Literature DB >> 27141312

Correlation of rpsU Gene Sequence Clusters and Biochemical Properties, Gc-Ms Spectra and Resistance Profiles of Clinical Burkholderia Spp. Isolates.

Maria Franziska Ostermann1, Heinrich Neubauer2, Hagen Frickmann3, Ralf Matthias Hagen4.   

Abstract

This study assessed the variation of phenotypic features of clinical isolates of Burkholderia spp. from common rpsU gene sequence clusters. A total of 41 clinical Burkholderia spp. isolates from German mucoviscidosis patients was subjected to rpsU gene sequencing. Biochemical assessment included the API systems 20 NE and 50 CHE as well as the Micronaut NF system. Fatty acid patterns were assessed using gas chromatography-mass spectrometry (GC-MS). Broth microdilution was used to identify minimum inhibitory concentrations. Five rpsU gene sequence clusters comprised more than one clinical isolate. Altogether, assignments to three species and seven clusters comprising more than one Burkholderia species were performed. Inhomogeneity of biochemical reactions within the clusters ranged from 0/28 to 45/50 reactions. The standard deviation for fatty acid distributions ranged from 0% to 11.5%. Minimum inhibitory concentrations within the clusters showed a wide variation but only minor differences between the clusters. Broad variations within identified rpsU gene sequence clusters regarding biochemical reactions, fatty acid patterns, and resistance patterns of clinical Burkholderia spp. isolates make the application of rpsU gene sequence analysis as a stand-alone procedure for discriminations within the Burkholderia cepacia complex unreliable.

Entities:  

Keywords:  Burkholderia; GC–MS; biochemical differentiation; clinical isolates; resistance; ribosomal protein S21; rpsU; typing

Year:  2016        PMID： 27141312      PMCID： PMC4838983          DOI： 10.1556/1886.2016.00002

Source DB:  PubMed          Journal:  Eur J Microbiol Immunol (Bp)        ISSN： 2062-509X


Introduction

Sequence analysis of the rpsU gene has been assessed as a potential tool for the discrimination of Burkholderia spp. beyond the genus level in previous studies [1-3]. The procedure allows for a discrimination of the environmental commensal species Burkholderia thailandensis from the phylogenetically closely related pathogens Burkholderia mallei and Burkholderia pseudomallei [2]. Further, rpsU gene sequencing can be used for a discrimination of this B. pseudomallei complex from other facultatively pathogenic or just environmental Burkholderia spp. The sequences of references strains grouped in four major clusters. Within these clusters, however, differentiation on species level was found to be unreliable [3]. While the discriminative power of rpsU gene sequencing has been well characterized with sequences from reference strains [3], respective analyses for clinical Burkholderia isolates are missing so far. Therefore, clinical isolates that had been biochemically characterized as Burkholderia cepacia by API 20 NE (BioMérieux, Marcy-l’Étoile, France) were subjected to rpsU gene clustering. The isolates from the resulting clusters were analyzed for homogeneity or heterogeneity regarding biochemical features, composition of fatty acids, and resistance patterns. By doing so, it was assessed whether the rpsU gene clusters indeed indicate clusters of phenotypically related Burkholderia spp. isolates, which might be of use for diagnostic purposes, or whether they are clustered without further relevance for the diagnostic microbiological laboratory.

Methods

Clinical isolates

In the 1990s, a total of 41 clinical Burkholderia spp. isolates from different mucoviscidosis patients were collected in Munich, Germany. All strains were subjected to biochemical differentiation by API 20 NE (BioMérieux), resulting in the preliminary diagnosis of B. cepacia. Considering the low discriminative potential of API 20 NE within the Burkholderia genus, all respective isolates were subjected to further molecular and phenotypic assessment as detailed below. To avoid the inclusion of copy strains, only one isolate per patient was used for further assessments. Due to events of losing strains during subculture passages, not all assessments could be performed for all strains.

rpsU gene sequence clustering

All 41 strains were subjected to rpsU gene PCR and sequencing as described previously [2, 3] to obtain 169-base-pair sequences. Due to a required minimum of 200 bp, the obtained short sequence fragments could not be deposited at NCBI GenBank and are thus presented in the electronic supplementary material (. All obtained sequences were clustered with the previously presented sequences from Burkholderia spp. reference strains [3] and well-characterized strains of the B. pseudomallei complex [2] using the software BioNumerics 7.1 (Applied Maths, Sint-Martens-Latem, Belgium). Species assignment was based on closest proximity to sequences of a reference strain and a variance to the reference sequence of <1%. In case of two “out-standers”, identification was based on a NCBI GenBank search with a detected sequence identity of ≥99%. In case of more than one match, all matching species were indicated, divided by the acronym “DD” (differential diagnosis).

Biochemical characterization

Next to the abovementioned API 20 NE (BioMérieux), the strains were analyzed with the API 50 CHE system (BioMérieux) and the Micronaut NF ID system (MERLIN Gesellschaft für mikrobiologische Diagnostika mbH, Bornheim-Hersel, Germany). The diagnostic procedure was performed as described by the manufacturers.

Characterization of fatty acid patterns

Bacterial fatty acids of the Burkholderia spp. isolates were assessed using GC–MS (gas chromatography–mass spectrometry) with a trimethylsulfoniumhydroxide (TMSH)-based procedure as previously described [4]. In short, saponification of the fatty acids of the bacteria is driven by TMSH, resulting in TMSH salts. These salts are split at 260 °C in the injector block of the gas chromatograph into dimethylsulfide and the methyl esters of the respective fatty acids. The methyl esters are afterwards divided by gas chromatography.

Characterization of resistance patterns

Susceptibility of the assessed strains towards antibiotic drugs was assessed by traditional broth microdilution testing to identify the minimum inhibitory concentration. Broth microdilution was performed in customer-designed broth microdilution plates (MERLIN Gesellschaft für mikrobiologische Diagnostika mbH). The assessed antibiotic drugs comprised both substances for Gram-positive and Gram-negative bacteria, i.e., amikacin, netilmicin, tobramycin, streptomycin, kanamycin, neomycin, spectinomycin, penicillin G, amoxicillin, azlocillin, piperacillin, ticarcillin, oxacillin, ampicillin sulbactam, sulbactam, cefaclor, cefixime, apramycin, cefpodoxime, loracarbef, cefdinir, cefetamet, ceftibuten, cefazolin, cefotaxime, ceftriaxone, cefotixin, ceftazidime, cefoperazone, cefotiam, mezlocillin, aztreonam, imipenem, amoxicillin clavulanate, meropenem, piperacillin tazobactam, biapenem, ribostamycin, pipemidic acid, norfloxacin, ofloxacin, ciprofloxacin, enoxacin, fleroxacin, pefloxacin, sparfloxacin, erythromycin, clindamycin, lincomycin, roxithromycin, clarithromycin, azithromycin, quinopristin/dalfopristin, livitomycin A, tetracycline, doxycycline, minocycline, chloramphenicol, sulfamethoxazole, nitrofurantoin, cotrimoxazole, trimethoprim, fosfomycin, vancomycin, rifampicin, teicoplanin, fusidic acid, cefepime, dalfopristin, and quinopristin.

Ethics

No ethical clearance was necessary because this study did not include patients, patient data, or patient materials.

Results

Observed rpsU gene sequence clusters

In eight out of 41 Burkholderia spp. isolates, rpsU gene sequence clustering allowed for an assignment on species level. The resulting species comprised B. cepacia (n = 5), Burkholderia multivorans (n = 2), and Burkholderia glumae (n = 1). For the remaining 33 out of 41 Burkholderia spp., no unambiguous assignment at species level was possible, resulting in seven clusters B. multivorans DD Burkholderia caryophili (n = 25), B. cepacia DD Burkholderia vietnamiensis (n = 2), B. cepacia DD Burkholderia cenocepacia (n = 2), B. cepacia DD B. vietnamiensis DD B. cenocepacia DD Burkholderia ambifaria (n = 1), B. cepacia DD B. vietnamiensis DD Burkholderia anthina DD B. ambifaria (n = 1), Burkholderia gladioli DD Burkholderia cocovenenans (n = 1), and Burkholderia caribensis DD Burkholderia hospita (n = 1), respectively. Adjusted to the previously suggested rpsU gene clusters [3], two isolates could be assigned to cluster rpsU-I, zero isolates to rpsU-II, 36 isolates to rpsU-III, and one isolate to rpsU-IV, respectively. The sequences of two isolates, one strain B. multivorans and one strain B. cepacia DD B. vietnamiensis DD B. ambifaria DD B. cenocepacia, could not be assigned to any of the proposed clusters [3] and had to be identified by NCBI BLAST search.

Biochemical features within the observed clusters

API 20 NE profiles were available for 40 out of 41 isolates. For one isolate B. multivorans DD B. caryophili, the profile had been lost and could not be reassessed because the isolate had died during passage. Data from API 50 CHE and Micronaut NF could be assessed for 38 out of 41 isolates. The detailed biochemical profiles of the API 20 NE, API 50 CHE, and Micronaut NF systems are depicted in , respectively. Homogeneity of the biochemical patterns was assessed for all clusters with more than one isolate. Regarding API 20 NE, inhomogeneity was observed for 8/20 reactions in the B. multivorans DD B. caryophili cluster, for 3/20 reactions in the B. cepacia DD B. vietnamiensis cluster, for 1/20 reactions in the B. cepacia DD B. cenocepacia cluster, for 3/20 reactions in the B. multivorans cluster, and for 4/20 reactions in the B. cepacia cluster (. Regarding API 50 CHE, inhomogeneity was observed for 45/50 reactions in the B. multivorans DD B. caryophili cluster, for 3/50 reactions in the B. cepacia DD B. vietnamiensis cluster, for 24/50 reactions in the B. cepacia DD B. cenocepacia cluster, for 25/50 reactions in the B. multivorans cluster, and for 31/50 reactions in the B. cepacia cluster (. Regarding Micronaut NF, inhomogeneity was observed for 11/28 reactions in the B. multivorans DD B. caryophili cluster, for 3/28 reactions in the B. cepacia DD B. vietnamiensis cluster, for 2/28 reactions in the B. cepacia DD B. cenocepacia cluster, for 0/28 reactions in the B. multivorans cluster, and for 7/28 reactions in the B. cepacia cluster after 24 h. Of note, an increase in the percentage of isolates showing N-acetyl-glucosamine assimilation was observed after 48 h (.

Composition of fatty acid patterns within the observed clusters

The patterns of fatty acid distribution of the Burkholderia spp. strains are shown in . The standard deviations for the individual tested fatty acids for the B. multivorans DD B. caryophili cluster ranged from 0% to 11.5%, for the B. cepacia DD B. vietnamiensis cluster from 0% to 5.5%, for the B. cepacia DD B. cenocepacia cluster from 0% to 2.7%, and for the B. cepacia cluster from 0% to 3.77% (.

Compositions of resistance patterns within the observed clusters

Details on the detected minimum inhibitory concentration of the tested antimicrobial substances are shown in the electronic supplementary material (. Varieties of up to 17 serial dilution steps were observed for the rpsU gene sequence clusters. In direct comparison of the B. multivorans DD B. caryophili cluster and the B. cepacia cluster, lower minimum inhibitory concentrations were observed for the aminoglycosides gentamycin, tobramycin, streptomycin, kanamycin, neomycin, and spectinomycin in the B. cepacia cluster. Among the β-lactam antibiotics, the lowest minimum inhibitory concentrations were observed for oxacillin. For all tested fluoroquinolones, a broad range of minimum inhibitory concentrations was measured (.

Discussion

The rpsU gene codes for the ribosomal protein S21 [2, 3]. Its role in the biochemical processes of the bacterial cell is a topic of ongoing research. A previous study indicated a role of ribosomal protein S21 for motility and biofilm formation of Bacillus subtilis [5]. Research with Helicobacter pylori suggests a potential role of rpsU gene mutations for metronidazole resistance [6]. In Listeria monocytogenes strains, influence of rpsU gene variants on stress resistance in vital cells could be demonstrated [7]. In the field of diagnostic microbiology, rpsU gene sequencing has been assessed for its discriminatory potential in the field of Burkholderia spp. differentiation. As previously demonstrated, the procedure is suited to discriminate highly pathogenic B. mallei/B. pseudomallei [8] from environmental B. thailandensis strains within the B. pseudomallei complex [2]. The respective sequence cluster of analyzed strains of the B. pseudomallei complex was later shown to form a distinct cluster rpsU-II that can be well discriminated from other Burkholderia spp. [3]. Within other rpsU gene sequence clusters, however, sequence comparison of well characterized reference strains showed high similarity, not allowing for reliable discrimination on species level within the B. cepacia complex [3]. The respective analysis, however, included reference strains only and did not include phenotypic features of the strains. Therefore, a potential correlation of rpsU gene sequence clustering and phenotypical properties of clinical Burkholderia spp. isolates remained completely unclear so far. To address this topic, clinical Burkholderia spp. strains from mucoviscidosis patients that had been identified as “B. cepacia” by API 20 NE were included in the study. The lacking reliability of biochemical assessments for the discrimination of Burkholderia spp. on species level has been repeatedly demonstrated [9-12]. Accordingly, the isolates were subjected to rpsU gene sequencing for further discrimination. The 41 isolates were assigned to three species and seven clusters of species groups, not allowing for an unambiguous assignment. This phenomenon confirms the results as observed for the reference strains in the previous assessment [3], limiting the diagnostic value of rpsU gene sequencing on species level. Interestingly, two out-standers were observed that did not match with any of the described rpsU gene sequence clusters [3] at all. This observation challenges the assumption of relative genetic stability of the rpsU gene region within distinct Burkholderia spp. [13]. Studies with larger sample counts might demonstrate further variability, making its diagnostic potential even less valuable. Biochemical data of species or species group assignments that comprise more than one strain suggest a broad phenotypic heterogeneity. This phenomenon was observed for all three assessed biochemical identification systems. Accordingly, it is highly likely that different species were assigned to the same rpsU gene sequence cluster. This was not only the case for assignments to species groups comprising more than one Burkholderia spp. The B. cepacia cluster and the B. multivorans cluster demonstrated considerable biochemical heterogeneity as well. This suggests incorrect assignments if just the rpsU gene sequence is considered. The same applies to the results of the fatty acid assessments. Cluster-depending standard deviations of up to 11.5% within a certain rpsU gene sequence cluster express a variability that does not speak in favor of a correct assignment on species level [4]. The broad variability of the genetic resistance patterns is interesting but does not provide much information with regards to the source of the isolates. For patients with a medical history of mucoviscidosis, numerous previous antibiotic therapies have to be assumed. No patient specific data were available for this study. Nevertheless, selection of resistant strains in mucoviscidosis patients under repeated antibiotic pressure is highly likely, potentially accounting for the broad spectrum of minimum inhibitory concentrations of fluoroquinolones. Of note, the obvious shift in the resistance patterns for aminoglycosides between the B. multivorans DD B. caryophili cluster and the B. cepacia cluster makes an assignment of distinguishable species to these clusters nevertheless plausible. The study has a number of limitations. First of all, not all strains could be included in all assessments. Even API 20 NE data of one isolate got lost. Some assessments could not be performed because the respective strains had died during passage from one culture or storage medium to another. The more important limitation is the fact that no definite species assignments, e.g., by recA gene [14-16], fur gene [17], or hisA gene [18] sequence typing, or by multiple-locus sequence typing (MLST) [16, 19], could be performed. Limited financial capacities allowed for sequence analysis of the rpsU gene with a respective cluster assignment only. Accordingly, conclusions about phenotypic properties of Burkholderia spp. apart from the performed assignment on rpsU gene sequence level cannot be drawn from the presented data.

Conclusions

The assessed data demonstrate a broad phenotypic heterogeneity of clinical Burkholderia spp. isolates that are assigned to common rpsU gene sequence clusters. These data confirm previous results with sequences of reference strains [3] and underline the low discriminatory potential of rpsU gene sequencing of Burkholderia spp. isolates for diagnostic purposes, that is basically restricted to a delineation from the rpsU-II cluster comprising the B. pseudomallei complex [2, 3]. If any, the diagnostic use of rpsU gene sequence analysis could be limited to implementations into MLST schemes. Future studies are, however, necessary to confirm or deny this hypothesis.
Table 1.

API 20 NE results

Species/species groupsReduction of potassium nitrate (%)Indol production from tryptophan (%)Glucose fermentation (%)Arginine hydrolysis (%)Urea hydrolysis (%)
B. multivorans DDB. caryophili (n = 24)91.701304.2
B. cepacia DDB. vietnamiensis (n = 2)00000
B. cepacia DDB. cenocepacia (n = 2)1000000
B. cepacia DDB. vietnamiensis DDB. cenocepacia DDB. ambifaria (n = 1)00000
B. cepacia DDB. vietnamiensis DDB. anthina DD B. ambifaria (n = 1)1000000
B. multivorans (n = 2)1000000
B. gladioli DDB. cocovenenans (n = 1)100010000
B. glumae (n = 1)1000000
B. cepacia (n = 5)200000
B. caribensis DD B. hospita (n = 1)00000
Table 2.

API 50 CHE results

Species/species groupsControl (%)Glycerol (%)Erythritol (%)D-Arabinose (%)L-Arabinose (%)Ribose (%)D-Xylose (%)L-Xylose (%)Adonitol (%)β-Methylxyloside (%)
B. multivorans DDB. caryophili (n = 24)4.258.316.762.779.229.237.533.358.320.8
B. cepacia DDB. vietnamiensis (n = 2)0000000000
B. cepacia DDB. cenocepacia (n = 2)000050050000
B. cepacia DDB. vietnamiensis DDB. cenocepacia DDB. ambifaria (n = 1)00001000100000
B. cepacia DDB. vietnamiensis DDB. anthina DDB. ambifaria (n = 1)0000000000
B. multivorans (n = 2)0500100100050505050
B. gladioli DDB. cocovenenans (n = 1)010000000000
B. cepacia (n = 5)02006040080206040
Table 3.

Micronaut NF results

Species/species groupsOxidase (%)Indole (%)Esculin (%)Urease (%)Ornithindecarboxylase (%)Arginindihydrolase (%)Glucose fermentation (%)Saccarose fermentation (%)
B. multivorans DDB. caryophili in = 24)1000004.201008.3
B. cepacia DDB. vietnamiensis (n = 2)10000050010050
B. cepacia DDB. cenocepacia (n = 2)10000050010050
B. cepacia DDB. vietnamiensis DDB. cenocepacia DDB. ambifaria (n = 1)10000000100100
B. cepacia DDB. vietnamiensis DDB. anthina DDB. ambifaria (n = 1)100000100000
B. multivorans (n = 1)100000001000
B. cepacia (n = 5)100000008080
B. caribensis DDB. hospita (n = 1)1000000000

* Varying results after 48 h of incubation in comparison to 24 h of incubation

Table 4.

Mean values (± standard deviations) of fatty acid methyl ester groups

Species/species groups12:00 (%)14:01 (%)14:00 (%)15:00 (%)
B. multivorans DD B. caryophili (n = 24)0(0)0.1(0.1)1.6(1.1)0.1(0.1)
B. cepacia DD B. vietnamiensis (n = 2)4.4(5.5)0(0)0.6(0.1)0.3 (0)
B. cepacia DD B. cenocepacia (n = 2)0(0)0(0)2.2(0.3)0(0)
B. cepacia DD B. vietnamiensis DD B. cenocepacia DD B. ambifaria (n = 1)002.70.3
B. cepacia DD B. vietnamiensis DD B. anthina DD B. ambifaria (n = 1)1.200.70.2
B. multivorans (n = 1)002.00
B. glumae (n = 1)002.90.1
B. cepacia (n = 5)0(0)0(0)1.2(0.7)0(0)
B. caribensis DD B. hospita (n = 1)002.10

* Left-shifted peak

+ Right-shifted peak

Supporting information 1.

Obtained The length of ≤169 base pairs between the primers did not allow deposition at NCBI GenBank.

New rpsU sequences as obtained with the primers fup1 and fup2 (fasta format).
>B46_Burkholderia_multivorans_DD_Burkholderia_caryophylliCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGCCATA
>B51_Burkholderia_multivorans_DD_Burkholderia_caryophylliGGCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>B52_Burkholderia_multivorans_DD_Burkholderia_caryophylliGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGCCATA
>B53_Burkholderia_multivorans_DD_Burkholderia_caryophylliGCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGCCGTCATA
>B106_Burkholderia_multivorans_DD_Burkholderia_caryophylliCGTGGCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>B111_Burkholderia_multivorans_DD_Burkholderia_caryophylliTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>B120_Burkholderia_multivorans_DD_Burkholderia_caryophylliCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGCTTTCTTTCAAAAGAATCGTCGTCATA
>B122_Burkholderia_multivorans_DD_Burkholderia_caryophylliCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>B126_Burkholderia_multivorans_DD_Burkholderia_caryophylliAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P260_Burkholderia_multivorans_DD_Burkholderia_caryophylliCATCTGGCTGCGCAGGCGCTTGTGCAGACGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P261_Burkholderia_multivorans_DD_Burkholderia_caryophylliCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P262_Burkholderia_multivorans_DD_Burkholderia_caryophylliGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P264_Burkholderia_multivorans_DD_Burkholderia_caryophylliGGCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P265_Burkholderia_multivorans_DD_Burkholderia_caryophylliCTGGCTGCGCAGGCGCTTGTGCAGACGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P266_Burkholderia_multivorans_DD_Burkholderia_caryophylliGGTCGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P267_Burkholderia_multivorans_DD_Burkholderia_caryophylliGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P268_Burkholderia_multivorans_DD_Burkholderia_caryophylliCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P269_Burkholderia_multivorans_DD_Burkholderia_caryophylliCATCTGGCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P270_Burkholderia_multivorans_DD_Burkholderia_caryophylliCTGCGCAGGCGCTTGTGCAGACGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P271_Burkholderia_multivorans_DD_Burkholderia_caryophylliGGCTGCGCAGGCGCTTGTGCAGACGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P272_Burkholderia_multivorans_DD_Burkholderia_caryophylliCATCTGGCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P273_Burkholderia_multivorans_DD_Burkholderia_caryophylliGGCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P276_Burkholderia_multivorans_DD_Burkholderia_caryophylliGACGGCTGTTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P277_Burkholderia_multivorans_DD_Burkholderia_caryophylliGGCTGCGCAGACGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P320_Burkholderia_multivorans_DD_Burkholderia_caryophylliGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>B54_Burkholderia_cepaciaGCTGCGCAGGCGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCACGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCACGGCGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P258_Burkholderia_cepaciaGGCTGCGCAGGCGCTTATGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGTTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCACGGCGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P278_Burkholderia_cepaciaCTGGCTGCGCAGGCGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCACGGCGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P308_Burkholderia_cepaciaGGCTGCGCAGGCGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCACGGCGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P310_Burkholderia_cepaciaGCATCTGGCTGCGCAGGCGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCACGGCGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P8_Burkholderia_vietnamiensis_DD_Burkholderia_cepaciaCTGGCTGCGCAGGCGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGTTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGTTCGCGCAGCTCAGCGATCAGGCCATTTTTTTCGATAGCACGGCGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P154_Burkholderia_vietnamiensis_DD_Burkholderia_cepaciaGCATCTGGCTGCGCAGGCGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGTTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGTTCGCGCAGCTCAGCGATCAGGCCATTTTTTTCGATAGCACGGCGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P112_Burkholderia_cepacia_DD_Burkholderia_cenocepaciaCTGGCTGCGCAGGCGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAAGACTGGCGCTCACGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P275_Burkholderia_cepacia_DD_Burkholderia_cenocepaciaGGCTGCGCAGGCGCTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAAGACTGGCGCTCACGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P113_Burkholderia_cepacia_DD_Burkholderia_vietnamiensis_DD_Burkholderia_ambifaria_DD_Burkholderia_cenocepaciaCGAGCCGTTCGAAGTGGCGATTCGCCGCTTTCGCCGTGCTATCGAAAAAAATGGCCTGATCGCTGAACTGCGCGAACGCCAGTCCTACGAAAAGCCGACCGCAGTCCGCAAGCGCAAGAAGGCAGCAGCCGTCAAGCGCCTGCATAAGCGCCTGCGCAGCCAGATGCTGCCGAAGAAGCTCCACA
>P153_Burkholderia_multivoransAGCCGTTCGAAGTGGCGATTCGCCGCTTTCGTCGCGCTATCGAAAAAAATGGCCTGATCGCTGAACTGCGCGAGCGCCAGTCCTACGAAAAGCCGACCGCAGTCCGCAAGCGCAAGAAGGCAGCAGCCGTCAAGCGCCTGCACAAGCGTCTGCGCAGCCAGATGCTGCCGAAGAAGCTCCACA
>P259_Burkholderia_multivoransGCGCAGGCGCTTGTGCAGACGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCGCGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCGCGACGAAAGCGGCGAATCGCCACTTCGAACGGCTCGTTTTCTTTCAAAAGAATCGTCGTCATA
>P223_Burkholderia_gladioli_DD_Burkholderia_cocovenenansGGCTGCGCAGGCGCTTGTGCAGGCGCTTCACGGCCGCGGCCTTCTTGCGCTTGCGCACGGCAGTCGGCTTCTCGTACGACTGGCGCTCACGCAGCTCAGCGATCAGGCCGTTCTTTTCGATCGCGCGGCGGAAGCGGCGGATCGCTACTTCGAACGGCTCGTTTTCCTTCAAAAGAATCGTCGTCATAA
>P307_Burkholderia_glumaeGGCTGCGCAGGCGCTTGTGCAGGCGCTTGACTGCCGCGGCCTTCTTGCGCTTGCGCACCGCCGTCGGCTTTTCGTAAGACTGGCGCTCACGCAGTTCAGCGATCAGGCCGTTCTTTTCGATCGCGCGGCGAAAGCGGCGAATCGCTACTTCGAACGGCTCGTTTTCCTTCAAAAGAATCGTCGTCATAA
>P309_Burkholderia_caribensis_DD_Burkholderia_hospitaTGCGCAGGCGCTTGTGCAGGCGCTTCACTGCAGCTGCCTTCTTGCGCTTACGTGCCGTCGTCGGCTTTTCGTACGCCTGGCGCTCACGCAGTTCTGCGATCAGGCCATTCTTTTCGATTGCGCGGCGGAAGCGGCGGATTGCCACTTCGAACGGCTCGTTTTCCTTCAAAAGAATCGTCGTCATA
>P263_Burkholderia_cepacia_DD_Burkholderia_vietnamiensis_DD_Burkholderia_anthina_DD_Burkholderia_ambifariaGGCGTTTGTGCAGGCGCTTGACGGCTGCTGCCTTCTTGCGCTTGCGGACTGCGGTCGGCTTTTCGTAGGACTGGCGCTCACGCAGTTCAGCGATCAGGCCATTTTTTTCGATAGCACGGCGAAAGCGGCGAATCGCCACTTCGAACGGTTCGTTTTCTTTCAAAAGAATCGTCGTCATA
Supporting information 2.

Measured minimum inhibitory concentrations (MIC) via broth microdilution.

MIC (mg/L)<0.03<0. 06<0.1 250.1 250.2 50.5124>48>816>1632>3264>64128>128256>256512>512>6 12
Amikacin1
B. multivorans DD00000000001/204/21/28/205/204/201/20000
B. caryophili (n=24)4444444
B. cepacia DD00000000000000001/100000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000001/201/200000000
B. cenocepacia (n=2)
B. cepacia DD00000000000000001/100000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)001/50000000003/501/50000000000
Gentamycin
B. multivorans DD0000000000004/208/209/203/2000000
B. caryophili (n=24)4444
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000001/201/200000000
B. cenocepacia (n=2)
B. cepacia DD00000000000000001/100000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)0001/5000000001/502/501/500000000
Netilmicin
B. multivorans DD000000000000007/2012/03/22/200000
B. caryophili (n=24)42444
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000001/201/2000000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000000001/1000000
B. cepacia (n=5)00001/50000000002/502/500000000
Tobramycin
B. multivorans DD00000000005/207/208/204/200000000
B. caryophili (n=24)4444
B. cepacia DD000000000000001/10000000000
B. vietnamiensis (n=1)
B. cepacia DD0000000000001/10001/100000000
B. cenocepacia (n=2)
B. cepacia DD000000000000001/10000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000001/10000000000
B. cepacia (n=5)00001/5000003/501/5000000000000
Streptomycin
B. multivorans DD0000000000000000002/205/217/000
B. caryophili (n=24)4424
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000000000002/2000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000000000001/1000
B. cepacia (n=5)000000001/50000000001/502/51/5000
Kanamycin
B. multivorans DD000000003/204/21/28/206/202/200000000
B. caryophili (n=24)444444
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000001/201/2000000
B. cenocepacia (n=2)
B. cepacia DD00000000000000001/100000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000001/1000000000000
B. cepacia (n=5)00001/50001/501/501/50001/500000000
Neomycin
B. multivorans DD00000000005/206/207/204/201/21/200000
B. caryophili (n=24)444444
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000001/201/200000000
B. cenocepacia (n=2)
B. cepacia DD00000000000000001/100000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000001/10000000000
B. cepacia (n=5)00001/50001/501/502/5000000000000
Spectinomycin
B. multivorans DD0000000000001/205/204/208/203/23/2000
B. caryophili (n=24)444444
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000000001/2001/2000
B. cenocepacia (n=2)
B. cepacia DD-------------------------
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=0)
B. multivorans (n=1)0000000000000000001/1000000
B. cepacia (n=5)000000001/5000001/502/501/5000000
Penicillin G
B. multivorans DD00000000001/201/202/220/000000000
B. caryophili (n=24)44424
B. cepacia DD0000000000000001/1000000000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000002/2000000000
B. cenocepacia (n=2)
B. cepacia DD0000000000000001/1000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000001/1000000000000
B. cepacia (n=5)00000000001/500004/5000000000
Amoxicillin
B. multivorans DD0000000000002/200000022/00000
B. caryophili (n=24)424
B. cepacia DD00000000000000000001/100000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000000002/200000
B. cenocepacia (n=2)
B. cepacia DD00000000000000000001/100000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000001/1000000000000
B. cepacia (n=5)00000000000000001/5004/500000
Azlocillin
B. multivorans DD0000001/277/202/21/21/20002/20002/201/200
B. caryophili (n=24)44444444
B. cepacia DD000000000000000000001/10000
B. vietnamiensis (n=1)
B. cepacia DD000000000000001/2000001/20000
B. cenocepacia (n=2)
B. cepacia DD0000000000001/1000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000001/100000000000000
B. cepacia (n=5)0000001/51/5001/501/500000001/50000
Piperacillin
B. multivorans DD0000006/24/24/21/22/21/22/202/202/201/2000000
B. caryophili (n=24)4444444444
B. cepacia DD000000000000000001/1000000
B. vietnamiensis (n=1)
B. cepacia DD0000000000001/2000001/2000000
B. cenocepacia (n=2)
B. cepacia DD000000001/10000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000001/100000000000000
B. cepacia (n=5)0000001/51/52/500000001/500000000
Ticarcillin
B. multivorans DD0000000000001/204/201/205/204/38/2000
B. caryophili (n=23)333323
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000000000002/2000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)0000000000001/5000001/5003/5000
Oxacillin
B. multivorans DD22/2000000000002/2000000000000
B. caryophili (n=24)44
B. cepacia DD1/1000000000000000000000000
B. vietnamiensis (n=1)
B. cepacia DD2/2000000000000000000000000
B. cenocepacia (n=2)
B. cepacia DD1/1000000000000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)1/1000000000000000000000000
B. cepacia (n=5)5/5000000000000000000000000
Ampicillin sulbactam
B. multivorans DD00000002/20000001/201/206/214/00000
B. caryophili (n=24)444424
B. cepacia DD00000000000000000001/100000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000000002/200000
B. cenocepacia (n=2)
B. cepacia DD00000000000000000001/100000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000001/100000000000000000
B. cepacia (n=5)0000000000001/0 50001/501/52/500000
Sulbactam
B. multivorans DD00000004/25/205/2000001/20001/202/21/240
B. caryophili (n=24)444444
B. cepacia DD00000000000000000000001/100
B. vietnamiensis (n=1)
B. cepacia DD0000000000001/200000000001/20
B. cenocepacia (n=2)
B. cepacia DD000000000000001/10000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000001/10000000000000000
B. cepacia (n=5)000000002/50001/50001/501/5000000
Cefaclor
B. multivorans DD000000000000005/207/203/29/200000
B. caryophili (n=24)4444
B. cepacia DD00000000000000000001/100000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000000002/200000
B. cenocepacia (n=2)
B. cepacia DD00000000000000000001/100000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)00000000001/5000001/5003/500000
Cefixime
B. multivorans DD0000005/28/24/201/202/200004/20000000
B. caryophili (n=24)444444
B. cepacia DD00000000000000001/100000000
B. vietnamiensis (n=1)
B. cepacia DD0000001/20000000001/200000000
B. cenocepacia (n=2)
B. cepacia DD00000001/100000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000001/51/52/51/50000000000000000
Apramycin
B. multivorans DD000000000000004/205/2012/3/200000
B. caryophili (n=24)44244
B. cepacia DD00000000000000000001/100000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000001/2001/200000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000000001/1000000
B. cepacia (n=5)0000000000001/50002/502/5000000
Cefpodoxime
B. multivorans DD000000009/205/201/201/206/22/20000000
B. caryophili (n=24)444444
B. cepacia DD00000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD00000001/2000000001/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)0000001/501/502/501/5000000000000
Loracarbef
B. multivorans DD000000000000001/201/203/204/215/000
B. caryophili (n=24)0444424
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis (n=1)
B. cepacia DD000000000000002/20000002/2000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000000001/1000000
B. cepacia (n=5)000000000000001/50001/5003/5000
Cefdinir
B. multivorans DD00000007/23/205/20001/204/24/20000000
B. caryophili (n=24)444444
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD00000000001/20000001/20000000
B. cenocepacia (n=2)
B. cepacia DD0000000000001/1000000000000
B. vietnamiensis DD
B. cenocepacia
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)00000001/51/50002/501/50000000000
Cefetamet
B. multivorans DD0000000000001/206/208/29/20000000
B. caryophili (n=24)4444
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000001/2001/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000000000001/100000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000000000000002/502/51/50000000
Ceftibuten
B. multivorans DD000000006/206/206/200006/20000000
B. caryophili (n=24)4444
B. cepacia DD000000000000001/10000000000
B. vietnamiensis (n=1)
B. cepacia DD000000001/2000001/20000000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000000002/502/501/5000000000000
Cefazolin
B. multivorans DD00000000000000000000024/000
B. caryophili (n=24)24
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000000000002/2000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000000000001/1000
B. cepacia (n=5)0000000000000000000005/5000
Cefotaxime
B. multivorans DD000000009/206/20004/204/21/20000000
B. caryophili (n=24)44444
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD000000001/2000000001/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)00000001/51/502/501/5000000000000
Ceftriaxone
B. multivorans DD000001/27/25/21/202/20004/203/21/20000000
B. caryophili (n=24)44444444
B. cepacia DD00000000000000001/100000000
B. vietnamiensis (n=1)
B. cepacia DD00000001/20000000001/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)00000002/51/501/5000001/500000000
Cefoxitin
B. multivorans DD00000000000000005/219/0000000
B. caryophili (n=24)424
B. cepacia DD00000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000001/21/20000000
B. cenocepacia (n=2)
B. cepacia DD000000000000000001/10000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000000000000001/502/52/50000000
Cefuroxime
B. multivorans DD00000000006/207/20009/22/20000000
B. caryophili (n=24)4444
B. cepacia DD00000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD0000000000001/200001/20000000
B. cenocepacia (n=2)
B. cepacia DD000000000000001/10000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)00000000001/501/502/501/500000000
Ceftazidime
B. multivorans DD0000008/26/23/20001/202/2004/20000000
B. caryophili (n=24)444444
B. cepacia DD000000000000001/10000000000
B. vietnamiensis (n=1)
B. cepacia DD0000001/200000001/20000000000
B. cenocepacia (n=2)
B. cepacia DD00000001/100000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)0000001/53/51/50000000000000000
Cefoperazone
B. multivorans DD000000007/202/204/204/206/21/20000000
B. caryophili (n=24)444444
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD00000000001/20000001/20000000
B. cenocepacia (n=2)
B. cepacia DD0000000000001/1000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=4)000000001/4000002/401/400000000
Cefotiam
B. multivorans DD0000000000000000024/0000000
B. caryophili (n=24)24
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000000002/20000000
B. cenocepacia (n=2)
B. cepacia DD000000000000000001/10000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000000000000000005/50000000
Mezlocillin
B. multivorans DD00000002/211/05/201/204/20001/2000000
B. caryophili (n=24)4244444
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis (n=1)
B. cepacia DD000000001/2000000000001/20000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000001/100000000000000
B. cepacia (n=5)000000002/502/5000001/500000000
Aztreonam
B. multivorans DD00000005/28/203/202/201/203/22/20000000
B. caryophili (n=24)4444444
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD000000001/2000000001/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000001/10000000000
B. cepacia (n=5)00000001/51/50002/500001/50000000
Imipenem
B. multivorans DD0000001/204/208/204/203/203/200000000
B. caryophili (n=23)333333
B. cepacia DD00000001/100000000000000000
B. vietnamiensis (n=1)
B. cepacia DD000000001/201/200000000000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000001/10000000000000000000
B. cepacia (n=5)00000001/5003/501/5000000000000
Amoxicillin clavulanate
B. multivorans DD01/20000000000001/20002/219/00001/
B. caryophili (n=24)4442424
B. cepacia DD00000000000000000001/100000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000000002/200000
B. cenocepacia (n=2)
B. cepacia DD00000000000000000001/100000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)01/100000000000000000000000
B. cepacia (n=5)00000000000000000005/500000
Meropenem
B. multivorans DD000001/210/4/26/202/20000001/20000000
B. caryophili (n=24)4244444
B. cepacia DD000000001/10000000000000000
B. vietnamiensis (n=1)
B. cepacia DD00000001/2001/200000000000000
B. cenocepacia (n=2)
B. cepacia DD000000001/10000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000001/10000000000000000
B. cepacia (n=5)00001/501/52/51/40000000000000000
Piperacillin/Tazob actam
B. multivorans DD000001/26/28/25/201/203/2000000000000
B. caryophili (n=24)444444
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis (n=1)
B. cepacia DD000001/20000000000001/2000000
B. cenocepacia (n=2)
B. cepacia DD000000001/10000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000001/10000000000000000
B. cepacia (n=5)0000002/52/51/50000000000000000
Biapenem
B. multivorans DD000001/24/26/27/204/201/2000000000000
B. caryophili (n=24)333333
B. cepacia DD00000001/100000000000000000
B. vietnamiensis (n=1)
B. cepacia DD000000001/20001/2000000000000
B. cenocepacia (n=2)
B. cepacia DD000000001/10000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000001/1000000000000000000
B. cepacia (n=5)000001/51/502/501/500000000000000
Ribostamycin
B. multivorans DD0000000000007/200011/06/2000000
B. caryophili (n=24)4244
B. cepacia DD00000000000000000001/100000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000000002/200000
B. cenocepacia (n=2)
B. cepacia DD00000000000000000001/100000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)0000000000001/50003/50001/500000
Pipemidic acid
B. multivorans DD000000000000004/2012/02/26/200000
B. caryophili (n=24)42444
B. cepacia DD00000000000000001/100000000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000002/200000000
B. cenocepacia (n=2)
B. cepacia DD000000000000001/10000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000000001/100000
B. cepacia (n=5)00000000001/501/503/50000000000
Norfloxacin
B. multivorans DD000000005/2013/0000006/20000000
B. caryophili (n=24)4244
B. cepacia DD00000000001/100000000000000
B. vietnamiensis (n=1)
B. cepacia DD00000000001/201/2000000000000
B. cenocepacia (n=2)
B. cepacia DD000000001/10000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)00000002/51/502/500000000000000
Ofloxacin
B. multivorans DD0000003/29/26/2000001/25/2000000000
B. caryophili (n=24)44444
B. cepacia DD000000001/10000000000000000
B. vietnamiensis (n=1)
B. cepacia DD000000001/201/200000000000000
B. cenocepacia (n=2)
B. cepacia DD00000001/100000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000001/51/503/50000000000000000
Ciprofloxacin
B. multivorans DD000004/27/27/20000001/25/2000000000
B. caryophili (n=24)44444
B. cepacia DD0000001/1000000000000000000
B. vietnamiensis (n=1)
B. cepacia DD00000001/21/20000000000000000
B. cenocepacia (n=2)
B. cepacia DD000001/10000000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000001/1000000000
B. cepacia (n=5)0001/51/51/52/5000000000000000000
Enoxacin
B. multivorans DD00000003/29/206/200006/2000000000
B. caryophili (n=24)4444
B. cepacia DD000000001/10000000000000000
B. vietnamiensis (n=1)
B. cepacia DD000000001/201/200000000000000
B. cenocepacia (n=2)
B. cepacia DD00000001/100000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000001/1000000000
B. cepacia (n=5)0000001/52/52/50000000000000000
Fleroxacin
B. multivorans DD000001/29/27/21/2000002/24/2000000000
B. caryophili (n=24)444444
B. cepacia DD000000001/10000000000000000
B. vietnamiensis (n=1)
B. cepacia DD00000001/21/20000000000000000
B. cenocepacia (n=2)
B. cepacia DD00000001/100000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000001/1000000000
B. cepacia (n=5)000001/51/53/500000000000000000
Pefloxacin
B. multivorans DD0000003/211/3/201/200006/2000000000
B. caryophili (n=24)424444
B. cepacia DD000000001/10000000000000000
B. vietnamiensis (n=1)
B. cepacia DD000000002/20000000000000000
B. cenocepacia (n=2)
B. cepacia DD00000001/100000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000001/1000000000
B. cepacia (n=5)0000001/51/51/52/50000000000000000
Sparfloxacin
B. multivorans DD00004/27/27/2000002/202/22/3000000000
B. caryophili (n=24)444442
B. cepacia DD00000001/100000000000000000
B. vietnamiensis (n=1)
B. cepacia DD000000002/20000000000000000
B. cenocepacia (n=2)
B. cepacia DD0000001/1000000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000001/10000000000
B. cepacia (n=5)0001/51/51/51/51/500000000000000000
Erythromycin
B. multivorans DD0000000000001/20009/214/0000000
B. caryophili (n=24)4424
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000000002/20000000
B. cenocepacia (n=2)
B. cepacia DD000000000000000001/10000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)00000000000000002/53/50000000
Clindamycin
B. multivorans DD00000000000000023/01/20000000
B. caryophili (n=24)244
B. cepacia DD0000000000000001/1000000000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000002/2000000000
B. cenocepacia (n=2)
B. cepacia DD0000000000000001/1000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000001/1000000000
B. cepacia (n=5)0000000000000005/5000000000
Lincomycin
B. multivorans DD00000000000000024/000000000
B. caryophili (n=24)24
B. cepacia DD0000000000000001/1000000000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000002/2000000000
B. cenocepacia (n=2)
B B. cepacia DD0000000000000001/1000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000001/1000000000
B. cepacia (n=5)0000000000000005/5000000000
Roxithromycin
B. multivorans DD00000000000000002/222/0000000
B. caryophili (n=24)424
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000000002/20000000
B. cenocepacia (n=2)
B. cepacia DD000000000000000001/10000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000000000000000005/50000000
Clarithromycin
B. multivorans DD00000000001/20003/2014/6/20000000
B. caryophili (n=24)44244
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000001/21/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000000000001/100000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)000000000000001/504/500000000
Azithromycin
B. multivorans DD0000000000002/208/2010/4/20000000
B. caryophili (n=24)44244
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000002/200000000
B. cenocepacia (n=2)
B. cepacia DD000000000000001/10000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)000000000000003/502/500000000
Quinupristin/Dalfo pristin (RP 57669/54476)
B. multivorans DD0000000000001/2012/011/00000000
B. caryophili (n=24)42424
B. cepacia DD00000000000000001/100000000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000002/200000000
B. cenocepacia (n=2)
B. cepacia DD000000000000001/10000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000001/100000000
B. cepacia (n=5)0000000000001/103/501/500000000
Livitomycin A
B. multivorans DD0000000000000000007/217/00000
B. caryophili (n=24)424
B. cepacia DD00000000000000000001/100000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000000002/200000
B. cenocepacia (n=2)
B. cepacia DD00000000000000000001/100000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000000001/100000
B. cepacia (n=5)0000000000000000001/54/500000
Tetracycline
B. multivorans DD0000001/2010/06/203/204/20000000000
B. caryophili (n=24)424444
B. cepacia DD00000000000000001/100000000
B. vietnamiensis
(n = 1)
B. cepacia DD000000000000000002/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000000000001/100000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000001/10000000000
B. cepacia (n=5)0000000000002/501/5002/50000000
Doxycycline
B. multivorans DD00001/24/26/27/22/203/201/2000000000000
B. caryophili (n=24)4444444
B. cepacia DD000000001/10000000000000000
B. vietnamiensis (n=1)
B. cepacia DD00000000001/201/2000000000000
B. cenocepacia (n=2)
B. cepacia DD000000001/10000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000001/100000000000000
B. cepacia (n=5)000001/51/51/51/501/500000000000000
Minocycline
B. multivorans DD000001/213/4/23/203/200000000000000
B. caryophili (n=24)424444
B. cepacia DD0000001/1000000000000000000
B. vietnamiensis (n=1)
B. cepacia DD00000001/21/20000000000000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000001/100000000000000
B. cepacia (n=5)000001/52/52/500000000000000000
Chloramphenicol
B. multivorans DD000000006/206/207/201/202/202/2000000
B. caryophili (n=24)444444
B. cepacia DD00000000001/100000000000000
B. vietnamiensis
(n = 1)
B. cepacia DD00000000001/20001/20000000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000001/1000000000000
B. cepacia (n=5)000000001/504/500000000000000
Sulfamethoxazole
B. multivorans DD00000001/22/204/208/204/203/202/2000000
B. caryophili (n=24)4444444
B. cepacia DD00000000000000001/100000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000001/2000000001/20
B. cenocepacia (n=2)
B. cepacia DD0000000000000000001/1000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000001/1000000000000
B. cepacia (n=5)000000000000001/50002/502/50000
Nitrofurantoin
B. multivorans DD00000000000000000000024/000
B. caryophili (n=24)24
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000000000002/2000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000000001/2000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000000000001/2000
B. cepacia (n=5)0000000000000000000005/5000
Cotrimoxazole
B. multivorans DD0000001/25/210/01/206/201/20000000000
B. caryophili (n=24)4424444
B. cepacia DD000000001/10000000000000000
B. vietnamiensis
(n=1)
B. cepacia DD00000000001/200000001/2000000
B. cenocepacia (n=2)
B. cepacia DD000000001/10000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000001/1000000000000
B. cepacia (n=5)00000001/52/501/501/5000000000000
Trimethoprim
B. multivorans DD000004/29/23/22/203/201/201/201/200000000
B. caryophili (n=24)44444444
B. cepacia DD0000001/1000000000000000000
B. vietnamiensis (n=1)
B. cepacia DD0000001/200000001/20000000000
B. cenocepacia (n=2)
B. cepacia DD0000001/1000000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000001/100000000000000
B. cepacia (n=5)000003/51/51/500000000000000000
Fosfomycin
B. multivorans DD00000000000000000000024/000
B. caryophili (n=24)24
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis (n=1)
B. cepacia DD0000000000000000000002/2000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000000001/1000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000000000001/1000
B. cepacia (n=5)0000000000000000000005/5000
Vancomycin
B. multivorans DD000000000000001/20023/0000000
B. caryophili (n=24)424
B. cepacia DD000000000000000001/10000000
B. vietnamiensis
(n=1)
B. cepacia DD000000000000000002/20000000
B. cenocepacia (n=2)
B. cepacia DD000000000000000001/10000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000000000000000005/50000000
Rifampicin
B. multivorans DD000000001/2012/03/203/25/2000000000
B. caryophili (n=24)424444
B. cepacia DD00000000001/100000000000000
B. vietnamiensis (n=1)
B. cepacia DD00000000001/200001/2000000000
B. cenocepacia (n=2)
B. cepacia DD0000000000000000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=0)
B. multivorans (n=1)0000000000000001/1000000000
B. cepacia (n=5)0000000000005/5000000000000
Teicoplanin
B. multivorans DD0000000000000000001/223/00000
B. caryophili (n=24)424
B. cepacia DD00000000000000000001/100000
B. vietnamiensis (n=1)
B. cepacia DD00000000000000000002/200000
B. cenocepacia (n=2)
B. cepacia DD00000000000000000001/100000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)00000000000000000001/100000
B. cepacia (n=5)00000000000000000005/500000
Fusidic acid
B. multivorans DD0000000000001/201/222/000000000
B. caryophili (n=24)4424
B. cepacia DD0000000000000001/1000000000
B. vietnamiensis
(n=1)
B. cepacia DD0000000000000002/2000000000
B. cenocepacia (n=2)
B. cepacia DD0000000000000001/1000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)0000000000000001/1000000000
B. cepacia (n=5)0000000000000005/5000000000
Cefepime
B. multivorans DD0000001/25/22/204/202/202/202/26/20000000
B. caryophili (n=24)44444444
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD00000000001/20000001/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000001/100000000000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)0000001/51/500001/50002/500000000
Dalfopristin (RP 54476)
B. multivorans DD000000000000001/2014/9/20000000
B. caryophili (n=24)4244
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000000002/20000000
B. cenocepacia (n=2)
B. cepacia DD00000000000000001/100000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000000000000001/502/52/50000000
Quinupristin (RP 57669)
B. multivorans DD0000000000000000024/0000000
B. caryophili (n=24)24
B. cepacia DD000000000000000001/10000000
B. vietnamiensis (n=1)
B. cepacia DD000000000000000002/20000000
B. cenocepacia (n=2)
B. cepacia DD000000000000000001/10000000
B. vietnamiensis DD
B. cenocepacia DD
B. ambifaria (n=1)
B. multivorans (n=1)000000000000000001/10000000
B. cepacia (n=5)000000000000000005/50000000
  18 in total

1.  Multilocus sequence typing scheme that provides both species and strain differentiation for the Burkholderia cepacia complex.

Authors:  Adam Baldwin; Eshwar Mahenthiralingam; Kathleen M Thickett; David Honeybourne; Martin C J Maiden; John R Govan; David P Speert; John J Lipuma; Peter Vandamme; Chris G Dowson
Journal:  J Clin Microbiol       Date:  2005-09       Impact factor: 5.948

2.  Development of a species-specific fur gene-based method for identification of the Burkholderia cepacia complex.

Authors:  Karlene H Lynch; Jonathan J Dennis
Journal:  J Clin Microbiol       Date:  2007-12-05       Impact factor: 5.948

3.  Burkholderia pseudomallei identification: a comparison between the API 20NE and VITEK2GN systems.

Authors:  Rama Narayana Deepak; Brett Crawley; Elaine Phang
Journal:  Trans R Soc Trop Med Hyg       Date:  2008-12       Impact factor: 2.184

4.  Cell motility and biofilm formation in Bacillus subtilis are affected by the ribosomal proteins, S11 and S21.

Authors:  Hiraku Takada; Masato Morita; Yuh Shiwa; Ryoma Sugimoto; Shota Suzuki; Fujio Kawamura; Hirofumi Yoshikawa
Journal:  Biosci Biotechnol Biochem       Date:  2014-05-28       Impact factor: 2.043

5.  Identification of species of the Burkholderia cepacia complex by sequence analysis of the hisA gene.

Authors:  Maria Cristiana Papaleo; Elena Perrin; Isabel Maida; Marco Fondi; Renato Fani; Peter Vandamme
Journal:  J Med Microbiol       Date:  2010-07-22       Impact factor: 2.472

6.  A new and rapid method for the assay of bacterial fatty acids using high resolution capillary gas chromatography and trimethylsulfonium hydroxide.

Authors:  K D Müller; H Husmann; H P Nalik
Journal:  Zentralbl Bakteriol       Date:  1990-11

7.  DISCRIMINATION OF Burkholderia mallei/pseudomallei FROM Burkholderia thailandensis BY SEQUENCE COMPARISON OF A FRAGMENT OF THE RIBOSOMAL PROTEIN S21 (RPSU) GENE.

Authors:  H Frickmann; N Chantratita; Y P Gauthier; H Neubauer; R M Hagen
Journal:  Eur J Microbiol Immunol (Bp)       Date:  2012-06-13

8.  RecA gene sequence and Multilocus Sequence Typing for species-level resolution of Burkholderia cepacia complex isolates.

Authors:  S Cesarini; A Bevivino; S Tabacchioni; L Chiarini; C Dalmastri
Journal:  Lett Appl Microbiol       Date:  2009-08-07       Impact factor: 2.858

9.  rpsU-based discrimination within the genus Burkholderia.

Authors:  H Frickmann; H Neubauer; U Loderstaedt; H Derschum; R M Hagen
Journal:  Eur J Microbiol Immunol (Bp)       Date:  2014-05-21

10.  Burkholderia pseudomallei misidentified by automated system.

Authors:  Christoph Weissert; Günter Dollenmaier; Philippe Rafeiner; Julia Riehm; Detlev Schultze
Journal:  Emerg Infect Dis       Date:  2009-11       Impact factor: 6.883
View more
  3 in total

1.  Comparison of Mast Burkholderia Cepacia, Ashdown + Gentamicin, and Burkholderia Pseudomallei Selective Agar for the Selective Growth of Burkholderia Spp.

Authors:  Carola Edler; Henri Derschum; Mirko Köhler; Heinrich Neubauer; Hagen Frickmann; Ralf Matthias Hagen
Journal:  Eur J Microbiol Immunol (Bp)       Date:  2017-01-09

2.  Comparison of Five Commercial Nucleic Acid Extraction Kits for the PCR-based Detection of Burkholderia Pseudomallei DNA in Formalin-Fixed, Paraffin-Embedded Tissues.

Authors:  Sonja Obersteller; Heinrich Neubauer; Ralf Matthias Hagen; Hagen Frickmann
Journal:  Eur J Microbiol Immunol (Bp)       Date:  2016-09-29

3.  New Auranofin Analogs with Antibacterial Properties against Burkholderia Clinical Isolates.

Authors:  Dustin Maydaniuk; Bin Wu; Dang Truong; Sajani H Liyanage; Andrew M Hogan; Zhong Ling Yap; Mingdi Yan; Silvia T Cardona
Journal:  Antibiotics (Basel)       Date:  2021-11-24
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.