| Literature DB >> 26941845 |
Mohamed Shehata Draz1, Xiaonan Lu2.
Abstract
As a major foodborne pathogen, Salmonella enterica serotype Enteritidis is increasingly rising as a global health concern. Here, we developed an integrated assay that combines loop mediated isothermal amplification (LAMP) and surface enhanced Raman spectroscopy (SERS) for DNA detection of S. Enteritidis using specifically designed Raman active Au-nanoprobes. The target DNA was amplified by LAMP and then labeled with Au-nanoprobes comprised of gold nanoparticle-modified with specific cy5/DNA probes to allow the detection by SERS. The sensitivity of the developed LAMP-SERS detection assay (66 CFU/mL) was ~100-fold higher than the conventional polymerase chain reaction (PCR) method. Significantly, this technique allowed highly specific detection of the target DNA of S. Enteritidis and could differentiate it from the DNA of closely related bacterial species or non-specific contamination, making it more accurate and reliable than the standard LAMP technique. The applicability of detection of S. Enteritidis in milk samples using LAMP-SERS assay was validated as well. In sum, the developed LAMP-SERS assay is highly specific and sensitive, and has the potential to be applied for rapid detection of different foodborne pathogens and other microbial contaminants.Entities:
Keywords: LAMP; Raman spectroscopy; SERS; bacterial infections; clinical diagnosis; food safety.; nanoprobe
Mesh:
Substances:
Year: 2016 PMID: 26941845 PMCID: PMC4775862 DOI: 10.7150/thno.14391
Source DB: PubMed Journal: Theranostics ISSN: 1838-7640 Impact factor: 11.556
List of DNA sequences used in this study.
| Assay type | Oligonucleotide name | Sequence (5'-3') |
|---|---|---|
| PCR | Forward primer (FP) | GGGAGGAGCTTTAGCCAA |
| Reverse primer (RP) | ATGGTGAGCAGACAACAG | |
| LAMP | Forward outer primer (F3) | GGGAGGAGCTTTAGCCAA |
| Backward outer primer (B3) | ATGGTGAGCAGACAACAG | |
| Forward inner primer (FIP) | CATGCTCGCTGCACAAAAGCGAGAGGCGGTTTGATGTG | |
| Backward inner primer (BIP) | CTGGAAAGCCTCTTTATATAGCTCATGATATACTCCCTGAATCTGAGA | |
| LAMP-SERS | Labeling probe | GCCTAAAAAATCAG/iCy5N/GACGA/3ThioMC3-D/ |
| Target fragment | TCGTCACTGATTTTTTAGGC |