branches and it may not be accurately placed within the phylogeny. One possibility is that this observation may be the result of the ML search that was performed [(Phyml with rudimentary branch swapping – a "combination of NNI and SPR")]. This approach may be insufficient to search treespace with such a large number of OTUs. The reviewers ask that the analysis be repeated with the newest version of RAxML which has more thorough search options. Alternatively, the authors should closely check the sequences or alignment as this could be due to minor alignment errors.We thank the reviewers for their comments regarding the phylogenetic position of CTVT clade 4 tumours in Figure 1A, and for raising the concern that this group may be inaccurately positioned due to limitations in the phylogenetic analysis algorithm or errors in alignment.We repeated the phylogenetic analysis shown in Figure 1A using RAxML 8.2.6 using the default rapid hill climbing algorithm. The phylogenetic position of the clade 4 tumours was consistent between the PhyML and RAxML trees (see Author response image 1). We have now included a statement in the Methods section: “Phylogenetic trees constructed using RAxML 8.2.6 with a rapid climbing algorithm and identical model specification were consistent with the phylogenetic trees obtained using PhyML.”
Author response image 1.
Diagram showing phylogenetic trees constructed using PhyML and RAxML.
DOI:
http://dx.doi.org/10.7554/eLife.14552.028
Diagram showing phylogenetic trees constructed using PhyML and RAxML.
DOI:
http://dx.doi.org/10.7554/eLife.14552.028In addition, we performed manual validation of each of the variants identified in CTVT clade 4 tumours, and visualised the alignment of clade 4 haplotypes to confirm the absence of alignment errors. We have added the following statement to the Methods section: “The long branch-lengths in CTVT clade 4 were further investigated by visually validating sequence alignments involving these samples.”We would further like to clarify that we do not wish to imply that clade 4 mtDNA represents the “ancestor of the lineage”. Our interpretation of the data is that the clade 4 group is derived from one of the five distinct horizontal transfer events detected in our analysis; we do not believe that the clade 4 mtDNA was originally present within the founder CTVT dog.2) Two reviewers also raised the issue of the full-length mitochondrial NUMT that is found in the dog genome. The reviewers state that NuMTs are a major confounder in many species, and it was well-served to be addressed. However, over 150 NuMTs have been discovered in the canine genome. It is unclear how the wgsim recreation of reduced CTVT reads aligned to the canine genome would demonstrate how NuMTs are unlikely to contribute significantly to mtDNA variant calling. During CTVT evolution, particularly in an organism purported to engage in mictochondrial capture, it is likely that novel NuMTs were introduced that diverge from the canine genome. While the authors are likely correct that current mtDNA assemblies have not been compromised by NuMTs, if the NuMT is tandemly arrayed (as they are in many mammalian genomes) it could be highly multicopy and approach the read depth of the true cytoplasmic copies. The authors should check this by estimating read depth of the dog NuMT insertion within the nuclear genome and see if is collapsed and determine the expected depth based on this measurement, rather than assuming one copy. This will certainly raise the caliber of the paper.We appreciate the reviewers’ comment about nuclear copies of mitochondrial DNA (NuMTs). Further to the concern raised, we have expanded the Methods subsection entitled “Nuclear copies of mtDNA (NuMT) analysis” to clarify the rationale behind the NuMT analysis that we have performed and to provide further justification for our conclusion that NuMTs have not significantly impacted on our CTVT mtDNA variant catalogue.3) The time estimate of 11,000 years cited in this work was estimated using a subset of extant canine variation to isolate ~1.9 million somatic mutations, and perform a strict clock approach based on the mutation signature of humanmedulloblastoma. Subsequent work used a more comprehensive catalog of canine variation resulting in a 50% reduction in total somatic mutations. A reanalysis of the timing of CTVT origin may be warranted and particularly useful for the field.We thank the reviewers for raising this point regarding the timing of CTVT origin. We agree that future re-analysis of the timing of CTVT’s origin will be an important contribution to the field. However, we believe that re-analysis of the timing of CTVT origin is beyond the scope of this work, whose focus is on mtDNA evolution in CTVT (and as mtDNA in CTVT has been acquired by horizontal transfer, analysis of CTVT mtDNA cannot cast light on the timing of CTVT’s origin). Nevertheless, we are aware of the uncertainty in CTVT origin timing estimates, and have emphasised this uncertainty by stating “approximately” or “around” whenever 11,000 years is mentioned. Additionally, we have now cited the paper to which the reviewers refer (Decker et al., 2015) (see the Introduction).4) The authors discuss the phenomenon of mitochondrial recombination, but do not discuss the likelihood of heteroplasmy. If mitocapture is a mechanism prevalent in CTVT, it is likely that these tumors are heteroplasmic. Are the authors indicating that mitochondria from the original CTVT founder, or a subsequent host prior to Clade A is no longer present, and has been supplanted completely by now homoplastic horizontal transfer? The issue of tumor clonality / subclonality is not addressed.We thank the reviewers for raising this interesting point. As the reviewers suggest, we do believe that the absence of haplotype-level heteroplasmy suggests that mtDNA horizontal transfer is either (i) not common or (ii) does not frequently reach levels that are detectable in our analysis. Following from this, we are indeed suggesting that the original CTVT mtDNA haplotype has been replaced and is no longer present, as stated in the third paragraph of the Results and Discussion section.Following on from this, we would like to thank the reviewers for the very valid point regarding tumour subclonality. The variable VAFs reported in Figure 2 may well be due to both intracellular heteroplasmy as well as intercellular heterogeneity (subclonality). We have addressed this point by adding a sentence to the Methods section, reading “Tumour variants with normalised VAF<1 most likely represent heteroplasmic variants; however, we cannot exclude that these represent distinct cellular subclones harbouring distinct homoplasmic mtDNA populations”.5) The authors use an in-house variant caller that is based on paired tumor-normal samples. Since CTVT by its nature does not have a normal sample, why was another caller that did not rely on tumor /simulated normal used? Please explain.We appreciate the reviewers’ concerns about the variant caller that we used in our analysis. The unavailability of matched normal DNA from the original founder dog that first gave rise to CTVT poses challenges for the computational analysis of CTVT. Somatic variant callers, which usually require paired tumour-normal samples, generally have greater sensitivity for variant detection and do not invoke underlying diploid segregation models. We selected CaVEMan as a variant caller, as this algorithm is widely used and validated as a somatic variant caller.6) Why was ploidy estimated to be 1.5 for CTVT and 2.0 for host? The reference indicates that CTVT is diploid.We are very grateful to the reviewers for pointing out this error. The reference indeed indicates that CTVT is diploid and we have now corrected the calculations to reflect this (please see Results and discussion, first paragraph and subsection “DNA sequencing”, first paragraph).7) Importantly, there is no indication of where the mtDNA alignments or variants, and low coverage nuclear data is deposited for future replication. This must be done prior to acceptance of the paper for publication.Further information about deposition of the data associated with this study is detailed below:a) The mtDNA data associated with this study are available in GenBank with accession numbers: KU290400 – KU291095.b) All the variant lists are available as Supplementary datasets 1 and 2.c) The low coverage sequence data associated with this study are available in the ENA with accession number ERP014691.
Primer
Sequence
LINE-MYCprimers (obtained from [Rebbeck, 2007])
Forward
AGG GTT TCC CAT CCT TTA ACA TT
Reverse
AGA TAA GAA GCT TTT GCA CAG CAA
ACTB primers
Forward
CTC CAT CAT GAA GTG TGA CGT TG
Reverse
CGA TGA TCT TGA TCT TCA TTG TGC
qPCR master mix reagents
Volume per reaction (μl)
SYBR Green Mix
10
Primers (5 μM/primer)
2.4
DNA (20 ng/μl)
0.5
Water
7.1
Total volume
20
Stage of qPCR amplification
Temperature (°C)
Time (s)
Initial denaturation
95
600
40 cycles
95
15
60
60
Final dissociation
95
15
PCR master mix reagents
Volume per reaction (μl)
1 X PCR LATaq buffer
2.5
Primer forward and reverse (10 μM)
1.2 (each)
DNA (100-200 ng/μl)
1.2
LATaq DNA polymerase
0.25
1X dNTP (10 mM)
4
Water
14.65
Total volume
25
Stage of PCR amplification
Temperature (°C)
Time (s)
Initial denaturation
94
300
12 cycles (touchdown PCR program, reduce 1°C each cycle)
94
60
61–50
60
74
90
25 cycles
94
60
52
60
74
90
Final extension
74
420
Primer name
Sequence (5’–3’)
D0132
ACC GTA AGG GAA TGA TGA A
D0136
TGT AAG TGG TCG TAG AGG TTC
D0141
AGG CGG ACT AAA TCA AAC TCA
D0146
GGG GTA TCT AAT CCC AGT TT
D0149
AAG TTT GGT AGC ACG AAG AT
Position
Base change
Justification for excluding substitution
15493
G>A
Inconsistently called due to low coverage and decreased mapping quality in this region
15505
T>C
Inconsistently called due to low coverage and decreased mapping quality in this region
15632
C>T
Frequently miscalled due to decreased mapping quality in this region
15639
T>A
Frequently miscalled due to decreased mapping quality in this region
15639
T>G
Frequently miscalled due to decreased mapping quality in this region
15931
A>G
Frequently miscalled due to its presence in the same position as a frequently miscalled indel (middle of a homopolymer tract)
16672
C>T
Frequently miscalled due to its proximity to a frequently miscalled indel (associated with a very long homopolymer tract)
16705
C>T
Frequently miscalled due to low coverage in this region
Position
Base change
381
T>A
1481
T>C
1683
T>C
2682
G>A
2683
G>A
3028
A>C
6629
T>C
6882
A>G
7014
T>G
8281
T>C
8368
C>T
8703
G>A
9825
G>A
9896
T>C
13708
C>T
14977
T>C
15524
C>T
15526
C>T
16660
T>C
16663
C>T
16671
T>C
Position
Indel
Sample
Justification for discarding indel
9891
TGATTTATCTCATAATTATCA> TATCTCATAATTATCATG
324T2-Dog
Indel miscalled due to close proximity of two other indels in the same sample
9910
C>CAT
401T-Dog
Indel miscalled due to presence of a substitution at the same position
PacBio sequencing reads used for phasing of individual haplotypes
Authors: Laura M Shannon; Ryan H Boyko; Marta Castelhano; Elizabeth Corey; Jessica J Hayward; Corin McLean; Michelle E White; Mounir Abi Said; Baddley A Anita; Nono Ikombe Bondjengo; Jorge Calero; Ana Galov; Marius Hedimbi; Bulu Imam; Rajashree Khalap; Douglas Lally; Andrew Masta; Kyle C Oliveira; Lucía Pérez; Julia Randall; Nguyen Minh Tam; Francisco J Trujillo-Cornejo; Carlos Valeriano; Nathan B Sutter; Rory J Todhunter; Carlos D Bustamante; Adam R Boyko Journal: Proc Natl Acad Sci U S A Date: 2015-10-19 Impact factor: 11.205
Authors: James B Stewart; Babak Alaei-Mahabadi; Radhakrishnan Sabarinathan; Tore Samuelsson; Jan Gorodkin; Claes M Gustafsson; Erik Larsson Journal: PLoS Genet Date: 2015-06-30 Impact factor: 5.917
Authors: Carolyn J Vivian; Amanda E Brinker; Stefan Graw; Devin C Koestler; Christophe Legendre; Gerald C Gooden; Bodour Salhia; Danny R Welch Journal: Cancer Res Date: 2017-06-29 Impact factor: 12.701
Authors: Martina Bajzikova; Jaromira Kovarova; Ana R Coelho; Stepana Boukalova; Sehyun Oh; Katerina Rohlenova; David Svec; Sona Hubackova; Berwini Endaya; Kristyna Judasova; Ayenachew Bezawork-Geleta; Katarina Kluckova; Laurent Chatre; Renata Zobalova; Anna Novakova; Katerina Vanova; Zuzana Ezrova; Ghassan J Maghzal; Silvia Magalhaes Novais; Marie Olsinova; Linda Krobova; Yong Jin An; Eliska Davidova; Zuzana Nahacka; Margarita Sobol; Teresa Cunha-Oliveira; Cristian Sandoval-Acuña; Hynek Strnad; Tongchuan Zhang; Thanh Huynh; Teresa L Serafim; Pavel Hozak; Vilma A Sardao; Werner J H Koopman; Miria Ricchetti; Paulo J Oliveira; Frantisek Kolar; Mikael Kubista; Jaroslav Truksa; Katerina Dvorakova-Hortova; Karel Pacak; Robert Gurlich; Roland Stocker; Yaoqi Zhou; Michael V Berridge; Sunghyouk Park; Lanfeng Dong; Jakub Rohlena; Jiri Neuzil Journal: Cell Metab Date: 2018-11-15 Impact factor: 27.287
Authors: Máire Ní Leathlobhair; Angela R Perri; Evan K Irving-Pease; Kelsey E Witt; Anna Linderholm; James Haile; Ophelie Lebrasseur; Carly Ameen; Jeffrey Blick; Adam R Boyko; Selina Brace; Yahaira Nunes Cortes; Susan J Crockford; Alison Devault; Evangelos A Dimopoulos; Morley Eldridge; Jacob Enk; Shyam Gopalakrishnan; Kevin Gori; Vaughan Grimes; Eric Guiry; Anders J Hansen; Ardern Hulme-Beaman; John Johnson; Andrew Kitchen; Aleksei K Kasparov; Young-Mi Kwon; Pavel A Nikolskiy; Carlos Peraza Lope; Aurélie Manin; Terrance Martin; Michael Meyer; Kelsey Noack Myers; Mark Omura; Jean-Marie Rouillard; Elena Y Pavlova; Paul Sciulli; Mikkel-Holger S Sinding; Andrea Strakova; Varvara V Ivanova; Christopher Widga; Eske Willerslev; Vladimir V Pitulko; Ian Barnes; M Thomas P Gilbert; Keith M Dobney; Ripan S Malhi; Elizabeth P Murchison; Greger Larson; Laurent A F Frantz Journal: Science Date: 2018-07-06 Impact factor: 47.728
Authors: Kevin Gori; Andrea Strakova; Adrian Baez-Ortega; Janice L Allen; Karen M Allum; Leontine Bansse-Issa; Thinlay N Bhutia; Jocelyn L Bisson; Cristóbal Briceño; Artemio Castillo Domracheva; Anne M Corrigan; Hugh R Cran; Jane T Crawford; Eric Davis; Karina F de Castro; Andrigo B de Nardi; Anna P de Vos; Laura Delgadillo Keenan; Edward M Donelan; Adela R Espinoza Huerta; Ibikunle A Faramade; Mohammed Fazil; Eleni Fotopoulou; Skye N Fruean; Fanny Gallardo-Arrieta; Olga Glebova; Pagona G Gouletsou; Rodrigo F Häfelin Manrique; Joaquim J G P Henriques; Rodrigo S Horta; Natalia Ignatenko; Yaghouba Kane; Cathy King; Debbie Koenig; Ada Krupa; Steven J Kruzeniski; Young-Mi Kwon; Marta Lanza-Perea; Mihran Lazyan; Adriana M Lopez Quintana; Thibault Losfelt; Gabriele Marino; Simón Martínez Castañeda; Mayra F Martínez-López; Michael Meyer; Edward J Migneco; Berna Nakanwagi; Karter B Neal; Winifred Neunzig; Máire Ní Leathlobhair; Sally J Nixon; Antonio Ortega-Pacheco; Francisco Pedraza-Ordoñez; Maria C Peleteiro; Katherine Polak; Ruth J Pye; John F Reece; Jose Rojas Gutierrez; Haleema Sadia; Sheila K Schmeling; Olga Shamanova; Alan G Sherlock; Maximilian Stammnitz; Audrey E Steenland-Smit; Alla Svitich; Lester J Tapia Martínez; Ismail Thoya Ngoka; Cristian G Torres; Elizabeth M Tudor; Mirjam G van der Wel; Bogdan A Viţălaru; Sevil A Vural; Oliver Walkinton; Jinhong Wang; Alvaro S Wehrle-Martinez; Sophie A E Widdowson; Michael R Stratton; Ludmil B Alexandrov; Iñigo Martincorena; Elizabeth P Murchison Journal: Science Date: 2019-08-02 Impact factor: 47.728
Authors: Anders Bergström; Laurent Frantz; Ryan Schmidt; Erik Ersmark; Ophelie Lebrasseur; Linus Girdland-Flink; Audrey T Lin; Jan Storå; Karl-Göran Sjögren; David Anthony; Ekaterina Antipina; Sarieh Amiri; Guy Bar-Oz; Vladimir I Bazaliiskii; Jelena Bulatović; Dorcas Brown; Alberto Carmagnini; Tom Davy; Sergey Fedorov; Ivana Fiore; Deirdre Fulton; Mietje Germonpré; James Haile; Evan K Irving-Pease; Alexandra Jamieson; Luc Janssens; Irina Kirillova; Liora Kolska Horwitz; Julka Kuzmanovic-Cvetković; Yaroslav Kuzmin; Robert J Losey; Daria Ložnjak Dizdar; Marjan Mashkour; Mario Novak; Vedat Onar; David Orton; Maja Pasarić; Miljana Radivojević; Dragana Rajković; Benjamin Roberts; Hannah Ryan; Mikhail Sablin; Fedor Shidlovskiy; Ivana Stojanović; Antonio Tagliacozzo; Katerina Trantalidou; Inga Ullén; Aritza Villaluenga; Paula Wapnish; Keith Dobney; Anders Götherström; Anna Linderholm; Love Dalén; Ron Pinhasi; Greger Larson; Pontus Skoglund Journal: Science Date: 2020-10-29 Impact factor: 47.728