Literature DB >> 27130520

Nucleosome breathing and remodeling constrain CRISPR-Cas9 function.

R Stefan Isaac1,2, Fuguo Jiang3,4, Jennifer A Doudna4,5,6,7,8, Wendell A Lim9,10,11, Geeta J Narlikar1, Ricardo Almeida10,11,12.   

Abstract

The CRISPR-Cas9 bacterial surveillance system has become a versatile tool for genome editing and gene regulation in eukaryotic cells, yet how CRISPR-Cas9 contends with the barriers presented by eukaryotic chromatin is poorly understood. Here we investigate how the smallest unit of chromatin, a nucleosome, constrains the activity of the CRISPR-Cas9 system. We find that nucleosomes assembled on native DNA sequences are permissive to Cas9 action. However, the accessibility of nucleosomal DNA to Cas9 is variable over several orders of magnitude depending on dynamic properties of the DNA sequence and the distance of the PAM site from the nucleosome dyad. We further find that chromatin remodeling enzymes stimulate Cas9 activity on nucleosomal templates. Our findings imply that the spontaneous breathing of nucleosomal DNA together with the action of chromatin remodelers allow Cas9 to effectively act on chromatin in vivo.

Entities:  

Keywords:  ATP-dependent chromatin remodeling; CRISPR; CRISPR-Cas9; biochemistry; chromatin; chromosomes; genes; none; nucleosome

Mesh:

Substances:

Year:  2016        PMID: 27130520      PMCID: PMC4880442          DOI: 10.7554/eLife.13450

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

The recent development of CRISPR (clustered regularly interspaced short palindromic repeats) systems, particularly the type II CRISPR-Cas9 mechanism from Streptomyces pyogenes, as an artificial tool for genome engineering, gene regulation, and live imaging is a remarkable achievement with profound impact in a wide variety of research fields and applications (Makarova et al., 2015; Doudna and Charpentier, 2014; Cong et al., 2013; Jinek et al., 2012; 2013; Mali et al., 2013). Despite its successful adoption across numerous eukaryotic organisms, relatively few details are known of the mechanism by which bacterial CRISPR-Cas9 systems operate in eukaryotic cells (Doudna and Charpentier, 2014; Ghorbal et al., 2014; Vyas et al., 2015). CRISPR-Cas9 originated in bacteria, where genomic DNA generally consists of supercoiled circular molecules associated with nucleoid-associated proteins (Travers and Muskhelishvili, 2005). In contrast, eukaryotic chromosomes are linear, packaged with histone octamers into nucleosomes, and further organized into higher-order structures (Luger et al., 1997; Olins and Olins, 1974; Woodcock et al., 1976; Dixon et al., 2012). The packaging of DNA into nucleosomes generally inhibits the binding of sequence specific DNA binding factors. In the simplest model, nucleosomes would analogously inhibit Cas9 action. Further, in eukaryotes ATP-dependent chromatin remodelers reposition, remove, or restructure nucleosomes to regulate the access of DNA binding factors (Clapier and Cairns, 2009; Narlikar et al., 2013). It can therefore be imagined that the action of remodelers also regulates the action of Cas9 on nucleosomes. To quantitatively test the above models we performed biochemical studies to measure Cas9 activity on nucleosomes assembled with native and artificial nucleosome positioning sequences. We find that the combination of nucleosome breathing, by which DNA transiently disengages from the histone octamer, and the action of chromatin remodeling enzymes allow Cas9 to act on nucleosomal DNA with rates comparable to naked DNA. The results provide a biochemical explanation for the efficacy of Cas9 in eukaryotic cells.

Results

Nucleosomes assembled on the 601 sequence inhibit Cas9 binding and cleavage of target DNA

To determine if a nucleosome inhibits the ability of Cas9 to scan, recognize, and cleave sgRNA-directed DNA targets, we performed in vitro Cas9 cleavage assays using mononucleosomes (single nucleosomes on short dsDNA molecules) reconstituted using the Widom 601 positioning sequence with 80 base pairs of flanking DNA on both sides (referred to as 601 80/80 particles, Figure 1A) (Lowary and Widom, 1998). The 601 sequence is an artificially derived sequence with high affinity for the histone octamer and has proved a valuable tool for assembling well positioning nucleosomes for biochemical studies. Using sgRNAs targeting the nucleosomal dyad, entry/exit sites, and flanking DNA, we measured the rates of Cas9 cleavage with naked 601 DNA and the 601 80/80 particles. Targeting the DNA flanking the nucleosome showed cleavage rates comparable to those of naked DNA. Cleavage rates at entry/exit sites of the nucleosome were much lower compared to naked DNA (~23–28x decrease cleavage rate vs. DNA alone) (Figure 1B,C). Targeting near the nucleosomal dyad resulted in further inhibition of cutting by Cas9 (~1000x decrease vs. DNA alone) (Figure 1C,D). Previous work has shown that nucleosomal DNA transiently disengages from the histone octamer, a process termed as nucleosomal DNA unpeeling or breathing. The equilibrium for DNA unpeeling gets progressively more unfavorable the closer the DNA site gets to the dyad (Polach and Widom, 1995; Li and Widom, 2004; Luger et al., 2012). The nucleosome-mediated inhibition of Cas9 activity is more pronounced near the dyad suggesting that Cas9 cleavage occurs on DNA that is transiently disengaged from the histone octamer.
Figure 1.

Cas9 DNA nuclease activity is hindered by nucleosomes.

(A) Schematic of sgRNAs designed against the assembled 601 80/80 nucleosome substrates targeting the flanking regions, entry/exit sites, and near the nucleosomal dyad. (B) Cleavage assay comparing Cas9 cleavage on 80/80 DNA and 80/80 nucleosomes when loaded with sgRNA #3. (C) Kinetics of cleavage with sgRNA #3. (D) Comparison of the relative rates of cleavage on nucleosomes to DNA at various positions along the 80/80 nucleosome construct. The position reported is the site of cleavage by Cas9. Represented values are mean ± SEM from three replicates.

DOI: http://dx.doi.org/10.7554/eLife.13450.003

DOI: http://dx.doi.org/10.7554/eLife.13450.004

DOI: http://dx.doi.org/10.7554/eLife.13450.005

DOI: http://dx.doi.org/10.7554/eLife.13450.006

DOI: http://dx.doi.org/10.7554/eLife.13450.007

DOI: http://dx.doi.org/10.7554/eLife.13450.008

DOI: http://dx.doi.org/10.7554/eLife.13450.009

DOI: http://dx.doi.org/10.7554/eLife.13450.010

DOI: http://dx.doi.org/10.7554/eLife.13450.011

DOI: http://dx.doi.org/10.7554/eLife.13450.012

DOI: http://dx.doi.org/10.7554/eLife.13450.013

DOI: http://dx.doi.org/10.7554/eLife.13450.014

DOI: http://dx.doi.org/10.7554/eLife.13450.015

(A) Schematic illustrating the stepwise mechanism of Cas9 binding to DNA targets and subsequent nucleolytic cleavage. (B) Gel shift assay comparing dCas9 binding to 0/0 DNA and nucleosomes while loaded with sgRNA #3 targeting the nucleosome dyad. Band shift pattern appears as discrete lower band (dCas9 bound to sgRNA-specified target, arrowhead) and higher, super shift bands (additional dCas9 PAM-only binding events). (C) Quantification of (B). Represented values are mean ± SEM from three replicates.

DOI: http://dx.doi.org/10.7554/eLife.13450.016

DOI: http://dx.doi.org/10.7554/eLife.13450.017

DOI: http://dx.doi.org/10.7554/eLife.13450.018

DOI: http://dx.doi.org/10.7554/eLife.13450.019

DOI: http://dx.doi.org/10.7554/eLife.13450.020

Cas9 DNA nuclease activity is hindered by nucleosomes.

(A) Schematic of sgRNAs designed against the assembled 601 80/80 nucleosome substrates targeting the flanking regions, entry/exit sites, and near the nucleosomal dyad. (B) Cleavage assay comparing Cas9 cleavage on 80/80 DNA and 80/80 nucleosomes when loaded with sgRNA #3. (C) Kinetics of cleavage with sgRNA #3. (D) Comparison of the relative rates of cleavage on nucleosomes to DNA at various positions along the 80/80 nucleosome construct. The position reported is the site of cleavage by Cas9. Represented values are mean ± SEM from three replicates. DOI: http://dx.doi.org/10.7554/eLife.13450.003

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNAs #2 and #6.

DOI: http://dx.doi.org/10.7554/eLife.13450.004 DOI: http://dx.doi.org/10.7554/eLife.13450.005 DOI: http://dx.doi.org/10.7554/eLife.13450.006

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #5.

DOI: http://dx.doi.org/10.7554/eLife.13450.007 DOI: http://dx.doi.org/10.7554/eLife.13450.008

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #1.

DOI: http://dx.doi.org/10.7554/eLife.13450.009 DOI: http://dx.doi.org/10.7554/eLife.13450.010

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #3.

DOI: http://dx.doi.org/10.7554/eLife.13450.011 DOI: http://dx.doi.org/10.7554/eLife.13450.012

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #4.

DOI: http://dx.doi.org/10.7554/eLife.13450.013 DOI: http://dx.doi.org/10.7554/eLife.13450.014

Quantification of Figure 1 Cas9 cleavage gels.

DOI: http://dx.doi.org/10.7554/eLife.13450.015

Nucleosome positioning blocks Cas9 from binding PAM sites on DNA.

(A) Schematic illustrating the stepwise mechanism of Cas9 binding to DNA targets and subsequent nucleolytic cleavage. (B) Gel shift assay comparing dCas9 binding to 0/0 DNA and nucleosomes while loaded with sgRNA #3 targeting the nucleosome dyad. Band shift pattern appears as discrete lower band (dCas9 bound to sgRNA-specified target, arrowhead) and higher, super shift bands (additional dCas9 PAM-only binding events). (C) Quantification of (B). Represented values are mean ± SEM from three replicates. DOI: http://dx.doi.org/10.7554/eLife.13450.016

-3Replicate gels of dCas9 binding to 0/0 601 DNA and nucleosomes with sgRNA #3.

DOI: http://dx.doi.org/10.7554/eLife.13450.017 DOI: http://dx.doi.org/10.7554/eLife.13450.018 DOI: http://dx.doi.org/10.7554/eLife.13450.019

Quantification of Figure 1—figure supplement 1 gel shifts.

DOI: http://dx.doi.org/10.7554/eLife.13450.020 Nucleosomes block the ability of Cas9 to cleave DNA, but it is unclear at which step of Cas9 activity this occurs. Cas9 recognizes DNA target sites in a two-step process that begins with binding to the DNA protospacer adjacent motif (PAM, in this case 'NGG') through its C-terminal PAM-interacting region, followed by sequential melting of the DNA double strand and annealing of the sgRNA guide segment to the unwound target DNA strand (Figure 1—figure supplement 1A) (Sternberg et al., 2014; Jiang et al., 2015). Complete annealing of the 20-nt guide RNA to the target DNA is required to drive a progressive conformational transformation that authorizes Cas9 to simultaneously cleave both DNA strands (Sternberg et al., 2015; Josephs et al., 2016). Given this order of events, it is conceivable that nucleosomes can interfere with any of the steps preceding and including DNA cleavage.
Figure 1—figure supplement 1.

Nucleosome positioning blocks Cas9 from binding PAM sites on DNA.

(A) Schematic illustrating the stepwise mechanism of Cas9 binding to DNA targets and subsequent nucleolytic cleavage. (B) Gel shift assay comparing dCas9 binding to 0/0 DNA and nucleosomes while loaded with sgRNA #3 targeting the nucleosome dyad. Band shift pattern appears as discrete lower band (dCas9 bound to sgRNA-specified target, arrowhead) and higher, super shift bands (additional dCas9 PAM-only binding events). (C) Quantification of (B). Represented values are mean ± SEM from three replicates.

DOI: http://dx.doi.org/10.7554/eLife.13450.016

DOI: http://dx.doi.org/10.7554/eLife.13450.017

DOI: http://dx.doi.org/10.7554/eLife.13450.018

DOI: http://dx.doi.org/10.7554/eLife.13450.019

DOI: http://dx.doi.org/10.7554/eLife.13450.020

To identify the point at which nucleosomes disrupt Cas9 function, we assessed binding of nuclease-dead Cas9 (dCas9) to mononucleosomal particles by an electrophoretic mobility shift assay. We performed dCas9 binding assays using 601 0/0 nucleosomal particles which are devoid of naked DNA overhangs. Binding of dCas9 pre-loaded with core targeting sgRNA with 601 0/0 nucleosomes is undetectable whereas binding to naked DNA control is still robust (Figure 1—figure supplement 1B). The presence of super shifts in the gel migration pattern suggests that multiple dCas9 molcules are engaging the same DNA substrate molecule. We investigated this further and determined that, in our binding assay, the highly transient dCas9 binding to PAMs within target DNA is observable as super shifts, likely due to a combination of a high number of PAMs on the target DNA (23 NGG PAMs present in 601 0/0 sequence) and common caging effects of gel binding assays. The absence of a super shift binding pattern with 0/0 nucleosomes (Figure 1—figure supplement 1B, right) suggests that dCas9 cannot stably interact with PAMs located on nucleosomes, in a manner consistent with a recently published study (Hinz et al., 2015).

Nucleosomes assembled on a native DNA sequence are permissive to Cas9 action

The artificial Widom 601 is an atypically strong nucleosome positioning sequence that shows ~100-fold less breathing dynamics compared to physiological nucleosome positioning sequences, such as the 5S rRNA gene (Anderson et al., 2002; Partensky and Narlikar, 2009). To determine how Cas9 contends with nucleosomes assembled on this physiological positioning sequence, we performed cleavage experiments with nucleosomes assembled from 5S rRNA gene sequences from Xenopus borealis (Figure 2A). Cas9-mediated cleavage at sites near the entry/exit of the nucleosome is substantially enhanced (700–fold) with 5S nucleosomes compared to 601 particles (Figure 2B–D). In the context of 601, cutting at this site is 1000-fold slower than in naked DNA. In contrast, with 5S nucleosomes, cutting at the comparable site is only 1.5-fold slower than in naked DNA. However, Cas9 cleavage near the dyad is inhibited to a similar extent on both 5S and 601 nucleosomes, showing that the 5S-specific enhancement of Cas9 activity does not extend all the way to the nucleosomal dyad. These results support our interpretation that nucleosomal DNA breathing substantially enhances Cas9 binding to nucleosomes and demonstrate that nucleosomal DNA sequence, through its influence on nucleosome stability, can regulate Cas9 activity over a large dynamic range.
Figure 2.

Higher nucleosomal breathing dynamics enhance Cas9 cleavage.

(A) Schematic illustrating nucleosome breathing and how it can enable Cas9 binding to a target in the nucleosome. (B) Cleavage assay comparing Cas9 cleavage of 601 and 5S 0/0 nucleosomes when loaded with sgRNAs targeting comparable positions at core and entry sites. (C) Quantification of (B). (D) Cas9 cleavage rates on 601 and 5S nucleosomes when targeted to core and entry sites. Values were normalized against naked DNA control rates. Represented values are mean ± SEM from three replicates. Additional gel panels shown in Figure 2—figure supplement 1.

DOI: http://dx.doi.org/10.7554/eLife.13450.021

DOI: http://dx.doi.org/10.7554/eLife.13450.022

DOI: http://dx.doi.org/10.7554/eLife.13450.023

DOI: http://dx.doi.org/10.7554/eLife.13450.024

DOI: http://dx.doi.org/10.7554/eLife.13450.025

DOI: http://dx.doi.org/10.7554/eLife.13450.026

DOI: http://dx.doi.org/10.7554/eLife.13450.027

DOI: http://dx.doi.org/10.7554/eLife.13450.028

DOI: http://dx.doi.org/10.7554/eLife.13450.029

Representative gel images of Cas9 cleavage experiments with 601 (left) and 5S (right) 0/0 particles using sgRNAs targeting entry (top) or core (bottom) sites, including DNA control experiments. Samples were resolved on 12% (entry) or 8% (core) polyacrylamide gels. Cleavage with sgRNAs targeting the entry site on both 5S and 601 substrates generates a short cleavage product (13 bp) which partially denatures and runs as two bands (single and double stranded) on 12% polyacrylamide gels.

DOI: http://dx.doi.org/10.7554/eLife.13450.030

Higher nucleosomal breathing dynamics enhance Cas9 cleavage.

(A) Schematic illustrating nucleosome breathing and how it can enable Cas9 binding to a target in the nucleosome. (B) Cleavage assay comparing Cas9 cleavage of 601 and 5S 0/0 nucleosomes when loaded with sgRNAs targeting comparable positions at core and entry sites. (C) Quantification of (B). (D) Cas9 cleavage rates on 601 and 5S nucleosomes when targeted to core and entry sites. Values were normalized against naked DNA control rates. Represented values are mean ± SEM from three replicates. Additional gel panels shown in Figure 2—figure supplement 1.
Figure 2—figure supplement 1.

Cas9 cleavage assay with 601 and 5S 0/0 nucleosomes.

Representative gel images of Cas9 cleavage experiments with 601 (left) and 5S (right) 0/0 particles using sgRNAs targeting entry (top) or core (bottom) sites, including DNA control experiments. Samples were resolved on 12% (entry) or 8% (core) polyacrylamide gels. Cleavage with sgRNAs targeting the entry site on both 5S and 601 substrates generates a short cleavage product (13 bp) which partially denatures and runs as two bands (single and double stranded) on 12% polyacrylamide gels.

DOI: http://dx.doi.org/10.7554/eLife.13450.030

DOI: http://dx.doi.org/10.7554/eLife.13450.021

Replicate gels of cleavage of 0/0 5S DNA and nucleosomes with sgRNA core.

DOI: http://dx.doi.org/10.7554/eLife.13450.022 DOI: http://dx.doi.org/10.7554/eLife.13450.023

Replicate gels of cleavage of 0/0 5S DNA and nucleosomes with sgRNA entry.

DOI: http://dx.doi.org/10.7554/eLife.13450.024 DOI: http://dx.doi.org/10.7554/eLife.13450.025

Replicate gels of cleavage of 0/0 601 DNA and nucleosomes with sgRNA entry.

DOI: http://dx.doi.org/10.7554/eLife.13450.026 DOI: http://dx.doi.org/10.7554/eLife.13450.027

Quantification of Figure 2 Cas9 cleavage gels.

DOI: http://dx.doi.org/10.7554/eLife.13450.028 DOI: http://dx.doi.org/10.7554/eLife.13450.029

Cas9 cleavage assay with 601 and 5S 0/0 nucleosomes.

Representative gel images of Cas9 cleavage experiments with 601 (left) and 5S (right) 0/0 particles using sgRNAs targeting entry (top) or core (bottom) sites, including DNA control experiments. Samples were resolved on 12% (entry) or 8% (core) polyacrylamide gels. Cleavage with sgRNAs targeting the entry site on both 5S and 601 substrates generates a short cleavage product (13 bp) which partially denatures and runs as two bands (single and double stranded) on 12% polyacrylamide gels. DOI: http://dx.doi.org/10.7554/eLife.13450.030

Nucleosome remodeling enhances Cas9 activity

We next investigated whether chromatin remodeling could enhance Cas9 activity towards chromatin substrates. Nucleosome positioning in vivo is strongly dependent on ATP-dependent chromatin remodelers, which are capable of loading, repositioning, and removing nucleosomes from the chromatin fiber. To measure how chromatin remodelers can influence Cas9 activity, we performed experiments where we pre-incubated 601 nucleosomes with remodeler enzymes prior to Cas9-mediated cleavage. For our experiments with the human ISWI-family remodeler SNF2h, we used asymmetric nucleosomes that possess flanking DNA only on the entry side (601 80/0 particles). When incubated with 601 80/0 particles, SNF2h promotes sliding of the nucleosome towards the center of the DNA molecule (Figure 3A–B, Figure 3—figure supplement 1) (Längst et al., 1999; He et al., 2006; Yang et al., 2006). We then performed in vitro cleavage experiments where 80/0 particles, pre-remodeled with SNF2h, were incubated with Cas9:sgRNA complex with its target site located within the nucleosome exit region. Remodeling 80/0 nucleosomes by SNF2h resulted in a strong enhancement of Cas9 cleavage to ~34%, showing that SNF2h slides the nucleosome enough to improve Cas9’s accessibility to the target site and that Cas9 is now able to bind and cleave at a higher rate (Figure 3A–D).
Figure 3.

Chromatin remodeling improves Cas9 cleavage of nucleosomal substrates.

(A) Schematic of Cas9 cleavage assay with remodeling. Cas9 is presented with 601 nucleosomes either untreated or previously remodeled with SNF2h or RSC remodelers. (B) Assay comparing cleavage on untreated and remodeled 80/0 nucleosomes when Cas9 is targeted to exit site (depicted in green). These asymmetric nucleosomes are recentered by SNF2h, exposing the exit target site to Cas9 (C) Quantification of (B). (D) Cleavage rates of 80/0 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of SNF2h. SNF2h improves Cas9 cleavage to ~35% of the naked DNA cleavage rate. (E) Assay comparing Cas9-mediated cleavage at entry site of 80/80 symmetric 601 nucleosomes, either untreated or previously treated with RSC remodeler. RSC can destabilize nucleosome structure and reposition nucleosomes towards the DNA ends. (F) Quantification of (E) (G) Comparison of the rates of cleavage of nucleosomes normalized to DNA control with and without the action of RSC chromatin remodeler. Mean enhancement rates of Cas9 activity by chromatin remodeling are shown. (H) Cleavage rates of 80/80 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of RSC. Cas9 cleavage is substantially enhanced by RSC, attaining ~63% of the naked DNA cleavage rate. Represented values are mean ± SEM from three replicates. Additional gel panels shown in Figure 3—figure supplement 1. (I) Model of Cas9 activity in vivo in eukaryotes. Left, stable and strongly positioned nucleosomes impede Cas9 activity (downward arrows). However, nucleosomes in vivo are generally more dynamic (breathing), allowing Cas9 opportunities to target underlying DNA (center). Cas9 accessibility to nucleosomal DNA can be further enhanced by the activity of chromatin remodelers that destabilize and/or reposition nucleosomes (right).

DOI: http://dx.doi.org/10.7554/eLife.13450.031

DOI: http://dx.doi.org/10.7554/eLife.13450.032

DOI: http://dx.doi.org/10.7554/eLife.13450.033

DOI: http://dx.doi.org/10.7554/eLife.13450.034

DOI: http://dx.doi.org/10.7554/eLife.13450.035

DOI: http://dx.doi.org/10.7554/eLife.13450.036

DOI: http://dx.doi.org/10.7554/eLife.13450.037

DOI: http://dx.doi.org/10.7554/eLife.13450.038

DOI: http://dx.doi.org/10.7554/eLife.13450.039

(A) Representative gel images of Cas9 cleavage experiments with 601 80/0 asymmetric particles and SNF2h chromatin remodeler, including DNA control experiments. Cas9 was loaded with sgRNA targeting the exit site of the nucleosome. SNF2h re-centers asymmetric nucleosomes such as 80/0 (Figure 3—figure supplement 3), exposing the Cas9 target site. (B) Quantification of (A). (C) Representative gel images of Cas9 cleavage experiments with 601 80/80 symmetric nucleosomes and RSC chromatin remodeler, including DNA control experiments. Cas9 was targeted to the entry site of the nucleosome. RSC destabilizes nucleosomal structure and repositions nucleosomes to the ends of the DNA molecule. (D) Quantification of (C). Represented values are mean ± SEM from three replicates.

DOI: http://dx.doi.org/10.7554/eLife.13450.040

(A) Assay comparing Cas9 cleavage of 601 80/0 nucleosomes simultaneously with chromatin remodeling byr SNF2h. The 601 80/0 asymmetric nucleosomes are recentered by SNF2h, exposing the exit target site to Cas9 (B) Quantification of (A). (C) Cleavage rates of 80/0 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of SNF2h. SNF2h improves Cas9 cleavage to ~40% of the naked DNA cleavage rate, similarly to sequential remodeling and cleavage assays shown in Figure 3A–D. Results shown for single experiment performed.

DOI: http://dx.doi.org/10.7554/eLife.13450.041

DOI: http://dx.doi.org/10.7554/eLife.13450.042

Gel‐shift nucleosome remodeling assay comparing positioned and SNF2h‐remodeled 80/0 nucleosomes (left) or RSC-remodeled 80/80 nucleosomes (right). Migration pattern for all three forms (centered, end-positioned nucleosomes and free DNA) is illustrated (center). Remodeling reactions were carried out 1 hr before being quenched and run on a 5% Acrylamide 0.5x TBE gel. SNF2h remodels 80/0 end‐positioned nucleosomes in a range of nucleosome positions biased towards the center of the DNA molecule, whereas RSC has the opposite bias of repositioned centered nucleosomes towards the ends of the DNA molecule. Images shown for single experiments performed, as previously described (Yang et al., 2006; Rowe and Narlikar, 2010).

DOI: http://dx.doi.org/10.7554/eLife.13450.043

DOI: http://dx.doi.org/10.7554/eLife.13450.044

DOI: http://dx.doi.org/10.7554/eLife.13450.045

Figure 3—figure supplement 1.

Cas9 cleavage assays with SNF2h and RSC chromatin remodelers.

(A) Representative gel images of Cas9 cleavage experiments with 601 80/0 asymmetric particles and SNF2h chromatin remodeler, including DNA control experiments. Cas9 was loaded with sgRNA targeting the exit site of the nucleosome. SNF2h re-centers asymmetric nucleosomes such as 80/0 (Figure 3—figure supplement 3), exposing the Cas9 target site. (B) Quantification of (A). (C) Representative gel images of Cas9 cleavage experiments with 601 80/80 symmetric nucleosomes and RSC chromatin remodeler, including DNA control experiments. Cas9 was targeted to the entry site of the nucleosome. RSC destabilizes nucleosomal structure and repositions nucleosomes to the ends of the DNA molecule. (D) Quantification of (C). Represented values are mean ± SEM from three replicates.

DOI: http://dx.doi.org/10.7554/eLife.13450.040

Chromatin remodeling improves Cas9 cleavage of nucleosomal substrates.

(A) Schematic of Cas9 cleavage assay with remodeling. Cas9 is presented with 601 nucleosomes either untreated or previously remodeled with SNF2h or RSC remodelers. (B) Assay comparing cleavage on untreated and remodeled 80/0 nucleosomes when Cas9 is targeted to exit site (depicted in green). These asymmetric nucleosomes are recentered by SNF2h, exposing the exit target site to Cas9 (C) Quantification of (B). (D) Cleavage rates of 80/0 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of SNF2h. SNF2h improves Cas9 cleavage to ~35% of the naked DNA cleavage rate. (E) Assay comparing Cas9-mediated cleavage at entry site of 80/80 symmetric 601 nucleosomes, either untreated or previously treated with RSC remodeler. RSC can destabilize nucleosome structure and reposition nucleosomes towards the DNA ends. (F) Quantification of (E) (G) Comparison of the rates of cleavage of nucleosomes normalized to DNA control with and without the action of RSC chromatin remodeler. Mean enhancement rates of Cas9 activity by chromatin remodeling are shown. (H) Cleavage rates of 80/80 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of RSC. Cas9 cleavage is substantially enhanced by RSC, attaining ~63% of the naked DNA cleavage rate. Represented values are mean ± SEM from three replicates. Additional gel panels shown in Figure 3—figure supplement 1. (I) Model of Cas9 activity in vivo in eukaryotes. Left, stable and strongly positioned nucleosomes impede Cas9 activity (downward arrows). However, nucleosomes in vivo are generally more dynamic (breathing), allowing Cas9 opportunities to target underlying DNA (center). Cas9 accessibility to nucleosomal DNA can be further enhanced by the activity of chromatin remodelers that destabilize and/or reposition nucleosomes (right). DOI: http://dx.doi.org/10.7554/eLife.13450.031

Replicate gels of cleavage of 80/0 DNA and nucleosomes using sgRNA #4 with or without prior remodeling by Snf2h.

DOI: http://dx.doi.org/10.7554/eLife.13450.032 DOI: http://dx.doi.org/10.7554/eLife.13450.033 DOI: http://dx.doi.org/10.7554/eLife.13450.034

Quantification of Cas9 cleavage gels from Figure 3—source data 1–3.

DOI: http://dx.doi.org/10.7554/eLife.13450.035

Replicate gels of cleavage of 80/80 DNA and nucleosomes using sgRNA 601_2 with or without prior remodeling by RSC.

DOI: http://dx.doi.org/10.7554/eLife.13450.036 DOI: http://dx.doi.org/10.7554/eLife.13450.037 DOI: http://dx.doi.org/10.7554/eLife.13450.038

Quantification of Cas9 cleavage gels from Figure 3—source data 5–7.

DOI: http://dx.doi.org/10.7554/eLife.13450.039

Cas9 cleavage assays with SNF2h and RSC chromatin remodelers.

(A) Representative gel images of Cas9 cleavage experiments with 601 80/0 asymmetric particles and SNF2h chromatin remodeler, including DNA control experiments. Cas9 was loaded with sgRNA targeting the exit site of the nucleosome. SNF2h re-centers asymmetric nucleosomes such as 80/0 (Figure 3—figure supplement 3), exposing the Cas9 target site. (B) Quantification of (A). (C) Representative gel images of Cas9 cleavage experiments with 601 80/80 symmetric nucleosomes and RSC chromatin remodeler, including DNA control experiments. Cas9 was targeted to the entry site of the nucleosome. RSC destabilizes nucleosomal structure and repositions nucleosomes to the ends of the DNA molecule. (D) Quantification of (C). Represented values are mean ± SEM from three replicates.
Figure 3—figure supplement 3.

SNF2h and RSC remodel nucleosomes prior to Cas9 cleavage.

Gel‐shift nucleosome remodeling assay comparing positioned and SNF2h‐remodeled 80/0 nucleosomes (left) or RSC-remodeled 80/80 nucleosomes (right). Migration pattern for all three forms (centered, end-positioned nucleosomes and free DNA) is illustrated (center). Remodeling reactions were carried out 1 hr before being quenched and run on a 5% Acrylamide 0.5x TBE gel. SNF2h remodels 80/0 end‐positioned nucleosomes in a range of nucleosome positions biased towards the center of the DNA molecule, whereas RSC has the opposite bias of repositioned centered nucleosomes towards the ends of the DNA molecule. Images shown for single experiments performed, as previously described (Yang et al., 2006; Rowe and Narlikar, 2010).

DOI: http://dx.doi.org/10.7554/eLife.13450.043

DOI: http://dx.doi.org/10.7554/eLife.13450.044

DOI: http://dx.doi.org/10.7554/eLife.13450.045

DOI: http://dx.doi.org/10.7554/eLife.13450.040

Simultaneous chromatin remodeling and Cas9 cleavage of nucleosomal substrates.

(A) Assay comparing Cas9 cleavage of 601 80/0 nucleosomes simultaneously with chromatin remodeling byr SNF2h. The 601 80/0 asymmetric nucleosomes are recentered by SNF2h, exposing the exit target site to Cas9 (B) Quantification of (A). (C) Cleavage rates of 80/0 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of SNF2h. SNF2h improves Cas9 cleavage to ~40% of the naked DNA cleavage rate, similarly to sequential remodeling and cleavage assays shown in Figure 3A–D. Results shown for single experiment performed. DOI: http://dx.doi.org/10.7554/eLife.13450.041

Gel of cleavage of 80/0 DNA and nucleosomes using sgRNA #4 with or without simultaneous remodeling by Snf2h.

DOI: http://dx.doi.org/10.7554/eLife.13450.042

SNF2h and RSC remodel nucleosomes prior to Cas9 cleavage.

Gel‐shift nucleosome remodeling assay comparing positioned and SNF2h‐remodeled 80/0 nucleosomes (left) or RSC-remodeled 80/80 nucleosomes (right). Migration pattern for all three forms (centered, end-positioned nucleosomes and free DNA) is illustrated (center). Remodeling reactions were carried out 1 hr before being quenched and run on a 5% Acrylamide 0.5x TBE gel. SNF2h remodels 80/0 end‐positioned nucleosomes in a range of nucleosome positions biased towards the center of the DNA molecule, whereas RSC has the opposite bias of repositioned centered nucleosomes towards the ends of the DNA molecule. Images shown for single experiments performed, as previously described (Yang et al., 2006; Rowe and Narlikar, 2010). DOI: http://dx.doi.org/10.7554/eLife.13450.043

Test remodeling gel of 80/0 nucleosomes with Snf2h.

DOI: http://dx.doi.org/10.7554/eLife.13450.044

Test remodeling gel of 80/80 nucleosomes with RSC.

DOI: http://dx.doi.org/10.7554/eLife.13450.045 We also performed this experiment by simultaneously adding SNF2h and Cas9 and found a similar rate enhancement (Figure 3—figure supplement 2).
Figure 3—figure supplement 2.

Simultaneous chromatin remodeling and Cas9 cleavage of nucleosomal substrates.

(A) Assay comparing Cas9 cleavage of 601 80/0 nucleosomes simultaneously with chromatin remodeling byr SNF2h. The 601 80/0 asymmetric nucleosomes are recentered by SNF2h, exposing the exit target site to Cas9 (B) Quantification of (A). (C) Cleavage rates of 80/0 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of SNF2h. SNF2h improves Cas9 cleavage to ~40% of the naked DNA cleavage rate, similarly to sequential remodeling and cleavage assays shown in Figure 3A–D. Results shown for single experiment performed.

DOI: http://dx.doi.org/10.7554/eLife.13450.041

DOI: http://dx.doi.org/10.7554/eLife.13450.042

While the ISWI remodeler SNF2h predominantly slides nucleosomes, remodelers from the SWI/SNF class have multiple outcomes, which include generation of DNA loops and eviction of the histone octamer in addition to nucleosome sliding (Rowe and Narlikar, 2010; Narlikar et al., 2001; Lorch et al., 1998; Schnitzler et al., 1998; Clapier and Cairns, 2009). To determine if the types of remodeled products generated influence Cas9 activity, we performed similar experiments using 601 80/80 particles and the yeast chromatin remodeler RSC. We find that RSC activity also dramatically enhances cleavage on 601 80/80 nucleosomes when Cas9 is targeted to the entry site, negating most of the inhibitory influence of the nucleosome on Cas9 (Figure 3E–F). These results demonstrate that two different classes of chromatin remodeling enzymes can significantly enhance Cas9 access to DNA targets normally obscured by nucleosomes.

Discussion

Here we demonstrate, using detailed biochemical studies with a variety of nucleosomal templates, that (i) the intrinsic stability of the histone-DNA interactions, (ii) the location of the target site within the nucleosomes (nucleosome positioning), and (iii) the action of chromatin remodeling enzymes play critical roles in regulating the activity of S. pyogenes Cas9. Below we discuss the implications of our results. Nucleosomes have been shown to inhibit the action of DNA binding factors. Recent work using nucleosomes assembled on the 601 sequence has led to the qualitatively similar conclusion that nucleosomes are refractory for Cas9 action (Hinz et al., 2015; Horlbeck et al., 2016). The comparison here between Cas9 action on 601 nucleosomes vs. nucleosomes assembled on the native 5S sequence suggests a more refined model for how nucleosomes regulate Cas9 action. We find that Cas9 sites near the entry/exit sites of 5S nucleosomes are cleaved ~700-fold better than the corresponding sites within 601 nucleosomes. Given that DNA breathing occurs at least 100-fold more in 5S nucleosomes than 601 nucleosomes we propose that Cas9 gains access to nucleosomal DNA when the DNA is transiently unpeeled from the histone octamer. This model also explains why sites closer to the entry/exit sites are cut more readily by Cas9 than sites near the dyad. This is because DNA unpeeling up to the dyad is substantially less favored (100-fold) for both the 601 and 5S nucleosomes than DNA unpeeling near their respective entry/exit sites (Anderson and Widom, 2000). In vivo, as in vitro, the precise position of nucleosomes can greatly affect DNA factor binding. Chromatin remodeling enzymes can move nucleosomes away or towards the factor binding sites to respectively enhance or inhibit factor binding. We find that Cas9 activity can also benefit from chromatin remodeling to access nucleosomal DNA, as evidenced by the strong enhancements of Cas9 cleavage resulting from the action of the chromatin remodelers SNF2h and RSC. These two remodelers produce distinct nucleosomal arrangements yet still substantially alleviate nucleosome-mediated occlusion of Cas9 activity. In combination, our data lead to a comprehensive model that reconciles both biochemical evidence and in vivo observations to explain how Cas9 is able to access nucleosomal DNA in live cells (Figure 3I). In vivo, the majority of nucleosomes are not located on strong positioning sequences, and therefore may be permissive to Cas9 binding, especially at target sites that are readily accessible by DNA unpeeling. Chromatin remodeling activities can further provide diverse mechanisms to potentiate Cas9 activity at sites located close to the nucleosomal dyad or within more strongly positioned nucleosomes, which would otherwise be refractory to Cas9 action. We hypothesize that the combination of spontaneous DNA unpeeling and remodeling contributes to the widespread success of CRISPR-Cas9 in eukaryotic cells. Interestingly, most applications of CRISPR-Cas9 in vivo have focused on genome engineering of protein-coding genes and other functional genomic elements associated with gene expression, which are typically associated with high rates of nucleosome remodeling (Clapier and Cairns, 2009). It is also conceivable that Cas9 can temporarily gain access to less accessible regions of the genome during specific points of cell cycle (e.g. DNA replication), leading to sufficient DNA cleavage events to promote NHEJ-mediated mutagenesis or HDR-mediated DNA integration at appreciable rates. Recent studies on Cas9’s behavior by single molecule imaging have also demonstrated that Cas9 favors more accessible euchromatin regions but is not completely excluded from transcriptionally silent heterochromatin (Knight et al., 2015). For other CRISPR applications that require stable binding of nuclease-deficient dCas9 to DNA, such as transcriptional regulation and live-cell imaging with fluorescent dCas9, even modest nucleosome phasing could have a dramatic impact (Gilbert et al., 2013; Mali et al., 2013; Chen et al., 2013; Ma et al., 2015). For example, the +1 nucleosome in RNA pol II-transcribed genes is strongly positioned with phasing that dissipates gradually with each following nucleosome. Several high resolution studies conducted in parallel to our work have established that the +1 nucleosome and resulting nucleosome phasing can exert a strong influence on dCas9’s DNA-binding ability for transcriptional regulation, but the effect is less striking on genome editing with Cas9 (Horlbeck et al., 2016; Smith et al., 2016). Our observations suggest that sgRNA design strategies that avoid targeting near the dyad of strongly phased nucleosomes are likely to be more successful than current methods. Large scale nucleosome positioning or DNA accessibility maps are now readily available and can inform CRISPR sgRNA design in order to avoid targeting regions of low accessibility (Jiang and Pugh, 2009; Thurman et al., 2012; Wu et al., 2014; Hsieh et al., 2015). Alternatively, whole cell chromatin de-condensation or de-repression using chromatin factor drugs such as HDAC or DNA methyltransferase inhibitors may be an alternative and attractive strategy for improving CRISPR-Cas9 activity towards densely compact regions of chromatin (Haaf, 1995; Tóth et al., 2004).

Materials and methods

Cas9 and sgRNA preparation

Wild-type Streptococcus pyogenes Cas9 and catalytically-inactive Cas9 (dCas9) containing D10A and H840A mutations were individually cloned into a custom pET-based expression vector encoding an N-terminal 6xHis-tag followed by a small ubiquitin-related modifier (SUMO) fusion tag and a Ulp1 protease cleavage site. Recombinant Cas9 variants were then expressed in Escherichia coli strain BL21 (DE3) (Novagen) and further purified to homogeneity as previously described (Jiang et al., 2015). Single guide RNAs (sgRNAs) were prepared by in vitro run-off transcription using recombinant His-tagged T7 RNA polymerase and PCR product templates. Briefly, the DNA templates containing a T7 promoter, a 20-nt target DNA sequence (listed in Table 1) and an optimal 78-nt sgRNA scaffold were PCR amplified using Phusion Polymerase (NEB) according to manufacturer’s protocol. The following PCR products were used directly as DNA templates for in vitro RNA synthesis in 1x transcription buffer (30 mM Tris-HCl pH 8.1, 20 mM MgCl2, 2 mM spermidine, 10 mM DTT, 0.1% Triton X-100, 5 mM each NTP, and 100 μg mL-1 T7 RNA polymerase). After incubation at 37°C for 4–8 hr, the reactions were further treated with RNase-free DNase I (Promega) at 37°C for 30 min to remove the DNA templates. The synthesized sgRNAs were purified by Ambion MEGAclear kit and eluted into DEPC-treated H2O for downstream experiments.
Table 1.

Spacer sequences for sgRNAs used in biochemistry experiments.

DOI: http://dx.doi.org/10.7554/eLife.13450.046

sgRNA #Guide sequencePAMTarget strandFigures where used
601_1CGAGTTCATCCCTTATGTGATGGAntisenseFigure 1D
601_2 (entry)AATTGAGCGGCCTCGGCACCGGGSenseFigure 1D, Figure 2B–D, Figure 2—figure supplement 1, Figure 3E–H, Figure 3—figure supplement 1D–E
601_3 (core)CCCCCGCGTTTTAACCGCCAAGGAntisenseFigure 1B–D, Figure 1—figure supplement 1B–C, Figure 2B–D, Figure 2—figure supplement 1
601_4GTATATATCTGACACGTGCCTGGSenseFigure 1D
601_5TCGCTGTTCAATACATGCACAGGSenseFigure 1D
601_6GCGACCTTGCCGGTGCCAGTCGGAntisenseFigure 1D
5S_1 (entry)TCTGATCTCTGCAGCCAAGCAGGSenseFigure 2B–E, Figure 2—figure supplement 1
5S_2 (core)TATGGCCGTAGGCGAGCACAAGGAntisenseFigure 2B–E, Figure 2—figure supplement 1
Spacer sequences for sgRNAs used in biochemistry experiments. DOI: http://dx.doi.org/10.7554/eLife.13450.046

Nucleosome reconstitution

Gradient salt dialysis was used to assemble mono-nucleosomes on DNA templates containing the 147 bp long 601 or the 5S positioning sequence from X. borealis (listed in Table 2), and labeled with fluorescein on the 5’ upstream end. Histones and histone octamers were prepared as previously described (Luger et al., 1999).
Table 2.

Sequences for DNA molecules used for biochemical assays (Positioning sequence highlighted in grey).

DOI: http://dx.doi.org/10.7554/eLife.13450.047

NameSequence
601 80/80CGGGATCCTAATGACCAAGGAAAGCATGATTCTTCACACCGAGTTCATCCCTTATGTGATGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACCTTGCCGGTGCCAGTCGGATAGTGTTCCGAGCTCCCACTCTAGAGGATCCCCGGGTACCGA
601 0/0CTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT
601 80/0CGGGATCCTAATGACCAAGGAAAGCATGATTCTTCACACCGAGTTCATCCCTTATGTGATGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT
5S 0/0GGCCCGACCCTGCTTGGCTGCAGAGATCAGACGATATCGGGCACTTTCAGGGTGGTATGGCCGTAGGCGAGCACAAGGCTGACTTTTCCTCCCCTTGTGCTGCCTTCTGGGGGGGGCCCAGCCGGATCCCCGGGCGAGCTCGAATT
Sequences for DNA molecules used for biochemical assays (Positioning sequence highlighted in grey). DOI: http://dx.doi.org/10.7554/eLife.13450.047

Cas9 cleavage assays

Cleavage assays were conducted as previously described with the following modifications (Anders and Jinek, 2014). Cas9:sgRNA complexes were reconstituted by incubating Cas9 and sgRNA for 10 min at 37°C. Reactions contained 5 nM fluorescein labeled DNA or nucleosomes and 100 nM Cas9:sgRNA. In combined cleavage and remodeling experiments, 25 nM SNF2h or 3 nM RSC was first incubated with 5 nM naked DNA or nucleosomes for 45 min at 37°C (Narlikar et al., 2001). Cleavage assays were carried out in reaction buffer (20 mM Tris-HCl pH 7.5, 70 mM KCl, 5 mM MgCl2, 5% Glycerol, and 1 mM DTT) at 25°C. For SNF2h and RSC remodeling experiments, 0.2 mM ATP was also added. For RSC remodeling experiments, 1 mM MgCl2 was used. Time points were quenched using stop buffer (20 mM Tris-HCl pH 7.5, 70 mM EDTA, 2% SDS, 20% glycerol, and 0.2 mg/mL xylene cyanol and bromophenol blue). Proteins were digested with 3 mg/mL of Proteinase K and incubated at 50°C for 20 min. Samples were resolved on 1x TBE, 10% Polyacrylamide gels for 4 hr at 140 V before visualizing using a Typhoon scanner (GE Healthcare) and quantifying with Image J (Schneider et al., 2012). For band quantification, background intensity was first subtracted after averaging the intensity of three areas. For cleavage gels, fraction uncleaved was determined by measuring the intensity of the uncleaved band compared to the total intensity for the lane. Similarly, fraction unbound was determined by measuring the intensity of the unbound band compared to the total intensity for the lane. All experiments were performed in triplicate. Experiment variability is presented as the standard error of the mean, calculated by the standard deviation divided by the square root of N. Propagation of error for Rates of Cleavage on Nucleosomes to Rates of Cleavage on DNA was calculated as follows: Data were fit on Graphpad Prism using a standard one phase decay model: where Y is the fraction of uncleaved DNA, Y0 is the value of Y at time = 0, k is the observed rate constant (min-1) and t is time (min).

Native gel mobility shift assays

dCas9 and a 2x molar ratio of sgRNA were incubated for 10 min at 37°C. Various concentrations of dCas9:sgRNA complex were incubated with 20 nM naked DNA or nucleosomes in binding buffer (20 mM Tris-HCl pH 7.5, 100 mM KCl, 5 mM MgCl2, 5% Glycerol, 1 mM DTT, and 0.02% NP-40). Samples were incubated at room temperature for 1 hr before being run on native 0.5X TBE 6% polyacrylamide gels, visualized on a Typhoon scanner, and quantified using ImageJ. Fraction unbound was measured as the intensity of all unbound species divided by the total intensity. Fraction unbound was then converted to fraction bound: and binding curves were fit with: In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. [Editors’ note: this article was originally rejected after discussions between the reviewers, but the paper was accepted for publication after an appeal against the decision.] Thank you for submitting your work entitled "Nucleosome Positioning, Dynamics and Remodeling Constrain CRISPR-Cas9 Function" for consideration by eLife. Your article has been reviewed by two peer reviewers, one of whom is a member of our Board of Reviewing Editors, and Jessica Tyler as the Senior Editor. Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife. The reviewers agree that the work was performed to a high standard and addresses an important problem. However, the advances represented by this study are relatively small in light of recent publications on this topic. Although the reviewers did have suggestions for increasing impact, we feel that these fall outside the realm of typical revisions at eLife. Reviewer #1: This short article from the Narlikar lab presents a detailed biochemical analysis of the effects of nucleosomes on binding and activity of CRISPR-Cas9. The main take-home is that nucleosomes block binding of Cas9 to PAM sites, thereby strongly inhibiting CRISPR-Cas9 cleavage activity. The authors begin by studying cleavage of mononucleosomal DNA comprising the 601 element with 80 bp of DNA on either side. They use sgRNAs that target sites within the nucleosome dyad, at the entry/exit sites, or within linker DNA. In full agreement with recently published work (Hinz et al. Biochemistry 2015), they find that linker DNA is efficiently cleaved, but that DNA sites near the dyad are nearly completely protected by the nucleosome. Presumably due to DNA breathing, a low level of cleavage is observed at entry/exit sites. This data is clear and very well presented. Next, the authors investigate which step is inhibited, and use gel shifts to demonstrate that the initial binding of Cas9 to PAM-containing DNA is blocked by nucleosomes. However, they also report a curious, non-specific binding of Cas9 to linker DNA that obscures this result, and forces them to use only 601 particles lacking linker DNA. This detracts from the resulting conclusions in that they can't compare specific binding near the dyad to binding at entry sites or linker regions. But the basic finding remains convincing: chromatin blocks Cas9 from binding PAM sites. Finally, the authors show that if a chromatin remodeler is used to move the nucleosome off the PAM site being targeted before Cas9 is mixed with DNA, then it can be more efficiently cleaved. I am not clear on what more we learn from this experiment, other than that it's another way to show that the position of a PAM site within a nucleosome dictates the efficiency of cleavage by CRISPR-Cas9. Overall, the manuscript is well written, the experiments are very nicely performed and presented, and the findings are compelling. However, I am not sure how much new is learned here beyond previous publications. The position-specific inhibition of CRISPR-Cas9 cleavage by nucleosomes was recently shown using nearly identical assays. So the novel aspect of this work is the delineation of the binding step as the point of inhibition, rather than unwinding or later steps. This is nice, but is I am not sure whether it represents a big step forward in our understanding, thus my enthusiasm for this work is only moderate. I wonder if the authors could perhaps provide more new information by performing an analysis of cleavage during remodeling (rather than afterwards) and by using a remodeler that doesn't reposition nucleosomes, but just makes them more dynamic, generating loops of potentially accessible DNA, etc. Also, all the work thus far has been done on the 601 DNA sequence, which is much more stable and translationally inflexible than other sequences, and this must be considered in interpretation. Reviewer #2: This manuscript studies the effect of nucleosome position on Cas9 binding to and cleavage of DNA targets. This is a very important subject given the current poor understanding of how Cas9 interacts with chromatinized DNA. This is a short study simply showing reduced cutting by Cas9 when nucleosomes are present. This is an interesting observation, but the cursory nature of the investigation and the previous report of essentially identical results decreases the overall impact of the work. The study would be significantly strengthened by a deeper analysis how Cas9 finds and interacts targets on nucleosomal and non-nucleosomal DNA. 1) The 2015 paper from Hinz, Laughery and Wyrick shows essentially identical results to the main points of this study. Although the current study includes the analysis of Cas9 cutting in the present of Snf2h, this is not assessed in depth. 2) Only a single gRNA and target site combination is studied. Because of the widely observed differences in activity of different gRNAs, it is important to study different gRNAs and determine that the results shown here are not unique to one or more particular targets. A similar problem is shown in Figure 1D, where the experiment is designed to study the variable of position within the nucleosome, but the variable of sequence identity of the target site is also changing and therefore convoluting the results. Since only a single target DNA strand was analyzed, it's difficult to generalize the observations. It would strengthen the conclusions to evaluate target site position independent of sequence. 3) The authors should consider making an additional effort to resolving their model with the many published studies showing Cas9 gene editing and dCas9 binding in heterochromatin. Some of these studies even show remodeling of chromatin in mammalian cells – how might this happen given the new results shown here? Does the proposed model in Figure 3E help predict gene editing activity within eukaryotic cells? Or does it at least explain differences in gene editing efficiency between target sites already described in the literature? Can the authors use the referenced nucleosome positioning maps to explain published data (or new data on gene editing in cells that they generate)? [Editors’ note: the author responses to the first round of peer review follow.] We are writing to appeal the decision by eLife on our manuscript, which was being considered as a co-submission with the manuscript by Weissman and colleagues. The critiques by the reviewers were very helpful in focusing us on the key issues of understanding how nucleosomes impede Cas9. Thus, in the last few weeks we have gathered significant additional data that addresses the core concerns of the reviewers and substantially widens the scope of our conclusions. The data provides a far deeper understanding of Cas9-nucleosome interactions. Our new results challenge the emerging simple view that nucleosomes are inhibitory. We find that nucleosomes assembled on native DNA sequences readily allow Cas9 action at locations that are inhibited when artificially derived nucleosome positioning sequences are used (the 601 sequence that has been used in all the published studies to date). These data uncover the dynamic range of Cas9 activity as influenced by nucleosomes and provide a mechanistic framework to understand how nucleosome dynamics can be leveraged to enhance Cas9 action in vivo. The reviewers agree that the work was performed to a high standard and addresses an important problem. However, the advances represented by this study are relatively small in light of recent publications on this topic. Although the reviewers did have suggestions for increasing impact, we feel that these fall outside the realm of typical revisions at eLife. eLife is highly selective, which means that the majority of submissions are rejected, but we thank you for sending your work for review and we hope you will submit to eLife again in the future. Both reviewers thought the paper was well written and technically compelling, but their major criticism was that our result that nucleosomes can block Cas9 cleavage has been previously shown. In response to these criticisms, we have significantly improved the paper by adding several critical pieces of new data that provide a far more nuanced and refined view of the important question of how Cas9 can interact with eukaryotic chromatinized DNA. We thank the reviewers for their excellent suggestions. These new data are: 1) We have examined Cas9 cleavage of more natural nucleosome particles. All prior studies (including our original data) have been performed using the 601 sequence element, which is an in vitro selected sequence that positions nucleosomes more rigidly compared to most native sequences. We have now repeated these studies with the naturally derived 5S element, which is one of the strongest natural sequences with respect to nucleosome positioning. Strikingly we find that the 5S DNA is up to 700-times more accessible to Cas9 than the artificial 601, although the dyad is still well protected. These data suggest a revised model – that many natural nucleosomes have sufficient dynamic breathing properties to allow for Cas9 interrogation (except for regions close to the dyad). 2) We have tested the effects of a second chromatin remodeler (RSC) that functions by a different mechanism than SNF2h. RSC slides nucleosomes and, additionally, generates DNA loops. We now find that RSC has even greater ability than SNF2h to improve Cas9 accessibility. Thus our new results provide a newer, more refined model of how Cas9 can interact with and interrogate chromatinized DNA. Our findings suggest that natural nucleosomes might have sufficient dynamic DNA breathing to allow for Cas9 searching and binding. Moreover, several classes of remodelers that reposition or destabilize nucleosomes can also favor Cas9 binding. This more comprehensive picture of Cas9 interactions with nucleosomes provides an explanation for why Cas9 has empirically proven so successful in accessing many endogenous loci. This model also provides ideas for how one can optimally pick Cas9 targets or how accessibility could be improved. Overall, we feel that this paper now provides significant advances over the prior work on this subject. Reviewer #1: This short article from the Narlikar lab presents a detailed biochemical analysis of the effects of nucleosomes on binding and activity of CRISPR-Cas9. The main take-home is that nucleosomes block binding of Cas9 to PAM sites, thereby strongly inhibiting CRISPR-Cas9 cleavage activity. The authors begin by studying cleavage of mononucleosomal DNA comprising the 601 element with 80 bp of DNA on either side. They use sgRNAs that target sites within the nucleosome dyad, at the entry/exit sites, or within linker DNA. In full agreement with recently published work (Hinz et al. Biochemistry 2015), they find that linker DNA is efficiently cleaved, but that DNA sites near the dyad are nearly completely protected by the nucleosome. Presumably due to DNA breathing, a low level of cleavage is observed at entry/exit sites. This data is clear and very well presented. Next, the authors investigate which step is inhibited, and use gel shifts to demonstrate that the initial binding of Cas9 to PAM-containing DNA is blocked by nucleosomes. However, they also report a curious, non-specific binding of Cas9 to linker DNA that obscures this result, and forces them to use only 601 particles lacking linker DNA. This detracts from the resulting conclusions in that they can't compare specific binding near the dyad to binding at entry sites or linker regions. But the basic finding remains convincing: chromatin blocks Cas9 from binding PAM sites. Finally, the authors show that if a chromatin remodeler is used to move the nucleosome off the PAM site being targeted before Cas9 is mixed with DNA, then it can be more efficiently cleaved. I am not clear on what more we learn from this experiment, other than that it's another way to show that the position of a PAM site within a nucleosome dictates the efficiency of cleavage by CRISPR-Cas9. Overall, the manuscript is well written, the experiments are very nicely performed and presented, and the findings are compelling. However, I am not sure how much new is learned here beyond previous publications. The position-specific inhibition of CRISPR-Cas9 cleavage by nucleosomes was recently shown using nearly identical assays. So the novel aspect of this work is the delineation of the binding step as the point of inhibition, rather than unwinding or later steps. This is nice, but is I am not sure whether it represents a big step forward in our understanding, thus my enthusiasm for this work is only moderate. We thank the reviewer for their careful reading of the manuscript. We have used the suggestions made by the reviewer to strengthen the study and increase its impact as described below in a point-by-point manner. I wonder if the authors could perhaps provide more new information by performing an analysis of cleavage during remodeling (rather than afterwards) and by using a remodeler that doesn't reposition nucleosomes, but just makes them more dynamic, generating loops of potentially accessible DNA, etc. We have now performed the experiment with analysis of cleavage during remodelling by SNF2h and we observe similar rate enhancements. Simultaneous cleavage results in a rate that is ~40% compared to naked DNA while sequential cleavage increases to ~35% compared to naked DNA (see Figure 3—figure supplement 2). In terms of the reviewer’s latter suggestion we have now investigated the effects of another chromatin remodeler, RSC. In contrast to SNF2h, which only slides nucleosomes away from DNA ends, RSC generates a wider range of remodelled products that are thought to include nucleosomes with DNA loops in addition to nucleosomes with different translational positions. We find that RSC activity also enhances Cas9 cleavage and has a larger stimulatory effect than SNF2h. These results strengthen our model that chromatin remodeling activities can potentiate Cas9 activity on nucleosomal DNA in vivo. Also, all the work thus far has been done on the 601 DNA sequence, which is much more stable and translationally inflexible than other sequences, and this must be considered in interpretation. The reviewer makes an excellent point. The published Biochemistry study as well as our first submission used the artificial 601 sequence to assemble nucleosome core particles. Previous work by the Widom group has shown that nucleosomes assembled on the 601 sequence show ~100-fold less DNA breathing than the naturally occurring 5S sequence (Anderson et al. J. Mol. Biol., 2000). To test if such increased DNA breathing increases Cas9 activity we compared Cas9 cutting on 5S nucleosome particles. With these more physiological 5S nucleosomes we detect ~700-fold higher Cas9 cleavage rates compared to rates at the same relative position on 601 nucleosomes. Our new results (i) strengthen our previous model that DNA breathing dynamics regulate Cas9 activity towards nucleosomal DNA and (ii) demonstrate that nucleosomal DNA sequence can regulate Cas9 activity over a large dynamic range. The results also imply that most nucleosomes in vivo, which are located on weaker positioning sequences than 5S, may not present large impedances to Cas9. Reviewer #2: This manuscript studies the effect of nucleosome position on Cas9 binding to and cleavage of DNA targets. This is a very important subject given the current poor understanding of how Cas9 interacts with chromatinized DNA. This is a short study simply showing reduced cutting by Cas9 when nucleosomes are present. This is an interesting observation, but the cursory nature of the investigation and the previous report of essentially identical results decreases the overall impact of the work. The study would be significantly strengthened by a deeper analysis how Cas9 finds and interacts targets on nucleosomal and non-nucleosomal DNA. We thank the reviewer for their suggestions. We have incorporated new data that helps address the core concerns as detailed below. 1) The 2015 paper from Hinz, Laughery and Wyrick shows essentially identical results to the main points of this study. Although the current study includes the analysis of Cas9 cutting in the present of Snf2h, this is not assessed in depth. As the reviewer mentioned, our results do indeed confirm the observations recently reported in Hintz et al. Biochemistry 2015, but our initial study built on the published work by (a) showing that nucleosomes inhibited the binding step of Cas9 to PAMs and (b) that remodelling enzymes can alleviate the inhibitory effect of a nucleosome. However, both the reviewers’ comments led us to perform additional experiments to probe more deeply how nucleosomes regulate Cas9 activity. a) We find that changing the DNA sequence from the strong and artificial positioning sequence, 601, to a naturally occurring positioning sequence, 5S, dramatically increases (by ~700-fold) the ability of Cas9 to access nucleosomal DNA. This result is consistent with old observations that 5S nucleosomal DNA breathes ~100-fold more than 601 nucleosomal DNA (Anderson et al., J. Mol Biol., 2000). Our new results thus (i) strengthen our previous model that DNA breathing dynamics regulate Cas9 activity towards nucleosomal DNA and (ii) demonstrate that nucleosomal DNA sequence can regulate Cas9 activity over a large dynamic range. In comparison, the published Biochemistry study used solely 601 nucleosomes. b) We have now investigated the effects of another chromatin remodeler, RSC. In contrast to SNF2h, which only slides nucleosomes away from DNA ends, RSC generates a wider range of remodeled products that are thought to include nucleosomes with DNA loops in addition to nucleosomes with different translational positions. We find that RSC activity also enhances Cas9 cleavage and has a larger stimulatory effect than SNF2h, bringing the rate of cutting to nearly the same level as on naked DNA. Together, the two new results outlined in (a) and (b) lead to the following, more comprehensive model to explain how Cas9 is able to access nucleosomal DNA in vivo: Most nucleosomes in vivo, are located on weaker positioning sequences than 5S, and thus may not present large intrinsic impedances to Cas9, especially when the sites are accessible through DNA breathing. For Cas9 targets that are either present closer to the dyad of the nucleosome or present within nucleosomes occupying strong positioning sequences, chromatin remodeling activities can provide diverse mechanisms to potentiate Cas9 activity. 2) Only a single gRNA and target site combination is studied. Because of the widely observed differences in activity of different gRNAs, it is important to study different gRNAs and determine that the results shown here are not unique to one or more particular targets. A similar problem is shown in Figure 1D, where the experiment is designed to study the variable of position within the nucleosome, but the variable of sequence identity of the target site is also changing and therefore convoluting the results. Since only a single target DNA strand was analyzed, it's difficult to generalize the observations. It would strengthen the conclusions to evaluate target site position independent of sequence. The reviewer raises a critical point. To control for the intrinsic variations introduced by the different guide RNA sequences we always normalize nucleosome cleavage rates for each individual sgRNA to their rates on the naked DNA target (Figure 1D). This normalization isolates nucleosome specific effects on Cas9 activity, allowing comparisons across multiple nucleosome positions. We have better clarified the normalization procedure in the revised manuscript. Furthermore, the activity of the sgRNAs used in our experiments was confirmed using cleavage assays with naked DNA. sgRNA designs found to be substantially less effective were replaced with alternative designs with similar target sites in order to preserve the dynamic range of our experiments. 3) The authors should consider making an additional effort to resolving their model with the many published studies showing Cas9 gene editing and dCas9 binding in heterochromatin. Some of these studies even show remodeling of chromatin in mammalian cells – how might this happen given the new results shown here? Does the proposed model in Figure 3E help predict gene editing activity within eukaryotic cells? Or does it at least explain differences in gene editing efficiency between target sites already described in the literature? Can the authors use the referenced nucleosome positioning maps to explain published data (or new data on gene editing in cells that they generate)? We agree with the reviewer that reconciling our observations that the strong effect nucleosomes have on Cas9 activity with widespread observations of Cas9 activity in vivo is of great importance. We address these issues below. i) As described in response to the Major concern #1 above, the additional data in this revision leads to a comprehensive model in which, (a) Cas9 acts on nucleosomes occupying weak positioning sequences without substantial inhibition and (b) Cas9 opportunistically benefits from the action of different remodelers to act on nucleosomes assembled on strong positioning sequences. ii) As the reviewer points out dCas9 binding in vivo can increase DNA accessibility in regions that are occupied by nucleosomes. Our results indicate that Cas9 can readily act at the entry/ exit sites of nucleosomes assembled on native DNA sequences like 5S by taking advantage of DNA breathing. We speculate that when dCas9 accesses such sites, its slow off rate keeps the unpeeled DNA from re-annealing with the histone octamer, thus making the histones more susceptible to disassembly by cellular histone chaperones or chromatin remodelers. iii) The reviewer suggests performing a correlation analysis on nucleosome position maps and published gene editing efficiency datasets to validate our mechanistic model. Previous in vivo dCas9 binding studies have already established that nucleosome-free regions are more amenable to Cas9 binding (Kuchu et al. and Wu et al., Nature Biotechnology, 2014). Furthermore, a higher resolution study on Cas9 editing/gene regulation efficiencies in vivo using purposefully designed, high density sgRNA libraries over a large number of genes is described in a parallel studies in human cells (Horlbeck and Witkowsky et al., eLife, 2016) and in yeast (Smith et al., Genome Biology, 2016) where the authors find that Cas9 function is negatively correlated with nucleosome positioning. These in vivo findings are in agreement with, and complementary to our mechanistic biochemical studies.
  50 in total

1.  Preparation of nucleosome core particle from recombinant histones.

Authors:  K Luger; T J Rechsteiner; T J Richmond
Journal:  Methods Enzymol       Date:  1999       Impact factor: 1.600

2.  Generation and interconversion of multiple distinct nucleosomal states as a mechanism for catalyzing chromatin fluidity.

Authors:  G J Narlikar; M L Phelan; R E Kingston
Journal:  Mol Cell       Date:  2001-12       Impact factor: 17.970

Review 3.  New insights into nucleosome and chromatin structure: an ordered state or a disordered affair?

Authors:  Karolin Luger; Mekonnen L Dechassa; David J Tremethick
Journal:  Nat Rev Mol Cell Biol       Date:  2012-06-22       Impact factor: 94.444

4.  Crystal structure of the nucleosome core particle at 2.8 A resolution.

Authors:  K Luger; A W Mäder; R K Richmond; D F Sargent; T J Richmond
Journal:  Nature       Date:  1997-09-18       Impact factor: 49.962

Review 5.  Genome editing. The new frontier of genome engineering with CRISPR-Cas9.

Authors:  Jennifer A Doudna; Emmanuelle Charpentier
Journal:  Science       Date:  2014-11-28       Impact factor: 47.728

6.  Mechanism of protein access to specific DNA sequences in chromatin: a dynamic equilibrium model for gene regulation.

Authors:  K J Polach; J Widom
Journal:  J Mol Biol       Date:  1995-11-24       Impact factor: 5.469

Review 7.  An updated evolutionary classification of CRISPR-Cas systems.

Authors:  Kira S Makarova; Yuri I Wolf; Omer S Alkhnbashi; Fabrizio Costa; Shiraz A Shah; Sita J Saunders; Rodolphe Barrangou; Stan J J Brouns; Emmanuelle Charpentier; Daniel H Haft; Philippe Horvath; Sylvain Moineau; Francisco J M Mojica; Rebecca M Terns; Michael P Terns; Malcolm F White; Alexander F Yakunin; Roger A Garrett; John van der Oost; Rolf Backofen; Eugene V Koonin
Journal:  Nat Rev Microbiol       Date:  2015-09-28       Impact factor: 60.633

8.  A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families.

Authors:  Valmik K Vyas; M Inmaculada Barrasa; Gerald R Fink
Journal:  Sci Adv       Date:  2015       Impact factor: 14.136

9.  CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering.

Authors:  Prashant Mali; John Aach; P Benjamin Stranges; Kevin M Esvelt; Mark Moosburner; Sriram Kosuri; Luhan Yang; George M Church
Journal:  Nat Biotechnol       Date:  2013-08-01       Impact factor: 54.908

10.  Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system.

Authors:  Baohui Chen; Luke A Gilbert; Beth A Cimini; Joerg Schnitzbauer; Wei Zhang; Gene-Wei Li; Jason Park; Elizabeth H Blackburn; Jonathan S Weissman; Lei S Qi; Bo Huang
Journal:  Cell       Date:  2013-12-19       Impact factor: 41.582

View more
  75 in total

1.  Evaluation and rational design of guide RNAs for efficient CRISPR/Cas9-mediated mutagenesis in Ciona.

Authors:  Shashank Gandhi; Maximilian Haeussler; Florian Razy-Krajka; Lionel Christiaen; Alberto Stolfi
Journal:  Dev Biol       Date:  2017-03-22       Impact factor: 3.582

2.  Nucleosomes Selectively Inhibit Cas9 Off-target Activity at a Site Located at the Nucleosome Edge.

Authors:  John M Hinz; Marian F Laughery; John J Wyrick
Journal:  J Biol Chem       Date:  2016-10-18       Impact factor: 5.157

3.  Internal Structure and Preferential Protein Binding of Colloidal Aggregates.

Authors:  Da Duan; Hayarpi Torosyan; Daniel Elnatan; Christopher K McLaughlin; Jennifer Logie; Molly S Shoichet; David A Agard; Brian K Shoichet
Journal:  ACS Chem Biol       Date:  2016-12-16       Impact factor: 5.100

4.  Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells.

Authors:  Daesik Kim; Jungeun Kim; Junho K Hur; Kyung Wook Been; Sun-Heui Yoon; Jin-Soo Kim
Journal:  Nat Biotechnol       Date:  2016-06-06       Impact factor: 54.908

5.  CRISPR-Cas12a has widespread off-target and dsDNA-nicking effects.

Authors:  Karthik Murugan; Arun S Seetharam; Andrew J Severin; Dipali G Sashital
Journal:  J Biol Chem       Date:  2020-03-11       Impact factor: 5.157

6.  Massively parallel kinetic profiling of natural and engineered CRISPR nucleases.

Authors:  Stephen K Jones; John A Hawkins; Nicole V Johnson; Cheulhee Jung; Kuang Hu; James R Rybarski; Janice S Chen; Jennifer A Doudna; William H Press; Ilya J Finkelstein
Journal:  Nat Biotechnol       Date:  2020-09-07       Impact factor: 54.908

Review 7.  The Latest Twists in Chromatin Remodeling.

Authors:  Ralf Blossey; Helmut Schiessel
Journal:  Biophys J       Date:  2018-01-06       Impact factor: 4.033

8.  BEON: A Functional Fluorescence Reporter for Quantification and Enrichment of Adenine Base-Editing Activity.

Authors:  Peipei Wang; Li Xu; Yandi Gao; Renzhi Han
Journal:  Mol Ther       Date:  2020-04-16       Impact factor: 11.454

9.  The microRNA/TET3/REST axis is required for olfactory globose basal cell proliferation and male behavior.

Authors:  Dong Yang; Xiangbo Wu; Yanfen Zhou; Weina Wang; Zhenshan Wang
Journal:  EMBO Rep       Date:  2020-07-17       Impact factor: 8.807

10.  OCT4/POU5F1 is required for NANOG expression in bovine blastocysts.

Authors:  Kilian Simmet; Valeri Zakhartchenko; Julia Philippou-Massier; Helmut Blum; Nikolai Klymiuk; Eckhard Wolf
Journal:  Proc Natl Acad Sci U S A       Date:  2018-02-26       Impact factor: 11.205

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.