Literature DB >> 26844521

Exome Sequencing in a Family Identifies RECQL5 Mutation Resulting in Early Myocardial Infarction.

Xiang Xie1, Ying-Ying Zheng, Dilare Adi, Yi-Ning Yang, Yi-Tong Ma, Xiao-Mei Li, Zhen-Yan Fu, Xiang Ma, Fen Liu, Zi-Xiang Yu, You Chen, Ying Huang.   

Abstract

Coronary artery disease (CAD) including myocardial infarction (MI) is the leading cause of death worldwide and is commonly caused by the interaction between genetic factors and environmental risks. Despite intensive efforts using linkage and candidate gene approaches, the genetic etiology for the majority of families with a multigenerational early CAD /MI predisposition is unknown.In this study, we used whole-exome sequencing of 10 individuals from 1 early MI family, in which 4 siblings were diagnosed with MI before the age of 55, to identify potential predisposing genes.We identified a mutation in the RECQL5 gene, 1 of the 5 members of the RECQ family which are involved in the maintenance of genomic stability. This novel mutation, which is a TG insert at position 73,626,918 on the 13 chromosome and occurs before the last nucleotide of the introns 11 acceptor splice site affecting splicing of RECQL5. RT-PCR suggested the control subject had a full-length mRNA including exon 12, but the patients with RECQL5 mutation had a shorter mRNA form involving splicing of exons 11 to 13 directly, with skipping of exon 12. Quantitative RT-PCR analysis of RECQL5 exon 12 demonstrated that individuals whose genotype is mutant homozygote had only trace amounts of mRNA containing this exon and the family members who carry the heterozygous genotype had a level at 48% to 55% of the control's level.These findings provide insight into both the pathogenesis of MI and the role of RECQL5 gene in human disease.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26844521      PMCID: PMC4748938          DOI: 10.1097/MD.0000000000002737

Source DB:  PubMed          Journal:  Medicine (Baltimore)        ISSN: 0025-7974            Impact factor:   1.889


INTRODUCTION

Coronary artery disease (CAD), including myocardial infarction (MI), has been considered as a leading cause of mortality and disability worldwide.[1,2] Currently, MI has been considered a multifactorial disease resulting from the interaction between several susceptibility genes, such as C5L2,[3]SAA1,[4] and CYP17A1 gene,[5] and multiple environmental factors.[6,7] Although recent genome-wide association studies (GWAS) have identified several loci associated with CAD and MI,[8] a large fraction of the genetic risk for CAD/MI have not been identified. Therefore, it is necessary to identify additional susceptibility loci focusing on family constellation. Recently, 4 new loci which were strongly associated with CAD in Chinese Han ethnicity were identified using the GWAS analysis.[8] Although these findings have provided new insights into pathways contributing to the susceptibility for CAD and MI, we did not find any mutation of these loci in a family whose 4 members were attacked by acute MI before 55 years. Therefore, there might be some new gene mutations related to MI that have not been identified in the past decades. In light of this observation, we examined cases without previously identified pathogenic mutations in an attempt to identify new mutations that can cause early MI. In this study, we used whole-exome sequencing methods to identify potential predisposing genes in an early MI family and found a novel mutation in the RECQL5 gene is a pathogenicity-related locus resulting in early MI.

METHODS

Ethics Statement

This study was approved by the ethics committee of the first affiliated hospital of Xinjiang Medical University. Written informed consent was obtained from all subjects or their respective guardians.

Human Subjects

We focused on a family in which 4 siblings were diagnosed with MI (Figure 1A). The affected siblings (II-2, II-3, III-1, and III-3) are alive and have received the coronary stent implantation treatment. All 4 siblings had multivessel disease and >4 stents were implanted for recurrent attacks of acute myocardial infarction (AMI). Also, sibling II-2 and sibling II-3 were attacked by AMI twice and thrice, respectively. This family is of Chinese Han ancestry, ascertained via subject II-3, who presented with AMI at 49 years. He had smoked and taken alcohol before his first hospitalization because of AMI and his body mass index (BMI) was 25.4. He also had some other risk factors such as diabetes and hypercholesterolemia. His father died at 45 years of age for an unknown cause, and his mother suffered CAD and was alive. Detailed clinical data were obtained for all available kindred members, including 5 affected with MI or CAD, 4 free of CAD, and 1 younger asymptomatic member (CAD phenotype unknown; age 27 years). The clinical characteristics of all these 10 members are shown in Table 1.
FIGURE 1

Identification of RECQL5 mutations in MI. (A) Pedigree of a family with CAD/MI in 4 children and their mother/grandmother. (B) Sanger sequencing chromatograms from the 3′-end of exon 13 and 5′-end of intron 12 on RECQL5 in the family members. (C) RT-PCR analysis of RECQL5 exons 9 and 14 from peripheral blood RNA samples from the family members. CAD = coronary artery disease, MI = myocardial infarction, RT-PCR = reverse transcription polymerase chain reaction.

TABLE 1

Characteristics of the Family Members

Identification of RECQL5 mutations in MI. (A) Pedigree of a family with CAD/MI in 4 children and their mother/grandmother. (B) Sanger sequencing chromatograms from the 3′-end of exon 13 and 5′-end of intron 12 on RECQL5 in the family members. (C) RT-PCR analysis of RECQL5 exons 9 and 14 from peripheral blood RNA samples from the family members. CAD = coronary artery disease, MI = myocardial infarction, RT-PCR = reverse transcription polymerase chain reaction. Characteristics of the Family Members

Construction of DNA Libraries and Sequencing

Exome sequencing was performed at Shanghai Majorbio Bio-pharm Technology Co., Ltd (Shanghai, China). Briefly, DNA was extracted from peripheral venous blood samples using whole blood purification kit (Qiagen Bio, TLD, Beijing). DNA sequencing library was constructed using 5 μg of genomic DNA. Whole-exome sequence capture was performed according to “SureSelectXT Target Enrichment System for Illumina Paired-End Sequencing Library Illumina HiSeq and MiSeq Multiplexed Sequencing Platforms Protocol Version 1.3.1, February 2012.” We used Agilent 2100 Bioanalyzer for quality check and quantified the DNA libraries of subjects. Sequencing was performed on the Illumina Genome Analyzer II using a standard 56 cycle paired-end read sequencing protocol and Illumina's sequencing reagents according to the manufacturer's recommendations. Each library was sequenced individually on a single flow cell lane.

Analysis of Sequencing Data

Illumina's Data Analysis Pipeline software (v.1.6) was used to perform the base calling and sequence reads quality assessment. And we used the Burrows–Wheeler alignment (BWA) tool[9] to perform the alignment of sequence reads to the reference human genome (hg19, GRCh37). All sequencing data were processed according to the previous report.[10] The variant filtration was performed after all variants were obtained, annotated, and assessed from the exome sequencing process. Raw SNP calls were filtered using the following criteria: “QUAL < 30.0 || QD < 5.0 || HRun > 5 || SB > −0.10” and raw InDel calls were filtered using the following criteria: “MQ0 ≥ 4 && ([MQ0 / {1.0 ∗ DP}] > 0.1)” “SB ≥−1.0” “QUAL < 10”.

Sanger Sequencing-Based Genotyping of Variants

The primer pairs were designed using the Primer Premier 5.0 software. The sense primer was 5′TCTCTGGTGCTGGATGGGAC3′ and the antisense primer was 5′GTGTTGACTGGCGGTTGCT3′. We amplify a fragment of 453 bp around this variant. The same set of primers was used for both PCR amplification from genomic DNA samples and for Sanger sequencing. Curated results were obtained from the sequencing-based genotyping using automated and manual approaches.

RT-PCR Analysis

We isolated the total RNA from peripheral blood using a Blood RNA kit (Aidlab, Beijing, China). The RNA was treated with DNase (Aidlab, Beijing, China) after purification. We carried out the RT-PCR using a One-Step RT-PCR kit (Aidlab, Beijing, China). RT-PCR primers were designed in exon 9 (forward, 5′AGGGGAACGGCTTTGAC3′) and in exon 14 (reverse, 5′CCTTGGAGGCTCTGTGGA3′) of RECQL5. 30 cycles with an annealing temperature of 55°C were carried out for RT-PCR, and agarose gel electrophoresis was utilized to analyze the products.

Quantitative RT-PCR

We utilized quantitative RT-PCR to detect the expression of RECQL5 exon 12. RNA was prepared as above. The PCR amplification was performed on the ABI Prism 7900HT sequence-detection system (Applied Biosystems). GAPDH was used as the control reference. RECQL5 expression quantification was carried out using the ΔΔCt method as described previously.[11] In the procedure, we utilized the primers as follows: RECQL5 exon 12forward: 5′CAGGCTGACTGTGAAGG3′ 5′TTGGAGGCTCTGTGGAT3′. The primers for GAPDH (forward: 5′-TGCACCACCAACTGCTTAGC-3′; reverse: 5′-GGCATGGACTGTGGTCATGAG-3′) were designed referring to the previous report.[9]

RESULTS

In this study, we carried out a whole-exome sequencing on 10 members of a family in which 4 siblings were diagnosed with MI before 55 years of age. We obtained at least 40-fold coverage for >90% of the target bases. We filtered out all variants utilized the following information: ##fileformat = VCFv4.0; ##fileDate = 20120118; ##source = dbSNP; ##dbSNP_BUILD_ID = 135; ##reference = GRCh37.p5; ##phasing = partial; ##variationPropertyDocumentationUrl = ftp://ftp.ncbi.nlm.nih.gov/ snp/specs/dbSNP_BitField_latest.pdf. After filtering, we identified a mutation in the RECQL5 gene, which was shared by 5 affected members and 1 unknown phenotype sibling but not by the 4 unaffected members. This extreme familial clustering and segregation of phenotypes within the kindred is unlikely to be explained by chance or multifactorial determination and provides strong evidence that early MI is transmitted as a highly penetrating autosomal dominant trait (Figure 1 A and B), which was in line with the previous study.[10] In the present study, we identified a mutation in the RECQL5 gene, which is a TG insert at position 73,626,918 on the 13 chromosome (Figure 1B). This mutation occurs before the last nucleotide of the introns 11 acceptor splice site of RECQL5 gene. Therefore, this mutation was considered to be predicted to affect splicing of RECQL5. The results from RT-PCR demonstrated this prediction. The control subject had a full-length mRNA including exon 12, but the patients with RECQL5 mutation had a shorter mRNA form involving splicing of exons 11 to 13 directly, with skipping of exon 12 (Figure 1C and Figure 2). Furthermore, the quantitative RT-PCR analysis indicated that only trace amounts of mRNA containing exon 12 (5%, 7%, and 9% of control levels, respectively) were observed in individuals I-1, II-2, and II-3 whose genotype is mutant homozygote and the family members who carry the heterozygous genotype had a level at 48% to 55% of the control's level (Figure 3).
FIGURE 2

A model of how RECQL5 mutation in MI favors production of RECQL5 and the DNA sequence segment of the normal and the mutant one. (A) The sequence of the normal and the mutation. (B) Splicing pattern of RECQL5 in humans and the resulting mRNA.DNA = deoxyribonucleic acid, MI = myocardial infarction.

FIGURE 3

RECQL5 exon 12 mutation results in trace amounts of RECQL5 mRNA containing exon 12. Quantitative RT-PCR was performed on peripheral blood RNA samples from all the members in the family. Data are shown as the mean ± SD. RNA = ribonucleic acid, RT-PCR = reverse transcription polymerase chain reaction, SD = standard deviation.

A model of how RECQL5 mutation in MI favors production of RECQL5 and the DNA sequence segment of the normal and the mutant one. (A) The sequence of the normal and the mutation. (B) Splicing pattern of RECQL5 in humans and the resulting mRNA.DNA = deoxyribonucleic acid, MI = myocardial infarction. RECQL5 exon 12 mutation results in trace amounts of RECQL5 mRNA containing exon 12. Quantitative RT-PCR was performed on peripheral blood RNA samples from all the members in the family. Data are shown as the mean ± SD. RNA = ribonucleic acid, RT-PCR = reverse transcription polymerase chain reaction, SD = standard deviation.

DISCUSSION

DNA helicases are a class of enzymes which can obtain energy using the hydrolysis of ATP to open the double-stranded DNA structure and generate single-stranded DNA. These enzymes play an important role in gene transcription, DNA replication, homologous recombination, and DNA repair. Among these, RECQ helicase family members are very conservative in sequence, structure, and function, which are important in maintaining genomic stability.[12] Currently, although several studies suggested that the RECQL5 gene was associated with cancers,[13-15] the relation between RECQL5 gene and CHD/MI remains unclear. The human RECQL5 gene is of 3 transcripts (RECQL5α, β, and γ) through different splice modes.[16] The RECQ5α, β, and γ contain a conserved helicase domain and a RECQC domain, respectively.[17] Furthermore, the RECQL5β also contains a long C-terminal, which contains an NLS. However, all other RECQ helicase do not have similar C-terminal sequence, which indicates that RECQL5β may be of particular biological function. Izumikawa et al[18] found that the RECQL5 gene was associated with low-density lipoprotein receptor (LDLR) gene and β-actin gene, both of which were reported to be associated with CAD. And their results showed that when RECQL5 gene was knocked down, the LDLR gene and β-actin gene were significantly upregulated. The primary function of the membrane protein LDLR is to remove the circulating LDL by binding to and internalizing it, which are essential for the regulation of plasma cholesterol. Previous study indicated that LDLR mutations influence the LDLR residual activities to a different degree[19] and associated with coronary heart disease.[20] Therefore, the novel mutation, a TG insert at position 73,626,918 on the 13 chromosome and occurs before the last nucleotide of the introns 11 acceptor splice site, affects splicing of RECQL5, which results in the dysfunction of RECQL5 gene due to deficiency of exon 12. Furthermore, the loss-of-function RECQL5 may affect the expression of LDLR gene according to the report from Izumikawa et al.[18] This explanation may answer the question why the RECQL5 gene mutation can increased the MI susceptibility in this family. However, it is emphasized that CAD, including MI, is a multifactorial disease resulting from the interaction between genetic background and envirnmental factors. In the present study, we also found all the subjects with MI have increased serum concentration of TC, LDL-C, and CRP comparing to the healthy individuals. Therefore, there may be other mechanisms to explain the pathogenesis of early MI in this family, which remain unclear but were worthy to exploring in the future.

LIMITATIONS

There are several limitations in the present study. First, we included relative small number of patients in this family. Second, we included a younger asymptomatic member (CAD phenotype unknown; age 27 years) who did not perform in this family. Therefore, this fact to identify healthy subject using a self-stated record rather than coronary angiography is a limitation. Finally, we did not verify the causal relationship between RECQL5 and MI by knocking out the RECQL5 gene in mice. Therefore, our results need further verification in both animal model and large-sample population.
  20 in total

1.  Bloom syndrome in two siblings.

Authors:  Sheikh Javeed Sultan; Sheikh Tariq Sultan
Journal:  Pediatr Dermatol       Date:  2010 Mar-Apr       Impact factor: 1.588

2.  Heart disease and stroke statistics--2011 update: a report from the American Heart Association.

Authors:  Véronique L Roger; Alan S Go; Donald M Lloyd-Jones; Robert J Adams; Jarett D Berry; Todd M Brown; Mercedes R Carnethon; Shifan Dai; Giovanni de Simone; Earl S Ford; Caroline S Fox; Heather J Fullerton; Cathleen Gillespie; Kurt J Greenlund; Susan M Hailpern; John A Heit; P Michael Ho; Virginia J Howard; Brett M Kissela; Steven J Kittner; Daniel T Lackland; Judith H Lichtman; Lynda D Lisabeth; Diane M Makuc; Gregory M Marcus; Ariane Marelli; David B Matchar; Mary M McDermott; James B Meigs; Claudia S Moy; Dariush Mozaffarian; Michael E Mussolino; Graham Nichol; Nina P Paynter; Wayne D Rosamond; Paul D Sorlie; Randall S Stafford; Tanya N Turan; Melanie B Turner; Nathan D Wong; Judith Wylie-Rosett
Journal:  Circulation       Date:  2010-12-15       Impact factor: 29.690

3.  Genetic variants of arachidonate 5-lipoxygenase-activating protein, and risk of incident myocardial infarction and ischemic stroke: a nested case-control approach.

Authors:  Robert Y L Zee; Suzanne Cheng; Hillary H Hegener; Henry A Erlich; Paul M Ridker
Journal:  Stroke       Date:  2006-06-15       Impact factor: 7.914

4.  Exome sequencing identifies GATA1 mutations resulting in Diamond-Blackfan anemia.

Authors:  Vijay G Sankaran; Roxanne Ghazvinian; Ron Do; Prathapan Thiru; Jo-Anne Vergilio; Alan H Beggs; Colin A Sieff; Stuart H Orkin; David G Nathan; Eric S Lander; Hanna T Gazda
Journal:  J Clin Invest       Date:  2012-06-18       Impact factor: 14.808

5.  LRP6 mutation in a family with early coronary disease and metabolic risk factors.

Authors:  Arya Mani; Jayaram Radhakrishnan; He Wang; Alaleh Mani; Mohammad-Ali Mani; Carol Nelson-Williams; Khary S Carew; Shrikant Mane; Hossein Najmabadi; Dan Wu; Richard P Lifton
Journal:  Science       Date:  2007-03-02       Impact factor: 47.728

6.  Genetic polymorphisms of serum amyloid A1 and coronary artery disease risk.

Authors:  X Xie; Y-T Ma; Y-N Yang; X-M Li; Y-Y Zheng; F Liu; X Ma; Z-Y Fu; Z-X Yu; Y Chen; B-D Chen; Y Huang
Journal:  Tissue Antigens       Date:  2015-02-06

7.  Genome-wide association study in Han Chinese identifies four new susceptibility loci for coronary artery disease.

Authors:  Xiangfeng Lu; Laiyuan Wang; Shufeng Chen; Lin He; Xueli Yang; Yongyong Shi; Jing Cheng; Liang Zhang; C Charles Gu; Jianfeng Huang; Tangchun Wu; Yitong Ma; Jianxin Li; Jie Cao; Jichun Chen; Dongliang Ge; Zhongjie Fan; Ying Li; Liancheng Zhao; Hongfan Li; Xiaoyang Zhou; Lanying Chen; Donghua Liu; Jingping Chen; Xiufang Duan; Yongchen Hao; Ligui Wang; Fanghong Lu; Zhendong Liu; Cailiang Yao; Chong Shen; Xiaodong Pu; Lin Yu; Xianghua Fang; Lihua Xu; Jianjun Mu; Xianping Wu; Runping Zheng; Naqiong Wu; Qi Zhao; Yun Li; Xiaoli Liu; Mengqin Wang; Dahai Yu; Dongsheng Hu; Xu Ji; Dongshuang Guo; Dongling Sun; Qianqian Wang; Ying Yang; Fangchao Liu; Qunxia Mao; Xiaohua Liang; Jingfeng Ji; Panpan Chen; Xingbo Mo; Dianjiang Li; Guoping Chai; Yida Tang; Xiangdong Li; Zhenhan Du; Xuehui Liu; Chenlong Dou; Zili Yang; Qingjie Meng; Dong Wang; Renping Wang; Jun Yang; Heribert Schunkert; Nilesh J Samani; Sekar Kathiresan; Muredach P Reilly; Jeanette Erdmann; Xiaozhong Peng; Xigui Wu; Depei Liu; Yuejin Yang; Runsheng Chen; Boqin Qiang; Dongfeng Gu
Journal:  Nat Genet       Date:  2012-07-01       Impact factor: 38.330

8.  Association of RECQL5 gene polymorphisms and osteosarcoma in a Chinese Han population.

Authors:  Li-Qiang Zhi; Wei Ma; Hong Zhang; Si-Xiang Zeng; Bo Chen
Journal:  Tumour Biol       Date:  2013-11-28

9.  Meta-analysis of low density lipoprotein receptor (LDLR) rs2228671 polymorphism and coronary heart disease.

Authors:  Huadan Ye; Qianlei Zhao; Yi Huang; Lingyan Wang; Haibo Liu; Chunming Wang; Dongjun Dai; Leiting Xu; Meng Ye; Shiwei Duan
Journal:  Biomed Res Int       Date:  2014-05-12       Impact factor: 3.411

10.  Association between RECQL5 genetic polymorphisms and susceptibility to breast cancer.

Authors:  Yu-Jun He; Zuo-Yi Qiao; Bo Gao; Xiao-Hua Zhang; Ya-Yuan Wen
Journal:  Tumour Biol       Date:  2014-11-14
View more
  3 in total

1.  Impact of metabolism-related mutations on the heart rate of gastric cancer patients after peritoneal lavage.

Authors:  Yan Yuan; Shuang Yao; Guang-Hua Luo; Xiao-Ying Zhang
Journal:  World J Clin Cases       Date:  2021-02-26       Impact factor: 1.337

Review 2.  Pathogenesis of premature coronary artery disease: Focus on risk factors and genetic variants.

Authors:  Haiming Wang; Zifan Liu; Junjie Shao; Min Jiang; Xuechun Lu; Lejian Lin; Lin Wang; Qiang Xu; Haomin Zhang; Xin Li; Jingjing Zhou; Yundai Chen; Ran Zhang
Journal:  Genes Dis       Date:  2020-11-10

3.  A Novel Gene CDC27 Causes SLE and Is Associated With the Disease Activity.

Authors:  Shunlai Shang; Yena Zhou; Keng Chen; Lang Chen; Ping Li; Diangeng Li; Shaoyuan Cui; Mei-Jun Zhang; Xiangmei Chen; Qinggang Li
Journal:  Front Immunol       Date:  2022-03-28       Impact factor: 7.561

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.