| Literature DB >> 26863600 |
John D Blair1, Helen S Bateup1, Dirk F Hockemeyer2.
Abstract
Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human development and investigate the pathophysiology of disease. By employing site-specific nucleases (SSNs) for genome editing, the rapid derivation of new hPSC lines harboring specific genetic alterations in an otherwise isogenic setting becomes possible. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 are the most commonly used SSNs. All of these nucleases function by introducing a double stranded DNA break at a specified site, thereby promoting precise gene editing at a genomic locus. SSN-meditated genome editing exploits two of the cell's endogenous DNA repair mechanisms, non-homologous end joining (NHEJ) and homology directed repair (HDR), to either introduce insertion/deletion mutations or alter the genome using a homologous repair template at the site of the double stranded break. Electroporation of hPSCs is an efficient means of transfecting SSNs and repair templates that incorporate transgenes such as fluorescent reporters and antibiotic resistance cassettes. After electroporation, it is possible to isolate only those hPSCs that incorporated the repair construct by selecting for antibiotic resistance. Mechanically separating hPSC colonies and confirming proper integration at the target site through genotyping allows for the isolation of correctly targeted and genetically homogeneous cell lines. The validity of this protocol is demonstrated here by using all three SSN platforms to incorporate EGFP and a puromycin resistance construct into the AAVS1 safe harbor locus in human pluripotent stem cells.Entities:
Mesh:
Substances:
Year: 2016 PMID: 26863600 PMCID: PMC4781717 DOI: 10.3791/53583
Source DB: PubMed Journal: J Vis Exp ISSN: 1940-087X Impact factor: 1.355
|
|
|
|
|
|
|
| Sexton | TPP1 | ZFN | GFP-Puro | unreported | unreported |
| Sexton | TERT | ZFN | Hygromycin | unreported | unreported |
| Hockemeyer | POU5F1 | ZFN | GFP-Puro | 31 | 39.0% |
| Hockemeyer | PITX3 | ZFN | GFP-Puro | 74 | 14.9% |
| Hockemeyer | POU5F1 | TALEN | GFP-Puro | 68 | 91.0% |
| Hockemeyer | PITX3 | TALEN | GFP-Puro | 96 | 13.0% |
| Merkle | VASA | Cas9 | Reporter-Geneticin | 139 | 94.0% |
| Merkle | CRH | Cas9 | Reporter-Geneticin | 30 | 93.0% |
| Merkle | HCRT | Cas9 | Reporter-Geneticin | 154 | 92.0% |
| Merkle | HMX2 | Cas9 | Reporter-Geneticin | 11 | 45.0% |
| Forster | LRG5-Nterm | ZFN | GFP-Puro | unreported | 30.0% |
| Forster | LRG5-Cterm | ZFN | GFP-Puro | unreported | 14.0% |
| Soldner | SNCA | ZFN | Puro | 96 | 1.0% |
|
|
|
|
| AAVS1-F primer | CTCTAACGCTGCCGTCTCTC | PCR conditions: Tm = 57 °C, 35 cycles |
| AAVS1-WT-R primer | GCTTCTCCTCTTGGGAAGTG | WT band: 1273 bp |
| AAVS1-Targeted-R primer | CGTCACCGCATGTTAGAAGA | Targeted band: 992 bp |
| T2-Cas9-guide | GGGCCACTAGGGACAGGAT | From Mali |
| AAVS1-ZFN-Right | TAGGGACAGGAT | From Hockemeyer |
| AAVS1-ZFN-Left | TGGGGTGTCACC | From Hockemeyer |
| AAVS1-TALEN-Right | TCCTAACCACTGTCTTT | From Hockemeyer |
| AAVS1-TALEN-Left | CCCCTCCACCCCACAGT | From Hockemeyer |
|
|
|
|
|
| ZFN | 150 | 86.9% (73.9% het/ 13.0 % homo) | 56% (50% het/6% homo) |
| TALEN | 412 | 91.3% (47.8% het/39.1% homo) | 47% (37.5% het/9.3% homo) |
| CRISPR-Cas9 | 235 | 95.7 % (69.5% het/26.3% homo) | unreported |