Literature DB >> 27027771

Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design.

Nils Pilotte1,2, Marina Papaiakovou1, Jessica R Grant1, Lou Ann Bierwert1, Stacey Llewellyn3, James S McCarthy3, Steven A Williams1,2.   

Abstract

BACKGROUND: The soil transmitted helminths are a group of parasitic worms responsible for extensive morbidity in many of the world's most economically depressed locations. With growing emphasis on disease mapping and eradication, the availability of accurate and cost-effective diagnostic measures is of paramount importance to global control and elimination efforts. While real-time PCR-based molecular detection assays have shown great promise, to date, these assays have utilized sub-optimal targets. By performing next-generation sequencing-based repeat analyses, we have identified high copy-number, non-coding DNA sequences from a series of soil transmitted pathogens. We have used these repetitive DNA elements as targets in the development of novel, multi-parallel, PCR-based diagnostic assays. METHODOLOGY/PRINCIPAL
FINDINGS: Utilizing next-generation sequencing and the Galaxy-based RepeatExplorer web server, we performed repeat DNA analysis on five species of soil transmitted helminths (Necator americanus, Ancylostoma duodenale, Trichuris trichiura, Ascaris lumbricoides, and Strongyloides stercoralis). Employing high copy-number, non-coding repeat DNA sequences as targets, novel real-time PCR assays were designed, and assays were tested against established molecular detection methods. Each assay provided consistent detection of genomic DNA at quantities of 2 fg or less, demonstrated species-specificity, and showed an improved limit of detection over the existing, proven PCR-based assay.
CONCLUSIONS/SIGNIFICANCE: The utilization of next-generation sequencing-based repeat DNA analysis methodologies for the identification of molecular diagnostic targets has the ability to improve assay species-specificity and limits of detection. By exploiting such high copy-number repeat sequences, the assays described here will facilitate soil transmitted helminth diagnostic efforts. We recommend similar analyses when designing PCR-based diagnostic tests for the detection of other eukaryotic pathogens.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27027771      PMCID: PMC4814118          DOI: 10.1371/journal.pntd.0004578

Source DB:  PubMed          Journal:  PLoS Negl Trop Dis        ISSN: 1935-2727


Introduction

Estimated to infect more than one quarter of the world’s total population, the soil transmitted helminths (STH) are responsible for profound morbidity and nutritional insufficiency [1]. Concentrated in the world’s most impoverished locations, the results of widespread infection on economic capacity are equally burdensome. Yet despite the scope of such disease, and continuing efforts to improve treatment programs and integration strategies, reliable and accurate diagnosis of STH infections remains difficult, and resulting prevalence estimates remain imprecise [1-2]. In recent years, the interest in molecular diagnostic methods for the detection of gastrointestinal helminths has grown substantially. Largely, this escalation in interest has occurred in parallel with the belief that standard microscopy-based methodologies for the examination of stool samples are sub-optimal, leading to underrepresentation of infection [3-5]. Further complicating matters, rates of STH egg/larval excretion have been shown to vary considerably within sequentially collected stool samples originating from a single infected individual [6-7]. This variability in egg/larval count can result in false negative samples, particularly when non-amplification-based diagnostic methodologies are utilized [7]. Such underrepresentation of disease complicates programmatic efforts, making the accurate assessment of the effects of intervention difficult, and frequently leaving low-level infections undiagnosed [5, 8–9]. Additionally, microscopy-based diagnostic methods have been linked with pathogen misidentification due to the morphological similarities that exist between species [5, 10]. Because of such concerns, a number of conventional and real-time PCR-based assays have been developed with the objective of improving both species-specificity and limits of detection [4, 11–17]. These assays have proven valuable, and as global efforts to estimate the burden of disease caused by the soil transmitted helminths (STHs) continue to increase, the number of studies incorporating such assays has risen in response [3, 5, 9, 18–21]. To date, the target sequences for such assays have been ribosomal internal transcribed spacer (ITS) sequences, 18S or ribosomal subunit sequences, or mitochondrial genes such as cytochrome oxidase I (COI) [4, 11–14]. Ribosomal sequences have been selected as diagnostic targets because they are typically found as easily identified moderate copy number tandem repeats in nucleated organisms [22-25]. Similarly, multiple copies of mitochondrial targets are found in the vast majority of eukaryotic cells [26], making them attractive target choices. However, while effective, such diagnostic targets are often sub-optimal. This is particularly true in the case of nematodes and other multi-cellular organisms where species-specific, highly repetitive DNA elements frequently make up a substantial portion of the genome, and are often present at copy-numbers exceeding 1,000 per haploid genome [27-29]. Due to such overrepresentation, non-coding repetitive sequence elements have become the targets of choice for many PCR-based diagnostic assays for the detection of various helminth species [30-31]. However, the identification of such repeats has historically been complicated and labor intensive. This identification has relied on techniques such as restriction endonuclease digestion of genomic DNA, followed by gel electrophoresis and Sanger DNA sequencing or polyacrylamide slab gel sequencing [32-34]. However, the advent of next-generation sequencing (NGS) technologies and associated informatics tools has expedited the search for highly repetitive sequence elements [35-39], and greater confidence can be placed in the accuracy of the results of such searches. Furthermore, as ribosomal and mitochondrial sequences tend to demonstrate high degrees of conservation between species, species-specificity of detection is also improved through the targeting of unique, highly-divergent, non-coding repeat DNA elements. Here we describe the development of a multi-parallel real-time PCR assay for the detection of five species of soil transmitted helminths (Necator americanus, pan class="Species">Ancylostoma duodenale, Trichuris trichiura, Strongyloides stercoralis, and Ascaris lumbricoides). Using NGS-generated sequence data and the Galaxy-based RepeatExplorer computational pipeline [38-39], we have searched the genomes of each organism for highly repetitive, non-coding DNA elements in order to identify diagnostic targets capable of providing optimal limits of detection and species-specificity of detection. Using these targets to design small-volume, multi-parallel tests [4], we have created a platform that provides cost-minimizing implementation of only those assays appropriate for a specific geographic region based upon the infections present. While performing multiplex assays may provide labor and time savings in locations where many parasites are co-endemic, such assays result in considerable waste when used in areas harboring only one or a few of the target species. In such settings, the “pick-and-choose” nature of multi-parallel assays minimizes reagent waste, and by improving upon limits of detection, the species-specific platform we describe here should facilitate improved STH monitoring and mapping efforts. Since NGS-based repeat analyses allow for the selection of the most efficacious target sequences, this approach to assay design should be applied to the development of additional diagnostics tests for other eukaryotic pathogens.

Materials and Methods

Isolation of parasite genomic DNA

For isolation of genomic DNA from N. americanus, A. duodenale, and T. trichiura, extractions were performed on cryopreserved adult worms in accordance with the “SWDNA1” protocol available on the Filarial Research Reagent Resource Center website (http://www.filariasiscenter.org/parasite-resources/Protocols/materials-1/). For N. americanus and A. duodenale, DNA extractions were conducted using a pool of approximately 10 adult worms. Both hookworm species belonged to strains originating in China. In the case of T. trichiura, extraction was performed using a single adult female worm of Ugandan origin. For S. stercoralis and A. lumbricoides, previously extracted genomic DNA was received from collaborators. S. stercoralis DNA was obtained from laboratory-reared worms originating from Pennsylvania, USA, and A. lumbricoides DNA was isolated from worms obtained from Ecuador.

Next-generation sequencing of genomic DNA

Library preparation

50 ng of genomic DNA, at a concentration of 2.5 ng/μl, was utilized for the NGS library preparation of all organisms except S. stercoralis. For S. stercoralis, sequencing was not performed, as publically available sequence reads were used for the bioinformatics analyses (Sequence Read Archive ID: ERX044031). For all remaining parasites, libraries were prepared using the Nextera DNA Sample Preparation Kit (Illumina, San Diego, CA), the Nextera DNA Sample Preparation Index Kit (Illumina), and the ZR-96 DNA Clean & Concentrator-5 Kit (Zymo Research Corporation, Irvine, CA) in accordance with the manufacturer’s protocols and previous description [40]. Following library preparation, the concentration of each library was determined using the Qubit 1.0 Fluorometer (Life Technologies, Carlsbad, CA) and the Qubit dsDNA Broad Range Assay Kit (Life Technologies). Additionally, the size distribution of each library was analyzed using the Agilent 2100 Bioanalyzer System (Agilent Technologies, Santa Clara, CA) and the Agilent High Sensitivity DNA Kit (Agilent Technologies).

Next-generation sequencing

Based upon the DNA concentrations and size distributions for each prepared library, aliquots containing approximately 12 pmol of library were created for all parasites. Library aliquots were then sequenced individually on the MiSeq platform (Illumina) using the MiSeq Reagent Kit v3 (150 cycles) (Illumina) and the single-ended read approach.

Repeat analysis

For each parasite analyzed, raw sequencing reads were uploaded to the Galaxy-based RepeatExplorer web server [39]. Reads were processed according to the workflow in Fig 1, enabling the identification of high copy-number repeat DNA sequences for each organism. Promising repeat families were further analyzed using the Nucleotide BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) available from the National Center for Biotechnology Information (NCBI). Results from each organism were screened for repetitive DNA elements found to have high degrees of homology with elements of the human genome, common bacteria of the pan class="Species">human microbiome, or other parasitic organisms likely to be found within the human gut. Had such sequences been identified as among the most repetitive, they would have been eliminated from further consideration as they would be expected to cause species-specificity challenges during downstream PCR assay development. However, no such conserved highly repetitive elements were identified. Following screening, sequences from each organism, putatively determined to be among the most highly repetitive, were utilized for further assay development (Fig 2).
Fig 1

Workflow for repeat analysis.

Output data from a next-generation sequencing run are uploaded to the RepeatExplorer Galaxy-based platform. During the QC and manipulation phase, the FASTQ Groomer tool is used to convert sequence reads into Sanger format. The FASTQ: READ QC tool is then used to verify the quality of the reads before removing unnecessary sequence (i.e. adapter sequences, etc.) from the ends of each read using the FASTQ Trimmer tool. The QC analysis is then repeated, and the FASTQ to FASTA converter tool is used to convert each read into FASTA format. Using these DNA sequence reads as input, sequences undergo clustering, during which an “all-to-all” sequence comparison is performed, and similar sequences are grouped together into clusters. Clusters containing the most highly repetitive sequences are then selected as putative diagnostic targets to be used for primer and probe-based real-time PCR assay design.

Fig 2

Illustrative output from RepeatExplorer analysis of Necator americanus.

During “clustering” each nucleotide within a cluster is assigned a number. That number corresponds to how many individual next-generation sequencing reads that particular nucleotide appeared in. Using this output, a stretch of the most abundant nucleotides (depicted in green within the larger cluster’s sequence) is selected, and the corresponding nucleotides (highlighted in yellow) are selected as the candidate sequence from which the primers and probe are designed.

Workflow for repeat analysis.

Output data from a next-generation sequencing run are uploaded to the RepeatExplorer Galaxy-based platform. During the QC and manipulation phase, the FASTQ Groomer tool is used to convert sequence reads into Sanger format. The FASTQ: READ QC tool is then used to verify the quality of the reads before removing unnecessary sequence (i.e. adapter sequences, etc.) from the ends of each read using the FASTQ Trimmer tool. The QC analysis is then repeated, and the FASTQ to FASTA converter tool is used to convert each read into FASTA format. Using these DNA sequence reads as input, sequences undergo clustering, during which an “all-to-all” sequence comparison is performed, and similar sequences are grouped together into clusters. Clusters containing the most highly repetitive sequences are then selected as putative diagnostic targets to be used for primer and probe-based real-time PCR assay design.

Illustrative output from RepeatExplorer analysis of Necator americanus.

During “clustering” each nucleotide within a cluster is assigned a number. That number corresponds to how many individual next-generation sequencing reads that particular nucleotide appeared in. Using this output, a stretch of the most abundant nucleotides (depicted in green within the larger cluster’s sequence) is selected, and the corresponding nucleotides (highlighted in yellow) are selected as the candidate sequence from which the primers and probe are designed.

Primer and probe design

Candidate primer and probe pairings for each organism, excluding A. lumbricoides, were designed using the PrimerQuest online tool (Integrated DNA Technologies, Coralville, IA), utilizing the default parameters for probe-based qPCR. The putative species-specificity of each primer pair was further examined using Primer-BLAST software (http://blast.ncbi.nlm.nih.gov/Blast.cgi). In the case of pan class="Species">S. stercoralis the highest copy-number repeat (as determined by RepeatExplorer) was not selected as a target sequence, due to design difficulties associated with the extreme A-T richness of the repeat (A-T % = 80.25). As a result, a second repeat analysis was performed, selecting only for sequence reads with > 30% G-C content, and a second candidate sequence was selected based on these results. In the case of A. lumbricoides, RepeatExplorer analyses of two different sequencing runs performed from two distinct libraries both resulted in the identification of ribosomal and mitochondrial sequences as the most highly repetitive. For this reason, sequences from an existing, proven, primer and probe set targeting the ITS1 region were selected for further analysis [14, 16]. With the exception of the previously published A. lumbricoides probe, all probes were labeled with a 6FAM fluorophore at the 5’ end, and were double quenched using the internal quencher ZEN and 3IABkFQ (IOWA BLACK) at the 3’ end (Integrated DNA Technologies). This fluorophore-quencher combination was chosen as comparative testing of each probe revealed improved Ct values and greater ΔRn values using this chemistry when compared to typical TAMRA quenching (Fig 3). Primer and probe sets for each organism can be found in Table 1.
Fig 3

Comparative probe testing.

For each novel probe design, FAM-TAMRA and double quenched FAM-ZEN-IOWA BLACK probes were synthesized. Comparative testing revealed that double quenched probes outperformed traditional probes, as evidenced by lower Ct values and greater ΔRn values. The plot above demonstrates these findings with the amplification of three concentrations of N. americanus template DNA using both double quenched (yellow) and traditional (blue) probe designs.

Table 1

Selected primer and probe sequences for each multi-parallel assay.

ParasiteForward PrimerReverse PrimerProbe
Necator americanus5’- CCAGAATCGCCACAAATTGTAT -3’5’- GGGTTTGAGGCTTATCATAAAGAA -3’5'- /56-FAM/CCCGATTT G/ZEN/AGCTGAATTGTCA AA/3IABkFQ/ -3'
Ancylostoma duodenale5’- GTATTTCACTCATATGATCGAGTGTTC -3’5’- GTTTGAATTTGAGGTATTTCGACCA -3’5'- /56-FAM/TGACAGTG T/ZEN/GTCATACTGTGGA AA/3IABkFQ/ -3'
Trichuris trichiura5’- GGCGTAGAGGAGCGATTT -3’5’- TACTACCCATCACACATTAGCC -3’5'- /56-FAM/TTTGCGGGC/ZEN/G AGAACGGAAATA TT/3IABkFQ/ -3'
Strongyloides stercoralis5’- CGCTCCAGAATTAGTTCCAGTT -3’5’- GCAGCTTAGTCGAAAGCATAGA -3’5'- /56-FAM/ACAGTCTC C/ZEN/AGTTCACTCCAGA AGAGT/3IABkFQ/ -3'
Ascaris lumbricoides5’- GTAATAGCAGTCGGCGGTTTCTT -3’5’- GCCCAACATGCCACCTATTC -3’5’- /56-FAM/ TTGGCGGACAATTGCATGCGAT/MBG/ -3’

Comparative probe testing.

For each novel probe design, FAM-TAMRA and double quenched FAM-ZEN-IOWA BLACK probes were synthesized. Comparative testing revealed that double quenched probes outperformed traditional probes, as evidenced by lower Ct values and greater ΔRn values. The plot above demonstrates these findings with the amplification of three concentrations of N. americanus template DNA using both double quenched (yellow) and traditional (blue) probe designs.

Primer and probe validation

Primer optimization reactions

In order to determine the optimal primer concentrations for each assay, a concentration matrix was created. For all primers, testing at 62.5 nM, 125 nM, 250 nM, 500 nM and 1000 nM was performed, and all forward primer concentrations were tested in combination with all reverse primer concentrations. Optimization assays were conducted in 7 μl volumes, containing 3.5 μl of 2X TaqMan Fast Universal PCR Master Mix (Life Technologies), 125 nmol of each assay’s respective probe, and 2 μl of template DNA at a concentration of 1 ng/μl. Cycling conditions consisted of an initial 2 min incubation step at 50°C, followed by a 10 min incubation at 95°C. These incubations were followed by 40 cycles of 95°C for 15 sec for denaturation, followed by 1 min at 59°C for annealing and extension. All reactions were conducted using the StepOne Plus Real-Time PCR System (Life Technologies).

Determination of assay detection limits

In order to determine the limits of detection for each assay, genomic template DNA stocks were titrated for each parasite. DNA stock concentrations of 1 ng/μl, 100 pg/μl, 10 pg/μl, 1 pg/μl, 100 fg/μl, 10 fg/μl, 1 fg/μl, 100 ag/μl, 10 ag/μl and 1 ag/μl were tested with each assay using the optimized primer concentrations and assays were again conducted in 7 μl total volumes. Reagent concentrations and cycling conditions were identical to those used for primer optimization reactions.

Assay species-specificity testing

In order to ensure the species-specificity of each assay, the primer-probe set for each parasite was tested using template DNA from each of the other STH species. Furthermore, each primer-probe combination was tested against human genomic DNA and the DNA of the common gastrointestinal tract commensal Escherichia coli (K-12 strain). All template stocks were at a concentration of 1 ng/μl, and all assays were performed using the same reagent volumes and concentrations as used for the primer optimization reactions and for the determination of assay detection limits.

Comparative testing of field-collected samples

Collection of samples

For comparative assay testing, a panel of 79 samples was employed. All samples had been previously collected as part of the “Wash for Worms” interventional trial in Timor-Leste (Trial registration: ACTRN12614000680662). The specific procedures used during the collection and storage of these samples have been previously described [41].

DNA extraction

All DNA extractions were performed at QIMR Berghofer using the PowerSoil DNA isolation Kit (Mo Bio, Carlsbad, CA, USA) in accordance with the previously described, modified version of the manufacturer’s protocol [42]. Following extraction, an aliquot of each sample was retained at QIMR Berghofer and another was shipped to Smith College (Northampton, MA, USA).

Real-time PCR testing

DNA extracts from all samples were assayed at both QIMR Berghofer and Smith College. Testing at QIMR Berghofer was conducted using previously described real-time PCR primer/probe sets [4, 13–15], optimized for use in pentaplex assays [42] to test for the presence of N. americanus, pan class="Species">T. trichiura, Ascaris ssp., Ancylostoma ssp., and S. stercoralis. For ease of reporting, hereafter, these assays will be referred to as the “QIMR assays”. Testing which occurred at Smith College made use of the optimized, previously undescribed multi-parallel assays for the detection of N. americanus, T. trichiura, A. lumbricoides, A. duodenale, and S. stercoralis introduced in this manuscript (hereafter referred to as the “Smith assays”). All sample aliquots tested at Smith College were coded blind by QIMR and assay results were not shared between institutions until all testing had been completed.

Statistical analysis

Positive, negative and overall agreements were calculated to assess concordance between the QIMR and Smith assays using the equations found in “Statistical Guidance on Reporting Results from Studies Evaluating Diagnostic Tests” [43]. Kappa statistics, which account for the possibility that concordance may occur by chance, were calculated for each taxon using R version 3.1.3 and the R package irr [44-45].

Trichuris speciation of Smith-negative, QIMR-positive samples

Samples testing positive for Trichuris ssp. using the QIMR assay, but negative for Trichuris trichiura using the Smith assay were further analyzed to determine the identity of the infecting species. Using a previously described primer-probe set targeting the coding sequence for the 18S ribosomal subunit [46], these samples were PCR amplified in 25 μl reactions using the Phusion Hot Start Flex DNA Polymerase Kit (New England Biolabs, Ipswich, MA). PCR reaction conditions were as follows: 16.5 μl PCR-grade water, 400 nM forward primer, 400 nM reverse primer, 0.5 μl dNTPs, 0.75 μl DMSO, 5.0 μl Phusion HF buffer, 0.25 μl Phusion Polymerase, and 1 μl template DNA. Cycling conditions consisted of an initial denaturing step at 98°C for 15 min, followed by 35 cycles of 98°C for 10 sec, 56°C for 15 sec, and 72°C for 15 sec. Following 35 cycles, a final extension step of 72°C for 7 min was performed. PCR products were then sequenced using standard Sanger methodology and resulting sequence data were analyzed using NCBI’s Nucleotide BLAST tool.

Differentiation of A. duodenale and A. ceylanicum infections

Samples testing positive for Ancylostoma ssp. using the QIMR assay, but negative for A. duodenale using the Smith assay, underwent further testing to discriminate between infection with A. duodenale and A. ceylanicum. For differential detection, a semi-nested PCR-Restriction Fragment Length Polymorphism (RFLP) assay was employed, and samples were tested in accordance with the published protocol [47]. Digestion of Ancylostoma ssp. PCR product using the MvaI enzyme (Life Technologies) was indicative of the presence of A. ceylanicum, while digestion with Psp1406I (Life Technologies) was indicative of A. duodenale.

Results

Primer optimization

The use of a primer matrix resulted in the determination of optimal concentrations for each assay. Optimal conditions were determined to be those at which Ct values were lowest when testing 2 μl of the appropriate template stock at a concentration of 1 ng/μl. For N. americanus, A. duodenale, and S. stercoralis, the optimal concentrations were determined to be 250 nM for both forward and reverse primers. For A. lumbricoides the optimal concentrations were determined to be 62.5 nM for both forward and reverse primers, and for T. trichiura, the optimal concentrations were determined to be 62.5 nM for the forward primer and 250 nM for the reverse primer.

Assay sensitivities

In order to demonstrate the detection limits of each multi-parallel PCR assay, genomic DNA stocks for each parasite were serially diluted, and optimal primer concentrations for each assay were used to test 2 μl of the appropriate template at concentrations of 1 ng/μl, 100 pg/μl, 10 pg/μl, 1 pg/μl, 100 fg/μl, 10 fg/μl, 1 fg/μl, 100 ag/μl, 10 ag/μl, and 1 ag/μl. For all species, consistent detection of parasite DNA was possible at all concentrations at or above 1 fg/μl. For the detection of A. duodenale, consistent detection occurred at all concentrations at or above 10 ag/μl, and for the detection of N. americanus, sporadic detection proved possible at the 100 ag/μl and 10 ag/μl concentrations.

Assay specificities

To verify that the primer-probe combinations for the detection of each parasite were species-specific, each optimized assay was tested against genomic template DNA from each of the other parasite species included within this multi-parallel platform. They were also tested against human genomic DNA and E. coli genomic DNA. In no instance did species-specificity testing result in the amplification of any non-target DNA template, indicating that each assay demonstrated excellent species specificity.

Comparative testing of field collected samples

A panel of 79 blindly-coded patient samples, obtained in Timor-Leste as part of a previously described study [42], was tested using the newly described multi-parallel Smith assays, as well as the previously described, multiplex real-time PCR detection methodology (QIMR assay) (Table 2, S1 Table). As samples were patient-obtained and no true “gold standard” exists for the detection of the various STH infections examined here, it is difficult to definitively determine whether increased sample positivity is a result of improved assay detection limits or non-specific, off-target amplification. For this reason, the comparative performances of each assay were assessed through calculations of positive, negative, and overall agreement [43]. For the detection of N. americanus, a positive agreement (PA) of 100% and a negative agreement (NA) of 61% were calculated. This resulted in an overall agreement (PO) of 85% (Kappa 0.658). Use of the Smith assay resulted in the detection of 60 positive samples, while the QIMR assay resulted in the detection of 48 positives. All 48 QIMR-positive samples were among the 60 positive samples detected using the Smith methodology.
Table 2

Comparative assay results for each species of parasite.

Necator americanusSmith-positiveSmith-negative
QIMR-positive480
QIMR-negative1219
Ascaris lumbricoidesSmith-positiveSmith-negative
QIMR-positive400
QIMR-negative732
Trichuris trichiuraSmith-positiveSmith-negative
QIMR-positive104*
QIMR-negative857
Strongyloides stercoralisSmith-positiveSmith-negative
QIMR-positive10
QIMR-negative078
Ancylostoma duodenaleSmith-positiveSmith-negative
QIMR-positive022 **
QIMR-negative057

* Two of these four samples contained T. ovis. The identity of the pathogen in the remaining 2 samples could not be determined due to a lack of material.

** 21 of these 22 samples contained A. ceylanicum. The identity of the pathogen in the 22nd sample could not be determined due to a lack of material.

* Two of these four samples contained T. ovis. The identity of the pathogen in the remaining 2 samples could not be determined due to a lack of material. ** 21 of these 22 samples contained A. ceylanicum. The identity of the pathogen in the 22nd sample could not be determined due to a lack of material. For the detection of A. lumbricoides, a PA of 100%, an NA of 82%, and a PO of 91% (Kappa 0.822) were seen. The Smith assay for A. lumbricoides detection resulted in the identification of 47 positive samples, while the corresponding QIMR assay resulted in 40 positives. Again, all 40 QIMR-positive samples were among the 47 Smith-positive samples which were identified. Detection of Trichuris gave a PA of 71%, an NA of 88% and a PO of 85% (Kappa 0.580). Sample examination using the Smith assay identified 18 positive extracts, while examination with the QIMR assay identified 14 positives. However, only 10 positives were common to both assays, with 8 samples identified as positive only by the Smith assay, and 4 samples demonstrating the presence of parasite DNA using only the QIMR methodology. Amplification in control reactions demonstrated that the QIMR assay, but not the Smith assay, would provide for the detection of the closely related parasite Trichuris vulpis, a whipworm species common to canines, but also known to cause zoonotic infection [48-49]. As Trichuris ssp. including T. vulpis, Trichuris suis, and Trichuris ovis have a wide geographic distribution with increased prevalence in tropical and sub-tropical locations [50-51], the four QIMR-positive, Smith-negative samples were sequenced to determine the identity of the Trichuris species present within these samples. BLAST analysis indicated that two of the samples contained DNA from the ruminant parasite T. ovis (E values = 0.0). Unfortunately, two independent trials failed to produce usable sequence for the remaining two samples, after which both sample stocks had been exhausted, making further examination impossible. Examination of all 79 samples for the presence of S. stercoralis resulted in the detection of only a single positive sample. This single sample was identified using both the Smith and QIMR assays. Sample examination for the presence of Ancylostoma resulted in the identification of 22 Ancylostoma ssp. positive samples using the QIMR methodology. However, not a single A. duodenale-positive sample was identified using the Smith assay. As the zoonotic parasite Ancylostoma ceylanicum has been suspected of causing human infection in Timor-Leste [52], a previously described, semi-nested PCR-RFLP assay was employed to discriminate infection with A. duodenale from infection with A. ceylanicum [47]. In this assay, an MvaI restriction digest of PCR product is indicative of the presence of A. ceylanicum, while digestion with Psp1406I is indicative of A. duodenale. 21 of the 22 Ancylostoma ssp. positive samples were digested by MvaI, identifying the infections as A. ceylanicum in origin. Two independent PCR trials (four replicates) failed to amplify the remaining Ancylostoma ssp.-positive sample, preventing a definitive determination of the identity of the parasite in that sample. Because a sizeable panel of field-collected samples was analyzed using the two different real-time PCR methodologies discussed here, a comparison of Ct values was conducted for all samples testing positive for a given parasite by both the Smith and QIMR methods (S1 Table). All 10 samples demonstrating positive results for T. trichiura when tested by both assays showed lower Ct values using the Smith methodology (mean difference in Ct value = 7.86 +/- 2.46). Examination for pan class="Species">N. americanus resulted in a similar pattern, with all 48 samples testing positive by both methodologies possessing lower Ct values when tested using the Smith assay (mean difference in Ct value = 4.94 +/- 1.22). In the case of A. lumbricoides, Ct values were lower using the QIMR methodology for 38 of 40 samples demonstrating positive results for both assays. However, at 0.896 +/- 0.767, the mean difference in Ct values was low. For S. stercoralis testing, only a single positive sample was identified. This sample possessed a lower Ct value when tested using the Smith assay. As no samples tested positive for Ancylostoma using the Smith assay (QIMR-positive samples were demonstrated to be A. ceylanicum), a Ct comparison could not be made.

Discussion

In light of their impact on global health, the importance of optimal and species-specific diagnostic methods for the detection of soil transmitted helminths cannot be overestimated. While current molecular assays making use of ribosomal and mitochondrial targets have vastly improved the diagnosis of STH infection, these targets are frequently sub-optimal, potentially leaving low-level pan class="Disease">infections undiagnosed. Furthermore, such sequences may lack the species-specificity required to discriminate between different species of the same genus. In contrast, assays targeting high copy-number repetitive sequences improve upon assay detection limits, as many eukaryotic pathogens contain large numbers of such non-coding repeat DNA elements. Accordingly, by coupling the high throughput nature of NGS with the Galaxy-based RepeatExplorer computational pipeline, a cost effective, accurate, and expedited methodology for the identification of high copy-number repeat DNA elements was developed. Through the design of real-time PCR primer/probe pairings that uniquely target such repetitive sequences in a species-specific manner, diagnostic accuracy and limits of detection are improved dramatically when compared with microscopy-based diagnostic techniques and PCR-based diagnostics targeting mitochondrial or ribosomal sequences. Utilizing this strategy, we have successfully identified novel target sequences for the detection of N. americanus, A. duodenale, T. trichiura, and S. stercoralis. Furthermore, we have demonstrated the consistent detection of genomic DNA from each target organism at quantities of 2 fg or less, and have presented evidence to suggest improved limits of detection and species-specificity relative to an established and validated PCR diagnostic methodology [Llewellyn, 2016]. Although further testing utilizing “spiked” samples containing known quantities of eggs/larvae is currently underway, 2 fg of DNA is far less than the quantity present within a single fertilized egg or L1 larvae of each species [53-55] (Table 3). In principle, we have therefore demonstrated the potential of these assays to detect a single egg within a tested patient stool sample.
Table 3

Estimated Minimum Quantities of DNA in the Eggs of Each Species of STH.

SpeciesHaploid Genome Size (Genbank Assembly Accession)Estimated Minimum Quantity of DNA/Diploid CellEstimated Number of Diploid Cells/Egg[55]Estimated Total Quantity of DNA/Egg
Necator americanus244 Mb[54] (GCA_000507365.1)0.54 pg4–82.16 pg– 4.32 pg
Ascaris lumbricoides317 Mb (GCA_000951055.1)0.70 pgAs few as 10.70 pg
Trichuris trichiura75 Mb (GCA_000613005.1)0.17 pg10.17 pg
Ancylostoma duodenale332 Mb (GCA_000816745.1)0.73 pg4–82.92 pg– 5.84 pg
Strongyloides stercoralis42–60 Mb[53] (GCA_000947215.1)0.09 pg– 0.13 pg2–8*0.18 pg– 1.04 pg*

* As S. stercoralis eggs typically hatch in the intestinal lumen, this parasite is released into the stool as rhabditiform larvae which possess an even greater number of cells. Therefore, a patient stool sample harboring a single larval worm will contain a much higher quantity of parasite DNA than the quantity listed here.

* As S. stercoralis eggs typically hatch in the intestinal lumen, this parasite is released into the stool as rhabditiform larvae which possess an even greater number of cells. Therefore, a patient stool sample harboring a single larval worm will contain a much higher quantity of parasite DNA than the quantity listed here. While the high copy-number nature of non-coding repetitive sequence elements makes them attractive diagnostic targets, such elements also frequently demonstrate rapid evolutionary divergence [56-57]. This divergence increases the diagnostic appeal of these sequences, as divergence reduces the risk for non-specific, off-target amplification, a characteristic essential for the development of species-specific PCR assays capable of discriminating between closely related organisms. Accordingly, while additional testing against genomic DNA from a growing panel of closely related parasites will continue to be used to evaluate the species-specificity of each selected primer/probe set, we have successfully demonstrated that each Smith assay does not amplify off-target templates from any other parasite species included within this multi-parallel platform. Furthermore, by employing a semi-nested PCR-RFLP tool, we were able to successfully demonstrate that our assay for the detection of A. duodenale does not amplify the closely related parasite pan class="Species">A. ceylanicum. In contrast, the previously published primer/probe set employed for comparative testing was unable to distinguish between these two species, resulting in consistent off-target amplification of A. ceylanicum DNA. Similarly, while our T. trichiura assay failed to amplify four samples containing genetic material from Trichuris ssp., the comparative QIMR assay again demonstrated non-specific, off-target amplification for at least two of these samples, as sequence analysis demonstrated the presence of DNA from the ruminant parasite T. ovis. Taken together, these findings support the notion that improved assay species-specificity results from non-coding, repeat-based PCR assay design. Of note, to our knowledge, this is the first example of T. ovis potentially serving as a causative agent of zoonotic infection. However, as sheep are considered a major agricultural commodity of Timor-Leste [58], the possibility exists that individuals testing positive for T. ovis may have ingested intestinal material from an animal harboring infection, making it conceivable that the T. ovis DNA present was not the result of zoonotic infection. Given that T. ovis is not known to cause human infection, further exploration of this possible zoonosis is warranted. Attempting to design a non-coding, repetitive DNA sequence-based assay for the species-specific detection of A. lumbricoides presented a unique set of challenges. A. lumbricoides, like many species of Ascaridae, discards large portions of its highly repetitive, non-coding genomic DNA during embryonic development. This process, known as chromosome diminution, eliminates the presence of such DNA elements from post-embryonic somatic cells [59-61]. Presumably for this reason, two separate repeat analyses, performed on two distinct library preparations, failed to identify any repetitive sequences with copy numbers greater than ribosomal and mitochondrial targets. Accordingly, a previously described primer/probe set targeting the ITS1 ribosomal region was chosen for inclusion in our multi-parallel platform [14, 16]. In order to improve diagnostics for this parasite, further analysis of A. lumbricoides using DNA extracted from eggs alone (before chromosome diminution) will be undertaken. In addition to the potential detection limit improvements and species-specificity gains realized when diagnostically targeting non-coding repetitive DNA sequences, designing multi-parallel assays provides another unique set of advantages over previous design strategies [4]. By reducing the number of tests required, multiplex assays can provide labor and reagent savings over alternative diagnostic measures when used in environments that harbor the full complement of organisms targeted by the assay [62-63]. However, as the geographic distribution of STH species is not uniform, the use of multi-parallel assays makes it possible to select only the assays appropriate for a given location, reducing primer/probe costs associated with testing for unnecessary targets [4]. By running these assays as “small-volume” 7 μl reactions, reagent use is minimized, resulting in cost savings. Furthermore, as multi-parallel reactions are run independently, this enables the development of new assays for new pathogens and their subsequent addition to the testing platform without the complex re-optimization of assay conditions required for multiplex PCR assays. While reagent costs associated with performing molecular diagnostic testing are higher than costs associated with conducting traditional microscopy-based diagnostics, expenses associated with molecular techniques are declining as improved reagents and enzymes have allowed reaction volumes to decrease, minimizing reagent needs [4, 64]. Furthermore, reagent improvements have increased the practicality of sample pooling, a practice already adopted by many tropical disease surveillance and diagnostic efforts [65-69]. Such pooling allows for cost-reducing high-throughput screening of stool samples [70-71]. Thus, while the total cost associated with performing a duplicate Kato-Katz thick smear under field conditions has been estimated at $2.06 [72] and we estimate the total cost associated with the duplicate testing a single stool sample using all five multi-parallel assays to be approximately $10, the pooling of as few as five samples would render small volume, multi-parallel PCR testing more cost effective than Kato-Katz testing. Furthermore, molecular diagnostic accuracy and reliability provide increased clarity of results [64], allowing for the implementation of more informed and effective treatment and control strategies. Such improvements in efficiency result in greater programmatic gains, drastically reducing long-term costs and expenses of control or elimination programs. One profound shortcoming which hampers STH diagnostic development is the lack of a reliable gold standard for detection [8]. While still used in many clinical, mapping, and research efforts, microscopy-based methodologies are known to lack both adequate limits of detection and species-specificity of detection [3–5, 10, 64]. Similarly, while currently available molecular methods have greatly improved upon many of the shortcomings inherent to microscopy, the use of sub-optimal ribosomal or mitochondrial targets possessing relatively high degrees of conservation can result in both false-negative, and off-target, false-positive results. Thus, a gold standard of detection is sorely needed. Unfortunately, without a definitive method for assigning positive/negative status to an unknown sample, distinguishing improved limits of detection from false-positive amplification can be difficult. Nonetheless, comparative assay testing remains an important aspect of designing any diagnostic test. As such, we believe the evaluation of Timor-Leste patient samples presented in this paper provides strong evidence for improved limits of detection when utilizing the newly described Smith assays. While strain-specific genetic differences arising within divergent geographic isolates could present detection challenges, testing on a limited number of pan class="Species">patient-derived samples from Argentina and Ethiopia aimed at providing evidence for the global applicability of these multi-parallel assays is currently underway. Additional studies to further validate these assays on a variety of geographic isolates will continue. In all instances, and for all parasites excluding Ancylostoma and Trichuris (where off-target amplification of A. ceylanicum and T. ovis by the QIMR assay was demonstrated), each Timor-Leste patient sample that provided a positive QIMR assay result also demonstrated positivity with the corresponding Smith assay. Furthermore, all N. americanus, T. trichiura, and S. stercoralis samples that were positive by both assays exhibited lower Ct values for the Smith assay results. These findings strongly suggest improved limits of detection for the Smith assays, and support our contention that samples returning Smith assay positive results, but QIMR assay negative results, are likely low-level positives escaping detection by the sub-optimal PCR platform. This conclusion is further supported by the finding that the Smith assays do not show off-target amplification of any other STH parasites, human DNA or E. coli DNA. As both the QIMR and Smith assays for the detection of A. lumbricoides make use of the same previously published primer/probe combination [14, 16], comparative assay testing for this parasite provided results which were more difficult to interpret. As increased reaction volumes are known to frequently improve detection limits for an assay, likely due to the large volume nature of the QIMR assay (25 μl vs. 7 μl for Smith), 38 of 40 samples returning positive results for both testing platforms demonstrated lower Ct values when examined using the QIMR method. Interestingly, despite this tendency for QIMR testing to result in lower Ct values, seven samples identified as positive using the Smith assay were found to be QIMR-negative. In contrast, not a single sample was found to be QIMR-positive and Smith-negative. As the QIMR assays are multiplexed, one explanation for this apparent contradiction is that the multiplex methodology failed to detect A. lumbricoides in a subset of samples that were positive for multiple STH parasites (S1 Table). Such failures are known to occur in multiplex reactions, particularly when primer concentrations are suboptimal, as reagents are utilized for the amplification of a more prevalent target, preventing the amplification of the lower copy-number target sequences within the sample [73]. Alternatively, while the results of our assay specificity testing present compelling evidence to the contrary, the possibility of false positive amplification cannot be definitively ruled out. Non-coding repetitive DNA elements are found in nearly all eukaryotic organisms. Such sequences are typically highly divergent, and frequently exist in high copy-number. These characteristics make them ideal molecular diagnostic targets, particularly for the detection of pathogens such as the STHs, which remain an underdiagnosed, poorly mapped global health concern. By applying next-generation sequencing technology to the challenge of repeat DNA discovery, we have designed highly specific multi-parallel PCR assays with improved limits of detection over existing diagnostic platforms. We believe that these assays will greatly aid in the global efforts to map STH infection, facilitating accurate disease prevalence estimates. Furthermore, we intend to apply this approach to molecular target discovery of other parasitic organisms and NTDs, as optimal limits of detection and species-specificity of detection are vital to all diagnostic efforts. This is particularly true when implementing diagnostics in climates of decreasing disease prevalence. Accordingly, as NTD elimination efforts continue to progress, optimized assays will play an increasingly critical role in the detection of sporadic and pan class="Disease">focal infections and the monitoring for disease recrudescence.

Comparative assay results for patient-obtained sample from Timor-Leste.

All samples were tested in duplicate utilizing both real-time PCR assays (QIMR and Smith) and results are provided as mean Ct values. (XLSX) Click here for additional data file.
  60 in total

1.  The occurrence, role and evolution of chromatin diminution in nematodes.

Authors:  C Goday; S Pimpinelli
Journal:  Parasitol Today       Date:  1993-09

2.  Multiplex real-time PCR monitoring of intestinal helminths in humans reveals widespread polyparasitism in Northern Samar, the Philippines.

Authors:  Catherine A Gordon; Donald P McManus; Luz P Acosta; Remigio M Olveda; Gail M Williams; Allen G Ross; Darren J Gray; Geoffrey N Gobert
Journal:  Int J Parasitol       Date:  2015-04-06       Impact factor: 3.981

3.  Rapid detection of Opisthorchis viverrini and Strongyloides stercoralis in human fecal samples using a duplex real-time PCR and melting curve analysis.

Authors:  Penchom Janwan; Pewpan M Intapan; Tongjit Thanchomnang; Viraphong Lulitanond; Witthaya Anamnart; Wanchai Maleewong
Journal:  Parasitol Res       Date:  2011-05-03       Impact factor: 2.289

4.  Rapid detection of Brugia malayi in mosquito vectors using a real-time fluorescence resonance energy transfer PCR and melting curve analysis.

Authors:  Tongjit Thanchomnang; Pewpan M Intapan; Viraphong Lulitanond; Wej Choochote; Anonglak Manjai; Thidarat K Prasongdee; Wanchai Maleewong
Journal:  Am J Trop Med Hyg       Date:  2008-03       Impact factor: 2.345

5.  Visceral larva migrans caused by Trichuris vulpis.

Authors:  T Sakano; K Hamamoto; Y Kobayashi; Y Sakata; M Tsuji; T Usui
Journal:  Arch Dis Child       Date:  1980-08       Impact factor: 3.791

6.  A novel, multi-parallel, real-time polymerase chain reaction approach for eight gastrointestinal parasites provides improved diagnostic capabilities to resource-limited at-risk populations.

Authors:  Rojelio Mejia; Yosselin Vicuña; Nely Broncano; Carlos Sandoval; Maritza Vaca; Martha Chico; Philip J Cooper; Thomas B Nutman
Journal:  Am J Trop Med Hyg       Date:  2013-03-18       Impact factor: 2.345

Review 7.  Chromatin diminution in nematode development.

Authors:  H Tobler; A Etter; F Müller
Journal:  Trends Genet       Date:  1992-12       Impact factor: 11.639

8.  A laboratory-developed TaqMan Array Card for simultaneous detection of 19 enteropathogens.

Authors:  Jie Liu; Jean Gratz; Caroline Amour; Gibson Kibiki; Stephen Becker; Lalitha Janaki; Jaco J Verweij; Mami Taniuchi; Shihab U Sobuz; Rashidul Haque; Doris M Haverstick; Eric R Houpt
Journal:  J Clin Microbiol       Date:  2012-11-21       Impact factor: 5.948

9.  A comprehensive assessment of lymphatic filariasis in Sri Lanka six years after cessation of mass drug administration.

Authors:  Ramakrishna U Rao; Kumara C Nagodavithana; Sandhya D Samarasekera; Asha D Wijegunawardana; Welmillage D Y Premakumara; Samudrika N Perera; Sunil Settinayake; J Phillip Miller; Gary J Weil
Journal:  PLoS Negl Trop Dis       Date:  2014-11-13

10.  Molecular xenomonitoring using mosquitoes to map lymphatic filariasis after mass drug administration in American Samoa.

Authors:  Mark A Schmaedick; Amanda L Koppel; Nils Pilotte; Melissa Torres; Steven A Williams; Stephen L Dobson; Patrick J Lammie; Kimberly Y Won
Journal:  PLoS Negl Trop Dis       Date:  2014-08-14
View more
  55 in total

1.  A Novel, Highly Sensitive Quantitative Polymerase Chain Reaction Assay for the Diagnosis of Subarachnoid and Ventricular Neurocysticercosis and for Assessing Responses to Treatment.

Authors:  Elise M O'Connell; Sarah Harrison; Eric Dahlstrom; Theodore Nash; Thomas B Nutman
Journal:  Clin Infect Dis       Date:  2020-04-15       Impact factor: 9.079

Review 2.  The Global State of Helminth Control and Elimination in Children.

Authors:  Jill E Weatherhead; Peter J Hotez; Rojelio Mejia
Journal:  Pediatr Clin North Am       Date:  2017-08       Impact factor: 3.278

3.  Performance of Real-Time Polymerase Chain Reaction Assays for the Detection of 20 Gastrointestinal Parasites in Clinical Samples from Senegal.

Authors:  Doudou Sow; Philippe Parola; Khadime Sylla; Magatte Ndiaye; Pascal Delaunay; Philippe Halfon; Sabine Camiade; Thérèse Dieng; Roger C K Tine; Babacar Faye; Jean Louis Ndiaye; Yémou Dieng; Oumar Gaye; Didier Raoult; Fadi Bittar
Journal:  Am J Trop Med Hyg       Date:  2017-07       Impact factor: 2.345

4.  Quantitative Polymerase Chain Reaction for Diagnosis of Soil-Transmitted Helminth Infections: A Comparison with a Flotation-Based Technique and an Investigation of Variability in DNA Detection.

Authors:  Naomi E Clarke; Stacey Llewellyn; Rebecca J Traub; James McCarthy; Alice Richardson; Susana V Nery
Journal:  Am J Trop Med Hyg       Date:  2018-10       Impact factor: 2.345

Review 5.  Worm Infestation: Diagnosis, Treatment and Prevention.

Authors:  Bhavneet Bharti; Sahul Bharti; Sumeeta Khurana
Journal:  Indian J Pediatr       Date:  2017-11-11       Impact factor: 1.967

6.  How does supplementary feeding affect endoparasite infection in wild boar?

Authors:  Ragne Oja; Kaisa Velström; Epp Moks; Pikka Jokelainen; Brian Lassen
Journal:  Parasitol Res       Date:  2017-05-19       Impact factor: 2.289

7.  Improved Detection of Strongyloides stercoralis in Modified Agar Plate Cultures.

Authors:  Leonor A Pocaterra; Giuseppe Ferrara; Rosaura Peñaranda; Elsy Rojas; Gladymar Pérez-Chacón; Aurora Hernán; Gabriela Certad; Carlos Goldstein; Luz Núñez
Journal:  Am J Trop Med Hyg       Date:  2017-01-23       Impact factor: 2.345

Review 8.  Whipworm and roundworm infections.

Authors:  Kathryn J Else; Jennifer Keiser; Celia V Holland; Richard K Grencis; David B Sattelle; Ricardo T Fujiwara; Lilian L Bueno; Samuel O Asaolu; Oluyomi A Sowemimo; Philip J Cooper
Journal:  Nat Rev Dis Primers       Date:  2020-05-28       Impact factor: 52.329

9.  Diagnosis of Strongyloides stercoralis: Detection of parasite-derived DNA in urine.

Authors:  Nilanjan Lodh; Reynaldo Caro; Shterna Sofer; Alan Scott; Alejandro Krolewiecki; Clive Shiff
Journal:  Acta Trop       Date:  2016-07-22       Impact factor: 3.112

10.  PCR-assisted impedimetric biosensor for colibactin-encoding pks genomic island detection in E. coli samples.

Authors:  Nadja E Solis-Marcano; Myreisa Morales-Cruz; Gabriela Vega-Hernández; Ramón Gómez-Moreno; Claudia Binder; Abel Baerga-Ortiz; Craig Priest; Carlos R Cabrera
Journal:  Anal Bioanal Chem       Date:  2021-05-27       Impact factor: 4.142

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.