Literature DB >> 27063570

Rosa26-targeted sheep gene knock-in via CRISPR-Cas9 system.

Mingming Wu1, Caihong Wei2, Zhengxing Lian1, Ruizao Liu2, Caiye Zhu2, Huihua Wang2, Jiaxue Cao2, Yuelei Shen3, Fuping Zhao2, Li Zhang2, Zhu Mu4, Yayu Wang4, Xiaogang Wang4, Lixin Du2, Chuduan Wang1.   

Abstract

Recent advances in our ability to design DNA binding factors with specificity for desired sequences have resulted in a revolution in genetic engineering, enabling directed changes to the genome to be made relatively easily. Technologies that facilitate specific and precise genome editing, such as knock-in, are critical for determining the functions of genes and for understanding fundamental biological processes. The CRISPR/Cas9 system has recently emerged as a powerful tool for functional genomic studies in mammals. Rosa26 gene can encode a non-essential nuclear RNA in almost all organizations, and become a hot point of exogenous gene insertion. Here, we describe efficient, precise CRISPR/Cas9-mediated Integration using a donor vector with tGFP sequence targeted in the sheep genomic Rosa26 locus. We succeeded in integrating with high efficiency an exogenous tGFP (turboGFP) gene into targeted genes in frame. Due to its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in will become a standard method for the generation transgenic sheep.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27063570      PMCID: PMC4827023          DOI: 10.1038/srep24360

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Sheep is an important economic animals and production trait has become the main direction of sheep breeding. Transgenic animals with reporter gene expression in specific tissues or cell types are valuable experimental tools. Recently, programmable endonucleases, such as Zinc Finger Nucleases (ZFNs), Transcription activator-like effector nucleases (TALENs), and especially the CRISPR, the recently developed clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system, were shown to be a kind of revolutionary technologies for targeted genome editing1. CRISPR loci contain an array of short palindromic repeats separated by proto spacer DNA snippets of about 20 bp that have been acquired from such invading agents. Compared to ZFNs and TALENs, CRISPR/Cas9-mediated genome engineering is easy to handle, highly specific, efficient, and multiplexable2. Compared with protein-based genome editing tools with customizable DNA binding specificities, such as ZFNs and TALENS, the newer CRISPR/Cas9 platform is based on simple base-pairing between an engineered RNA and the targeted genomic site, which enables rapid design, ease of use, and low costs3. The Cas9 endonuclease is ushered to the specific site of interest by a single guide RNA (sgRNA), an engineered fusion molecule of the targeting CRISPR RNA (crRNA) and the trans-activating crRNA, to generate double-stranded DNA breaks (DSDBs) at the target site4. The CRISPR/Cas9 system has been demonstrated to be easy to handle, highly specific, efficient, and multiplexable, making it a suitable approach to the engineering of eukaryotic genomes5. This system has been successfully used to target genomic loci in several species, including mice, rats, zebrafish, and pigs678910. However, so far, there have been no reports of the use of CRISPR/Cas9-mediated knock-in DNA cassettes in the sheep genome. ROSA26 is a safe area, exogenous genes that decide a dot inside this site will not affect the expression of other genes. Rosa26 is ubiquitously expressed in embryonic and adult tissues11. Rosa26 was first identified and targeted in mouse embryonic stem cells (ESCs) in the 1990s and then in human ESCs in 200710. Efficient integration of transgenes at preselected chromosomal locations was achieved in mammalian cells by recombinase-mediated-cassette-exchange (RMCE), a novel procedure that makes use of the CRE recombinase together with Lox sites bearing different spacer regions. Here, the sheep Rosa26 (sRosa26) locus was characterized and its locus tagged with a knock-in reporter gene using a CRISPR/Cas9-mediated method. Using this approach, transgenic sheep stably over-expressing a gene of interest were also created through RMCE12. The most preferred integration site used for transgene insertionis the Rosa26 locus in mice. As in mice, the human and rat Rosa26 loci were identified and successfully targeted using traditional HR13. There have reported that knock-in of a long DNA fragment via homology-independent DNA repair can be achieved in zebrafish using the CRISPR/Cas9 system. In this method, co-injection of a donor plasmid, short guide RNAs (sgRNAs) and Cas9 mRNA leads to concurrent digestion of the genomic DNA and the donor plasmid, resulting in the incorporation of the donor plasmid into the genome1415. In some cases, fluorescent proteins such as GFP have been used for the characterisation and quantification of homologous recombination events as well as for endogenous gene-tagging and determination of subcellular localisation of expressed proteins16. Here, we have modified this method, and succeeded in generating knock-in transgenic sheep with reporter gene (tGFP) that mimics endogenous gene expression for the same targeted loci. The method is simple, and flexible in design. Furthermore, the efficiency of obtaining transgenic founders is 12.5%. We propose that CRISPR/Cas9 mediated knock-in will become a standard method for the generation of transgenic sheep lines.

Results

Confirmation of Rosa26 locus

The ensemble ovis database was searched using the mouse Rosa26 sequence as a template and a highly conserved region was located on the sheep chromosome 19 (Supplementary Table S1). Sequence alignments of porcine, murine, rat, and human Rosa26 sequences showed high sequence conservation (>70%) among these species (Supplementary Fig. S1). According to the homologous sequence between them. In mice, rats, and humans, the Rosa26 locus encodes non-coding RNAs that are ubiquitously expressed. RT-PCR and SYBR-green-based quantitative PCR assays demonstrated that this non-coding RNA was expressed in a wide variety of adult sheep tissues (Fig. 1a,b).
Figure 1

Characterization of sRosa26 and highly efficient gene knock-in and replacement at the sRosa26 locus.

(a,b) sRosa26 was expressed in a variety of organ tissues as determined by (a) RT-PCR and (b) quantitative RT-PCR. For RT-PCR, the designed primers annealed in sRosa26 sequence and amplified a correctly spliced product of 485 bp. Ovis GAPDH served as a control (234 bp). For qPCR, primers were specific to the sRosa26 sequence. The PCR product of the Ovis ACTB gene served as the reference control. Data are presented as the average expression levels of three individual RT/qPCR reactions.

Designation of the sgRNA for sRosa26 locus

Here, 5 guide RNAs (sgRNAs) were designed to target the sequence of the sRosa26 locus (Fig. 2 and Table 1). The activity of the CRISPR/Cas9 was assessed using a UCA kit. The results of genotyping with the UCA kit showed that all 5 sgRNAs efficiently guided Cas9 for genome editing (Fig. 2a). This led to non-homologous end-joining mediated insertions and deletions (indels) in the sRosa26 locus. The sgRNA with the highest activity was used to target the sRosa26 locus.
Figure 2

(a) Analysis of sgRNA activity. 5 guide RNAs (sgRNAs) were designed to target the sequence of the sRosa26 locus. All 5 sgRNAs efficiently guided Cas9 for genome editing.

Table 1

5 different sgRNA designations.

sgRNA Sequence (5′–3′)Target sequence length
sROSA26-sgRNA1target sequenceggaggcgatgacgagatcgc ggg20 + PAM
sROSA26-sgRNA1-Upcacc ggaggcgatgacgagatcgc
sROSA26-sgRNA1-Dnaaac gcgatctcgtcatcgcctcc
sROSA26-sgRNA2target sequenceggggagggagggattcttct agg20 + PAM
sROSA26-sgRNA2-Upcacc ggggagggagggattcttct
sROSA26-sgRNA2-Dnaaac agaagaatccctccctcccc
sROSA26-sgRNA3target sequencegacgagatcgcgggggaggg agg20 + PAM
sROSA26-sgRNA3-Upcacc ggacgagatcgcgggggaggg
sROSA26-sgRNA3-Dnaaac ccctcccccgcgatctcgtcc
sROSA26-sgRNA4target sequencegaggcgatgacgagatcgcg ggg20 + PAM
sROSA26-sgRNA4-Upcacc ggaggcgatgacgagatcgcg
sROSA26-sgRNA4-Dnaaac cgcgatctcgtcatcgcctcc
sROSA26-sgRNA5target sequencegtcgagtctctcctcgatta tgg20 + PAM
sROSA26-sgRNA5-Upcacc ggtcgagtctctcctcgatta
sROSA26-sgRNA5-Dnaaac taatcgaggagagactcgacc

5 guide RNAs (sgRNAs) were designed to target the sequence of the sRosa26 locus. The activity of the CRISPR/Cas9 was assessed using a UCA kit. All 5 sgRNAs efficiently guided Cas9 for genome editing.

Preparation of the CRISPR/Cas plasmids for genome engineering

The targeting vector contains a 1.0 Kb left arm and a 1.0 Kb right arm for homologous recombination (Fig. 3a). It also contains a CAG promoter (2753 bp, Supplementary Fig. S2). To validate the targeting efficiency of these sgRNAs, expression vectors were constructed in which a sgRNA was driven by the CAG promoter. An expression cassette comprising a viral splice acceptor (SA), a CAG promoter gene, and an tGFP gene was inserted between the homologous arms (Fig. 3a). The tGFP (928 bp, Supplementary Table S2) expression vector was designed to determine whether the exogenous gene can be expressed at the sRosa26 locus. The CAG promoter-driven tGFP vector was transfected into sheep fibroblasts. At 48 h post-transfection, a high level of tGFP expression was detected in sheep fibroblasts (Fig. 3b).
Figure 3

(a) Diagram of Cas9-mediated knock-in of LA-CAG-tGFP-polyA-RA into the sRosa26 locus. LA, left arm (1.0 kb); RA, right arm (1.0 kb). (b) CAG promoter-driven tGFP expression in sheep fibroblasts (CAG promoter region is shown in supplementary information).

Cas9/sgRNA-Mediated Genome Targeting Efficiently Transmits into Ovaries of Sheep

The germline transmission of genetic mutations is the necessary condition to establish genetically modified animals17. In vitro synthesized Cas9 mRNA (40 ng/μl), sgRNA (20 ng/μl), and expression vector (20 ng/μl) were injected into the single-cell sheep embryos. Out of the 35 injected embryos, 30 healthy embryos were transferred into surrogate mothers and 8 pups were born (Fig. 4 and Table 2). Out of these 8 pups, 1 had the tGFP gene at the sRosa26 locus and it was expressed in lamb ear tissues as indicated by PCR, Southern blot, RT-PCR and Western blot analysis (Fig. 4). And the sRosa26 locus sequence were detected by PCR and sequencing (Supplementary Fig. S3). The PCR and sequencing results showed that the tGFP gene locus was the sRosa26 target locus. These results suggest that the CRISPR/Cas9 system can induce mutations and knock-in DNA fragments in the sRosa26 locus very efficiently.
Figure 4

(a) PCR analysis of tGFP in tissues knock-in lambs. M = marker, N = negative control, P = postive control The size of target band is about 650 bp. (b) Southern blot analysis of tGFP–KI mutant sheep, Both the negative control and tGFP-KI sheep can be detected the target sequence. (c) RT- PCR analysis of tGFP expression in tissues knock-in lambs. All the lambs were 1 month old. tGFP gene expression quantity is 4.5 times that of the negative control. (d) Western blot analysis of tGFP–KI mutant sheep. Total protein from tGFP-KI sheep was subjected to SDS-PAGE on a 12% acrylamide gel. GADPH was used as a loading control. The tGFP gene expression cann’t be detected in controls.

Table 2

Numbers of injected and transferred embryos, newborns, and mutants generated during the establishment of knock-in sheep using gRNA/Cas9 system.

GeneNumber of embryos injectedNumber of embryos transferredNumber of new bornsNumber of mutations
sRosa26353081
Ration/85.7%26.7%12.5%

Cas9 mRNA and sgRNA were mixed and injected into sheep zygotes. The injected eggs were transferred into pseudopregnant females. The mutations were identified by sequencing PCR amplified 0.5 kbp genomic fragment containing target in the center. GMO; gene modified organism.

Discussion

Instead of knocking-in DNA constructs in the exon of a gene of interest, we knocked in constructs in the upstream region of a gene with the CAG promoter construct (Fig. 3a). There are advantages and a potential disadvantage in this approach. An advantage is that expression levels of transgenes are increased18. In our experience generating transgenic sheep, the usage of the CAG promoter instead of promoters of endogenous gene promoters increased the expression level of the transgene for many genes including tGFP. Another advantage is that a relatively large genomic region can be a subject of integration. This allowed that many sgRNAs can be tested by the usage of the CAG promoter. Transmission of the precise genome modification to the germline is a key to establishing a targeted gene knock-in line. In mice, rats, and humans, the Rosa26 locus encodes non-coding RNAs that are ubiquitously expressed13. So 5 guide RNAs (sgRNAs) were designed to target the sequence of the sRosa26 locus. In this study, we showed that the precise integration of exogenous DNA into the targeted genomic locus in sheep can be efficiently achieved using a donor vector containing short homology arms. We improved this method by introducing homology arms into a donor vector. In comparison to ZFNs and TALENs, the CRISPR/Cas9 system is suitable for this method because of the ease of donor-vector construction and of the multiple gRNA design1819. A conventional knock-in vector carries more than 800 bp of homology arms without cleavable sites2021. And the targeting vector contains a 1.0 Kb left arm and a 1.0 Kb right arm for homologous recombination. The CRISPR/Cas9 system has been used to introduce defined genetic modification in cultured cell system2223, but whether this could be applied to in vivo system and what parameter(s) is influential for its efficiency was less explored24. This is the first study to use oligonucleotides as templates to successfully knock DNA cassettes into the sheep genome via the CRISPR/Cas9 system. This is also the first recorded use of CRISPR/Cas9-mediated knock in of DNA sheep into the sRosa26 locus as part of a research exercise. Collectively, these data strongly suggest that the sRosa26 locus is an ideal site for expression of exogenous genes. But the using of Cas9-mediated knock-ins has not yet been reported in sheep. Here, this simple and efficient CRISPR/Cas9 system was successfully extended to the modification of the sheep genome at the sRosa26 locus. Unlike other ways of editing genes, which require construction of double-stranded DNA templates, this CRISPR/Cas9 system allows rapid and seamless editing of the genome at precise locations. It may become a powerful tool for assessing the functions of genes, altering critical residues in proteins to create desirable gain-of-function or loss-of-function mutations, and generating mutations in highly conserved proteins in sheep to facilitate the study of corresponding human diseases and agricultural production. All the results given above indicate that the sRosa26 locus is an excellent site for ubiquitous expression of exogenous genes. Taken together, these results indicate that transgenic sheep stably overexpressing a gene of interest could be generated through CRISPR/Cas9 sysem at the sRosa26 locus without any need for more sophisticated technology.

Methods

Ethics statement

All animals were housed and handled according to China Agricultural University Institutional Animal Care and Use Committee guidelines and all animal work was approved by the appropriate committee (IACUC 0000000 and 0000000A-1). All experiments were performed according to institutional guidelines.

Animals

All animals were handled according to the Guidelines for the Care and Use of Laboratory Animals established by the Beijing Association for Laboratory Animal Science. Animal experiments were approved by the Animal Ethics Committee of College of Biological Sciences of China Agricultural University.

Cell culture

A sheep fetal fibroblast (SFB) cell line (China Agricultural University) was cultured in the medium containing 10% fetal bovine (Gibco, USA) serum in 5% CO2 at 37 °C. The cells were seeded in 6-well plates (Thermo Scientific, USA). After 24 h, cells were co-transfected with a mixture of plasmid, pcDNA3.1(+)-Cas9, pMD-19T-U6-sgRNA, and tGFP expression vector with the mass ratio of 2:1:1 (2500 ng in total per well), following the instruction of Lipofectamine3000 (Life Technologies, USA). Cells were harvested 48 h after transfection.

Preparation of Cas9 mRNA and sgRNA

Cas9 and sgRNA coding regions containing the T7 promoter were PCR-amplified using DNA polymerase from each plasmid constructed above. The T7-Cas9 PCR products were gel purified and used as the template for in vitro transcription (IVT) using an mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Life Technologies, USA). The T7-sgRNA PCR product was gel-purified and used as the template for IVT using MEGA shortscript T7 Kit (Life Technologies). The sgRNA was purified by ethanol precipitation, and all products were re-dissolved in RNase-free water and stored at −80 °C. 5 guide RNAs (sgRNAs) were designed to target the sequence of the sRosa26 locus (Fig. 2 and Table 1). The activity of the CRISPR/Cas9 was assessed using a UCA kit (Beijing Biocytogen Co., Ltd, China).

Microinjection of zygotes and embryo transfer

The sheep zygotes were obtained by super-ovulation of females and artificial insemination. The zygotes were flushed from the oviduct using sterile filtered embryo flushing solution. After that, 2–5 pl TE solution containing 20 ng/μl of sgRNA, 40 ng/μl of Cas9 mRNA and expression vector (20 ng/μl) were injected into the cytoplasm of pronucleus embryos using injection needles. Injections were performed using an Eppendorf TransferMan NK2 micromanipulator.

Detection and Analysis of Indel Mutation in Lambs

Ear and muscle in hind leg were collected and digested in lysis buffer (10 μM Tris-HCl, 0.4 M EDTA, 1% SDS, and 100 μg/ml Proteinase K). And incubated at 50 °C for 1 hr, followed by extraction in 400 ml of phenolchloroform. The mixture was then centrifuged at 21,000 × g for 20 min at 4 °C. The supernatant was transferred to a new tube. An equal volume of isopropanol was added, and the tube was vortexed thoroughly. The mixture was then kept at −20 °C for at least 1 hr, followed by centrifugation at 21,000 × g for 20 min at 4 °C The supernatant was removed, and the DNA pellet was washed with 500 ml of 75% ethanol, Followed by centrifugation at 21,000 × g for 5 min at 4 °C. Finally, the pellet was dried for 10 min and resuspended in 30 ml of DNase-free water. For each samples, at least 100 clones were picked up randomly and sequenced.

Southern Blot detection

To confirm transgene insertion in the sheep genome, Southern Blot was performed using DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, 11585614910). DNA was isolate from the transgenic lambsand a wild type hu sheep tissue, Plasmid sRosa26-Gibson-HR1 was used as a positive control. The probe hybridizes to a 0.92 kb fragment depicted in Fig. 4b, indicating site-specific gene insertion.

Western blotting analysis

For Western blot analysis, total proteins were isolated from the samples by homogenization in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.25% sodium deoxycholate, and complete protease inhibitor cocktail (Roche). The concentration of proteins was measured by Bradford reagent (Sigma), separated on 10% SDS-PAGE gels and transferred to Immobilon-P membranes (Millipore). After blocking in 5% low-fat milk in PBST (0.1% Tween 20 in PBS) for 1 h, the membranes were incubated with tGFP antibody (1:500, SantaCruz Biotechnology), Fst antibody (1:500, Santa Cruz Biotech- nology) or mouse GAPDH antibody (1:2000, Santa Cruz Biotechnology) overnight at 4uC. After washing in PBST, the membranes were incubated in goat anti-rabbit antibody conjugated with horseradish peroxidase (1:5000) for 1 h, followed by three washes in PBST. The signals were detected by ECL Chemiluminescent kit (Amersham Pharmacia Biotech, Arlington Heights).

Off-target Analyses

Potential targets of tGFP gene and CAG promoter were detected using PCR amplifications with the program: 95 °C for 5 min; 95 °C for 1 min; 58 °C for 1 min, 72 °C for 1 min, 30 cycles, 72 °C for 10 min, store at 4 °C and the expression of tGFP gene were detected using RT-PCR, The target Rosa26 sequence were detected using PCR and Sanger sequencing (Invitrogen).

Additional Information

How to cite this article: Wu, M. et al. Rosa26-targeted sheep gene knock-in via CRISPR-Cas9 system. Sci. Rep. 6, 24360; doi: 10.1038/srep24360 (2016).
  22 in total

1.  Transcriptional behavior of LCR enhancer elements integrated at the same chromosomal locus by recombinase-mediated cassette exchange.

Authors:  E E Bouhassira; K Westerman; P Leboulch
Journal:  Blood       Date:  1997-11-01       Impact factor: 22.113

2.  Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice.

Authors:  G Friedrich; P Soriano
Journal:  Genes Dev       Date:  1991-09       Impact factor: 11.361

Review 3.  Transcription factors: from enhancer binding to developmental control.

Authors:  François Spitz; Eileen E M Furlong
Journal:  Nat Rev Genet       Date:  2012-08-07       Impact factor: 53.242

4.  TALEN-mediated precise genome modification by homologous recombination in zebrafish.

Authors:  Yao Zu; Xiangjun Tong; Zhanxiang Wang; Da Liu; Ruochuan Pan; Zhe Li; Yingying Hu; Zhou Luo; Peng Huang; Qian Wu; Zuoyan Zhu; Bo Zhang; Shuo Lin
Journal:  Nat Methods       Date:  2013-02-24       Impact factor: 28.547

5.  Generation of gene-modified mice via Cas9/RNA-mediated gene targeting.

Authors:  Bin Shen; Jun Zhang; Hongya Wu; Jianying Wang; Ke Ma; Zheng Li; Xueguang Zhang; Pumin Zhang; Xingxu Huang
Journal:  Cell Res       Date:  2013-04-02       Impact factor: 25.617

6.  Multiple genome modifications by the CRISPR/Cas9 system in zebrafish.

Authors:  Satoshi Ota; Yu Hisano; Yoshiya Ikawa; Atsuo Kawahara
Journal:  Genes Cells       Date:  2014-05-22       Impact factor: 1.891

7.  CRISPR/Cas9 and TALEN-mediated knock-in approaches in zebrafish.

Authors:  Thomas O Auer; Filippo Del Bene
Journal:  Methods       Date:  2014-04-01       Impact factor: 3.608

8.  Efficient homologous recombination-mediated genome engineering in zebrafish using TALE nucleases.

Authors:  Jimann Shin; Jiakun Chen; Lilianna Solnica-Krezel
Journal:  Development       Date:  2014-09-05       Impact factor: 6.868

9.  Efficient genome editing in zebrafish using a CRISPR-Cas system.

Authors:  Woong Y Hwang; Yanfang Fu; Deepak Reyon; Morgan L Maeder; Shengdar Q Tsai; Jeffry D Sander; Randall T Peterson; J-R Joanna Yeh; J Keith Joung
Journal:  Nat Biotechnol       Date:  2013-01-29       Impact factor: 54.908

10.  Optimization of genome engineering approaches with the CRISPR/Cas9 system.

Authors:  Kai Li; Gang Wang; Troels Andersen; Pingzhu Zhou; William T Pu
Journal:  PLoS One       Date:  2014-08-28       Impact factor: 3.240

View more
  19 in total

Review 1.  What rheumatologists need to know about CRISPR/Cas9.

Authors:  Gary J Gibson; Maozhou Yang
Journal:  Nat Rev Rheumatol       Date:  2017-02-09       Impact factor: 20.543

2.  Highly efficient CRISPR-targeting of the murine Hipp11 intergenic region supports inducible human transgene expression.

Authors:  Jill Browning; Michael Rooney; Emily Hams; Satoru Takahashi; Seiya Mizuno; Fumihiro Sugiyama; Padraic G Fallon; Vincent P Kelly
Journal:  Mol Biol Rep       Date:  2019-12-06       Impact factor: 2.316

Review 3.  Application of CRISPR/Cas9 System in Establishing Large Animal Models.

Authors:  Yingqi Lin; Jun Li; Caijuan Li; Zhuchi Tu; Shihua Li; Xiao-Jiang Li; Sen Yan
Journal:  Front Cell Dev Biol       Date:  2022-05-17

4.  CRISPR/Cas9 microinjection in oocytes disables pancreas development in sheep.

Authors:  Marcela Vilarino; Sheikh Tamir Rashid; Fabian Patrik Suchy; Bret Roberts McNabb; Talitha van der Meulen; Eli J Fine; Syed Daniyal Ahsan; Nurlybek Mursaliyev; Vittorio Sebastiano; Santiago Sain Diab; Mark O Huising; Hiromitsu Nakauchi; Pablo J Ross
Journal:  Sci Rep       Date:  2017-12-12       Impact factor: 4.379

5.  Optimization of a CRISPR/Cas9-mediated Knock-in Strategy at the Porcine Rosa26 Locus in Porcine Foetal Fibroblasts.

Authors:  Zicong Xie; Daxin Pang; Kankan Wang; Mengjing Li; Nannan Guo; Hongming Yuan; Jianing Li; Xiaodong Zou; Huping Jiao; Hongsheng Ouyang; Zhanjun Li; Xiaochun Tang
Journal:  Sci Rep       Date:  2017-06-08       Impact factor: 4.379

6.  Fumarylacetoacetate Hydrolase Knock-out Rabbit Model for Hereditary Tyrosinemia Type 1.

Authors:  Li Li; Quanjun Zhang; Huaqiang Yang; Qingjian Zou; Chengdan Lai; Fei Jiang; Ping Zhao; Zhiwei Luo; Jiayin Yang; Qian Chen; Yan Wang; Philip N Newsome; Jon Frampton; Patrick H Maxwell; Wenjuan Li; Shuhan Chen; Dongye Wang; Tak-Shing Siu; Sidney Tam; Hung-Fat Tse; Baoming Qin; Xichen Bao; Miguel A Esteban; Liangxue Lai
Journal:  J Biol Chem       Date:  2017-01-04       Impact factor: 5.157

7.  Site-Specific Fat-1 Knock-In Enables Significant Decrease of n-6PUFAs/n-3PUFAs Ratio in Pigs.

Authors:  Mengjing Li; Hongsheng Ouyang; Hongming Yuan; Jianing Li; Zicong Xie; Kankan Wang; Tingting Yu; Minghao Liu; Xue Chen; Xiaochun Tang; Huping Jiao; Daxin Pang
Journal:  G3 (Bethesda)       Date:  2018-05-04       Impact factor: 3.154

8.  Low incidence of SNVs and indels in trio genomes of Cas9-mediated multiplex edited sheep.

Authors:  Xiaolong Wang; Jing Liu; Yiyuan Niu; Yan Li; Shiwei Zhou; Chao Li; Baohua Ma; Qifang Kou; Bjoern Petersen; Tad Sonstegard; Xingxu Huang; Yu Jiang; Yulin Chen
Journal:  BMC Genomics       Date:  2018-05-25       Impact factor: 3.969

Review 9.  Genetically engineered pigs as models for human disease.

Authors:  Carolin Perleberg; Alexander Kind; Angelika Schnieke
Journal:  Dis Model Mech       Date:  2018-01-22       Impact factor: 5.758

10.  Screen and Verification for Transgene Integration Sites in Pigs.

Authors:  Linyuan Ma; Yuzhe Wang; Haitao Wang; Yiqing Hu; Jingyao Chen; Tan Tan; Man Hu; Xiaojuan Liu; Ran Zhang; Yiming Xing; Yiqiang Zhao; Xiaoxiang Hu; Ning Li
Journal:  Sci Rep       Date:  2018-05-09       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.