Literature DB >> 26808531

Molecular Evidence for the Hybrid Origin of Ilex dabieshanensis (Aquifoliaceae).

Lin Shi1, Naiwei Li2, Shuqiong Wang3, Yubing Zhou3, Weijie Huang3, Yuchen Yang3, Yongpeng Ma4, Renchao Zhou3.   

Abstract

Ilex, the largest genus of dioecious woody plants, is a good study system to assess the role of hybridization in speciation and evolution. Ilex dabieshanensis, a tree endemic to Dabieshan Mountains region, was initially described as a new species. Based on morphological intermediacy and sympatric distribution with its putative parental species, I. cornuta and I. latifolia, we proposed it as a natural hybrid between them. In this study, we sequenced one chloroplast intergenic spacer (trnH-psbA) and two nuclear genes (gapC and nepGS) in I. dabieshanensis and its putative parental species to test the hybrid origin hypothesis. Our results showed that there were one to two differentially fixed sequence differences between I. cornuta and I. latifolia at the two nuclear genes. Twelve of the 14 individuals of I. dabieshanensis exhibited additivity in chromatograms on these differentially fixed sites at both nuclear genes, and the remaining two exhibited additivity in chromatograms on the fixed site at only the nepGS gene. Except one haplotype of I. cornuta at the nepGS gene, all of the haplotypes of I. cornuta at the two nuclear genes were well separated from those of I. latifolia, and most haplotypes of I. dabieshanensis were shared with those of I. cornuta and I. latifolia. Phylogenetic analysis of these haplotypes was largely consistent with haplotype network analysis. I. cornuta and I. latifolia differed by two nucleotide substitutions in the chloroplast intergenic spacer, and 12 individuals of I. dabieshanensis had the same sequences as I. latifolia, while the remaining two were identical with I. cornuta. The molecular data provide convincing evidence for the hybrid origin of I. dabieshanensis and asymmetrical direction of hybridization. One haplotype of I. cornuta at the nepGS gene was nested with those of I. latifolia, indicating introgression to I. cornuta.

Entities:  

Mesh:

Year:  2016        PMID: 26808531      PMCID: PMC4725680          DOI: 10.1371/journal.pone.0147825

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

When closely related species, especially those within a genus, come into contact, hybridization is a common consequence in many plant groups [1,2]. If hybrids have reduced fitness in the habitats of their parental species, they will be restricted to intermediate habitats [3]. The hybrid zones can be maintained by a balance between selection against hybrids and repeated hybridization between parental species. This kind of hybrid zones can not expand if one or both parental species fail to expand its or their ranges. In this situation, the hybrid taxa may be recognized as locally endemic because they span a relatively limited range. Narrow ranges of species can also be caused by recent speciation by lineage splitting on a local scale, or range contraction of previously widespread species. Thus, precise characterization of the number of hybrid taxa within plant groups with a high proportion of narrow ranging species is critical for assessing the role of hybridization in species diversity and evolution. Ilex L. (Hollies) is the sole genus of Aquifoliaceae [4], consisting of 400–600 species in tropical and subtropical to temperate regions of the world [5-8]. It is also the largest genus of dioecious woody plants [6,9]. The main areas of extant diversification of Ilex are East Asia and South America [10-12]. Seeds of Ilex species are extremely important food for numerous species of birds, and some wild animals [13,14], and thus Ilex species play important roles in the local ecosystems. There are many naturally occurring or cultivated interspecific hybrids in this genus [6, 15–19]. Interspecific hybridization and introgression have probably played important roles in the evolution and speciation of Ilex, as also suggested by substantial incongruence between the nuclear phylogeny and the plastid phylogeny of this genus [10-12,20]. Many species in this genus have very limited geographic distributions and to date 97 species of this genus have been listed in the ICUN red list of endangered species [21]. In China, there are about 200 species of Ilex, which are mostly distributed in Southwest and South China, with the southern slopes of Qingling Mountains being the northern range margin of this genus [7,8]. Among the 200 species, about 150 species are endemic to China. Many species endemic to China occur in very narrow ranges, and one such is I. dabieshanensis K. Yao et M. P. Deng [22]. I. dabieshanensis was initially described as a new species and is distributed only in the Dabieshan Mountains region [8,22], a major mountain range located in the boundary between Hubei, Henan and Anhui provinces in Central China. It is usually found in slopes, roadsides and streamsides with an elevation of 100–500 m [8]. In addition to I. dabieshanensis, there are three other species of Ilex in the Dabieshan Mountains region, namely, I. latifolia Thunb., I. cornuta Lindl. et Paxt. and I. chinensis Sims. I. latifolia is distributed in Central and South China and Japan, with an elevation of 250–1500 m. I. chinensis has a very similar geographic distribution with I. latifolia, but with a broader range in elevation (from sea level to 2000 m). I. cornuta is native to North, Central and East China and Korea with an elevation of 100–1900 m, and is widely cultivated as an ornamental plant in Europe and North America. While I. chinensis has papery leaves, crenate leaf margins and purple-red flowers, all other three species have thickly leathery leaves, serrated or spiny leaf margins and yellow-green flowers. Compared with the three other species, I. dabieshanensis is quite rare. It has many morphological characters intermediate between I. latifolia and I. cornuta. For example, I. comuta has the spiny leaf margins with one to two spines per side and one strong reflexed spine in the apex, and I. latifolia has serrated leaf margins, with over 20 pairs of teeth, while I. dabieshanensis has slightly revolute and serrated leaf margins, with four to eight pairs of spines. Based on its rare occurrence in the overlapping areas and morphological intermediacy between I. cornuta and I. latifolia, we propose that I. dabieshanensis might be an interspecific hybrid between them. Verifying the hybrid origins of taxa in question is valuable for studies on taxonomy, evolution and conservation. In the present study, we determined the sequences of one chloroplast intergenic spacer and two low-copy nuclear genes in the four sympatric Ilex species in the Dabieshan Mountains region to test the hypothesis that I. dabieshanensis is a hybrid of I. cornuta and I. latifolia. Because introgression is a common consequence of hybridization and can contribute to transfer of adaptive traits between species [23-25], we also aimed to investigate if there is any evidence for introgression between its parental species.

Materials and Methods

Plant materials

Our sampling site was located in Manshuihe, Huoshan, Anhui, China. At this location, no specific permissions were required for scientific research and no endangered or protected species were involved at this study. These four species were identified according to the diagnostic morphological traits described in the Flora of China [7,8]. Fig 1 showed the morphological illustrations of these species. We sampled 14 individuals of I. cornuta, 17 indi viduals of I. latifolia and 14 individuals of I. dabieshanensis. We used different number of individuals for the three taxa because we could find only these individuals during our field work. We also sampled eight individuals of I. chinensis, which were used as outgroups. Leaves from each individual of these species were collected and dried in plastic bags with silica gel for subsequent DNA extraction.
Fig 1

Morphological illustrations for the four Ilex species used in this study.

The adaxial and abaxial surfaces of the four species are shown in the upper and lower panels, respectively. From left to right are I. chinensis, I. cornuta, I. dabieshanensis and I. latifolia.

Morphological illustrations for the four Ilex species used in this study.

The adaxial and abaxial surfaces of the four species are shown in the upper and lower panels, respectively. From left to right are I. chinensis, I. cornuta, I. dabieshanensis and I. latifolia.

PCR and sequencing of the two nuclear genes and the chloroplast trnH-psbA regions

We extracted genomic DNA of these samples from dried leaf tissues using the CTAB method [26]. In this study, we used two universal low-copy nuclear genes (nepGS and gapC), which encode the nuclear encoded plastid glutamine synthetase (nepGS) and the cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPC), respectively. We obtained the primer sequences of nepGS from Emshwiller and Doyle [27]. As for gapC, we first used its universal primers of angiosperms [28] for amplification in one individual of each species. After the sequences had been generated, we designed the specific primers for these Ilex species. The primer sequences were IgapC-F: 5' TTTGTATTGATATTGCTCCATTTTG 3' and IgapC-R: 5' TGAAATATCCATTCTCACCTGTTG 3'. We amplified the chloroplast trnH-psbA regions using the universal primers trnH and psbA [29]. We purified the PCR products using a Pearl Gel Extraction Kit (Pearl Bio-tech, Guangzhou, China) and then directly sequenced them on an ABI 3730 DNA automated sequencer with the BigDye chemistry (Applied Biosystems, Foster City, CA, USA). For most individuals of I. dabieshanensis and some individuals of I. cornuta and I. latifolia, direct sequencing produced the superimposed chromatograms on multiple sites and unreadable peaks were observed after intra-individual length polymorphisms at the two nuclear genes, so we used cloning sequencing to phase the haplotypes. We conducted ligation reactions with a pMD18-T&A cloning kit (Takara, Dalian, China) and selected eight positive colonies for each individual for sequencing. We deposited all of the sequences in GenBank with accession numbers KP867812-KP867869 and KP903384-KP903390.

Sequence analyses

We edited all of the sequences from the four species by using SeqMan (DNASTAR Inc., Madison, WI, USA) and aligned them in Clustal X [30]. At the two nuclear genes, we phased the haplotypes for those individuals that were subject to direct sequencing using Phase [31]. We used Network 4.6 (www.fluxus-engineering.com) with the median-joining method [32] to resolve the relationships of the haplotypes of the nuclear genes. To examine if there is any recombination at the two nuclear genes between the two putative parental species, we detected the minimum number of recombination events for each of I. cornuta and I. latifolia, and for the three taxa together, respectively, using DNASP5.0 [33]. For each nuclear gene, we also reconstructed the phylogeny of these haplotypes using maximum parsimony (MP) and maximum likelihood (ML) methods, as implemented in PAUP4.0b [34]. We carried out parsimony analyses by using a heuristic search with tree bisection-reconnection branch swapping, the MulTrees option, accelerated transformation optimization, and 100 random addition replicates. We considered indels as the fifth state, and each indel with two or more nucleotides as a single mutational event. Bootstrap analyses were carried out with 1000 replicates of the heuristic search with simple taxon addition and maxtrees being set to 500. Because I. chinensis was highly divergent with the three other species at the two nuclear genes and the chloroplast intergenic spacer, we used it as an outgroup to root the phylogenetic trees. For ML analysis, we selected an appropriate nucleotide substitution model for each gene based on the result of Modeltest 3.7 [35]. Similar to the MP analysis, the ML analysis was carried out by using heuristic search with tree bisection-reconnection branch swapping, holding one tree at each step. The maxtrees was also set to 500. Node support was estimated with 1000 bootstrap replicates.

Results

Sequence analyses of the chloroplast trnH-psbA regions in the four species of Ilex

The aligned sequences of the chloroplast trnH-psbA regions from the four species of Ilex were 495 bp in length. No within-species variation was found in this region for each of I. cornuta, I. latifolia and I. chinenesis. I. chinensis differed from I. cornuta and I. latifolia by seven nucleotide substitutions and three insertion/deletions (57bp, 2bp and 1 bp, respectively) (Table 1). There were two nucleotide substitutions in the chloroplast trnH-psbA regions between I. cornuta and I. latifolia (Table 1). Of the 14 individuals of I. dabieshanensis that we sampled, 12 had identical trnH-psbA sequence with I. latifolia, whereas the remaining two had the same trnH-psbA sequences as I. cornuta (Table 1 and Table 2).
Table 1

Variable sites of chloroplast trnH-psbA in the four species of Ilex.

Numbers represent the positions of variable sites. Two haplotypes (H1 and H2) are found in I. dabieshanenesis and 12 and 2 individuals have H1 and H2, respectively. a: 57 bp deletion; b: 57 bp insertion.

TaxonVariable sites
686983118119127133–189295–296297302
I. cornutaAAACACaGAAT
I. latifoliaAAAAACaGAAG
I. dabieshanensisH1 (12)AAAAACaGAAG
H2 (2)AAACACaGAAT
I. chinensisTCCACAb- -T-
Table 2

Haplotypes and genotypes of the 14 individuals of Ilex dabieshanenesis at two nuclear genes (gapC and nepGS) and one chloroplast intergenic region (trnH-psbA).

Haplotypes with single and double underline have identical sequences with those of I. cornuta and I. latifolia, respectively (see Fig 2 for haplotype sharing information). At the chloroplast intergenic region (trnH-psbA), H1 and H2 of I. dabieshanenesis have identical sequences with that of I. latifolia and I. cornuta, respectively.

Sample No.Marker
gapCnepGStrnH-psbA
Id1D1, D9D9, D11H1
Id2D1, D10D5, D8H1
Id3D2, D11D7, D11H2
Id4D3, D6D6, D11H2
Id5D5, D9D3, D4H1
Id6D2, D8D7, D11H1
Id7D4, D9D1, D12H1
Id8D13, D14D5, D13H1
Id9D5, D7D10, D11H1
Id10D5, D7D10, D11H1
Id11D5, D7D10, D11H1
Id12D7, D12D9, D11H1
Id13D1, D4D2, D13H1
Id14D1, D15D5, D11H1

Variable sites of chloroplast trnH-psbA in the four species of Ilex.

Numbers represent the positions of variable sites. Two haplotypes (H1 and H2) are found in I. dabieshanenesis and 12 and 2 individuals have H1 and H2, respectively. a: 57 bp deletion; b: 57 bp insertion.

Haplotypes and genotypes of the 14 individuals of Ilex dabieshanenesis at two nuclear genes (gapC and nepGS) and one chloroplast intergenic region (trnH-psbA).

Haplotypes with single and double underline have identical sequences with those of I. cornuta and I. latifolia, respectively (see Fig 2 for haplotype sharing information). At the chloroplast intergenic region (trnH-psbA), H1 and H2 of I. dabieshanenesis have identical sequences with that of I. latifolia and I. cornuta, respectively.
Fig 2

Haplotype networks of gapC (A) and nepGS (B) genes for four species of Ilex.

Green, red, yellow and blue circles represent haplotypes of I. cornuta, I. latifolia, I. dabieshanensis and I. chinensis, respectively. The circle size denotes the haplotype frequency. C, L, D and Ch denote the haplotype ID for I. cornuta, I. latifolia, I. dabieshanensis and I. chinensis, respectively. Small black circles represent hypothetical haplotypes. The numbers close to the connecting lines denote mutational steps. The number is not shown when the mutational step is equal to one.

Sequence analyses of the gapC genes in the four species of Ilex

The aligned length of the partial gapC gene in the four Ilex species was 730 bp. There were 26 fixed nucleotide substitutions between I. chinenesis and the three other species. Although both I. cornuta and I. latifolia had relatively high levels of within-species polymorphism (see below), there were only one fixed nucleotide substitution (the 539th site: T for I. cornuta and G for I. latifolia) and one fixed 1-bp insertion/deletion (the 605th site:—for I. cornuta and T for I. latifolia) between I. cornuta and I. latifolia. For I. dabieshanensis, 12 of the 14 individuals exhibited chromatogram additivity on these two differentially fixed sites between I. cornuta and I. latifolia; the remaining two individuals (Id1 and Id12) had the same sequence as I. latifolia on these two fixed sites. For the haplotype analysis, no polymorphism at this gene was detected for the eight individuals of I. chinenesis, while I. cornuta and I. latifolia had nine and seven haplotypes, respectively. In contrast, I. dabieshanensis exhibited much higher haplotype richness, with 15 haplotypes being detected. Eleven of the 15 haplotypes of I. dabieshanensis were shared with those of I. cornuta and I. latifolia (Fig 2A). The remaining four haplotypes were unique to I. dabieshanensis (Table 2). The haplotypes of I. chinensis were well separated from those of the three other species (Fig 2A). Recombination analysis showed that the numbers of minimum recombination events in I. cornuta and I. latifolia were two and zero, respectively. When the haplotype data of the three taxa (I. cornuta, I. latifolia and I. dabieshanensis) were combined for this analysis, the number of minimum recombination events was three.

Haplotype networks of gapC (A) and nepGS (B) genes for four species of Ilex.

Green, red, yellow and blue circles represent haplotypes of I. cornuta, I. latifolia, I. dabieshanensis and I. chinensis, respectively. The circle size denotes the haplotype frequency. C, L, D and Ch denote the haplotype ID for I. cornuta, I. latifolia, I. dabieshanensis and I. chinensis, respectively. Small black circles represent hypothetical haplotypes. The numbers close to the connecting lines denote mutational steps. The number is not shown when the mutational step is equal to one. Twenty-six of the 730 nucleotide sites were parsimoniously informative for the gapC gene matrix. Based on the Akaike Information Criterion in Modeltest, the best-fit model for the ML analysis is the HKY+G model. Phylogenetic analysis with the MP algorithm yielded one most parsimonious tree of 69 steps (Fig 3A; CI = 0.899; RI = 0.889; RC = 0.799). In the MP tree, the haplotypes of I. cornuta, I. latifolia and I. dabieshanensis formed two clades; one clade consisted of all of the haplotypes of I. cornuta and some halpotypes of I. dabieshanensis, and the other clade comprised all of the haplotypes of I. latifolia and other halpotypes of I. dabieshanensis. The ML analysis of this dataset generated highly similar tree topology with the MP analysis.
Fig 3

Phylogenetic analyses of haplotype data of two nuclear genes for the four species of Ilex.

Shown are the most parsimonious trees for the gapC (A) and nepGS (B) data sets. Numbers above the branches indicate maximum parsimony/maximum likelihood bootstrap values (> 50%).–is used for < 50% bootstrap support.

Phylogenetic analyses of haplotype data of two nuclear genes for the four species of Ilex.

Shown are the most parsimonious trees for the gapC (A) and nepGS (B) data sets. Numbers above the branches indicate maximum parsimony/maximum likelihood bootstrap values (> 50%).–is used for < 50% bootstrap support.

Sequence analyses of the nepGS genes in the four species of Ilex

The partial nepGS gene was 859 bp long in the four species of Ilex after sequence alignment. There were 14 fixed nucleotide substitutions between I. chinenesis and the three other species. Only one differentially fixed nucleotide substitution (the 823rd site: G for I. cornuta and C for I. latifolia) were observed between I. cornuta and I. latifolia. All 14 individuals of I. dabieshanensis exhibited chromatogram additivity on this fixed site. For the haplotype analysis, no polymorphism at this gene was detected for the eight individuals of I. chinenesis. Again, both I. cornuta and I. latifolia show relatively high levels of polymorphisms at this gene. Seven and six haplotypes were found in I. cornuta and I. latifolia, respectively. Thirteen haplotypes were detected in the 14 individuals of I. dabieshanensis. Seven of the 13 haplotypes of I. dabieshanensis were shared with those of I. cornuta and I. latifolia, and six haplotypes were unique to I. dabieshanensis ((Fig 2B, Table 2). Again, the haplotype of I. chinensis was well separated from those of the three other species at this gene (Fig 2B). The numbers of minimum recombination events at the nepGS gene in I. cornuta and I. latifolia were four and two, respectively. When the haplotype data of the three taxa (I. cornuta, I. latifolia and I. dabieshanensis) were combined for recombination analysis, the number of minimum recombination events was nine. Fifty-five of the 859 nucleotide sites were parsimoniously informative for the nepGS gene set. Based on the Akaike Information Criterion in Modeltest, the best-fit model for the ML analysis is the TVM+I+G model. Phylogenetic analysis with the MP algorithm yielded one most parsimonious tree of 116 steps (Fig 3B; CI = 0.690; RI = 0.817; RC = 0.564). In the MP tree, the haplotypes of I. cornuta, I. latifolia and I. dabieshanensis formed two well separated clades; one clade consisted of six of the seven haplotypes of I. cornuta and some halpotypes of I. dabieshanensis, while the other clade comprised all of the haplotypes of I. latifolia, one haplotype of I. cornuta and other halpotypes of I. dabieshanensis. Again, the ML analysis of this dataset generated highly similar tree topology with the MP analysis.

Discussion

The hybrid origin of I. dabieshanensis

Ilex dabieshanensis was initially described as a distinct species in this genus. Since it shows morphological intermediacy between I. cornuta and I. latifolia, and occurs where the two species overlap in geographic distribution, we proposed it might be a hybrid between them. In the present study, we sequenced a chloroplast intergenic spacer and two low-copy nuclear genes to test the hybrid origin hypothesis. I. cornuta and I. latifolia had one to two differentially fixed sequence differences at both the nuclear and the chloroplast loci. All 14 individuals of I. dabieshanensis showed an identical chlorotype with either I. cornuta or I. latifolia and chromatogram additivity on these differentially fixed sites at one or both nuclear genes, supporting the hypothesis of hybrid origin of I. dabieshanensis. Two individuals of I. dabieshanensis (Id1 and Id12) that exhibited chromatogram additivity between I. cornuta and I. latifolia at the nepGS gene but identical haplotypes with I. latifolia at the gapC gene, must be later-generation hybrids. Furthermore, because chloroplast DNA is maternally inherited in the majority of angiosperms [36] and if it holds in Ilex, that 12 and 2 individuals of I. dabieshanensis have identical trnH-psbA sequences with I. latifolia and I. cornuta respectively indicate that the hybridization was bidirectional and asymmetrical. We also observed several haplotypes unique to I. dabieshanensis at the nuclear genes, most of which are only one or two mutational steps from the haplotypes of I. cornuta or I. latifolia. This pattern may stem from unsampled polymorphisms in the parental species, which is not surprising given that both I. cornuta and I. latifolia have a relatively high level of polymorphism. Of course, we could not exclude the possibility of new mutations occurred in I. dabieshanensis and intragenic recombination. At each of the two nuclear genes, the number of minimum recombination events in the combined data of the three taxa is higher than the sum of minimum recombination events in I. cornuta and I. latifolia, suggesting that intragenic recombination should contribute to this. Together, the scarcity of taxon-specific haplotypes and the evidence of its hybrid origin indicate that I. dabieshanensis is not a biological species, and therefore, does not merit recognition of the species taxonomic rank. Interspecific hybridization between I. cornuta and I. latifolia may be attributable to several factors. First, I. cornuta and I. latifolia have overlapping geographic distributions in Dabieshan Mountains region of Central China. Both species can occur in sparse forests and streamsides, although I. latifolia usually has higher elevations than I. cornuta in Dabieshan Mountains region. Second, flowering periods of both species are from April to May [7,8]. Moreover, pollinator sharing between many species of Ilex [37] is another factor. Species of this genus are generally dioecious, with male and female flowers on different plants [4,6-8]. Bees and other insects are main pollinators of Ilex species [37]. All these factors should contribute to natural hybridization between the two species.

Potential introgression between I. cornuta and I. latifolia

One of the prominent outcomes of natural hybridization is introgression. Introgression can facilitate adaptation by transfer of beneficial genes and corresponding traits [24-26]. Unlike many other interspecific hybrids that often have much reduced fertility, I. dabieshanensis can produce a great number of seeds and these seeds can germinate [38], thus offering chances for introgression. In this study, at least two individuals of I. dabieshanensis are identified as later generation hybrids in the hybrid zone, indicative of potential introgression. This is further supported by the nepGS gene analysis. Both haplotype network analysis and phylogenetic analysis of the nepGS gene reveal that one relatively common haplotype, C6 (D7), of I. cornuta is nested within the clade of I. latifolia rather than in its own clade. Introgression of I. latifolia alleles to I. cornuta can account for this. Moreover, this haplotype possesses the diagnostic nucleotide G (the 823rd site) of I. cornuta, which can be generated by intragenic recombination between alleles of I. cornuta and I. latifolia, and is also consistent with the occurrence of introgression. Introgression between species of Ilex has also been found in previous studies [16-18]. Interestingly, in one case where I. cornuta and I. integra hybridize in Wando, Korea, the introgression is also skewed to I. cornuta [18]. Introgression of alleles of other species to I. cornuta may contribute to its adaptation to local environments and thus facilitate its range expansion, a hypothesis in need of further testing.

Natural hybridization in Ilex

Besides the species mentioned here, many other species of Ilex overlap to different degrees in geographic ranges and flowering periods [4, 6–8]. Furthermore, sharing of pollinators between many Ilex species [37] also provides ample opportunities for natural hybridization. Artificial crosses between many species of Ilex have proven successful with many combinations producing viable seeds [6]. Thus, reproductive isolation between some Ilex species should be incomplete. We propose that many species of Ilex that are morphologically intermediate between, and geographically overlapping with, other species, may in fact be of hybrid origin, a hypothesis in need of further testing. There are approximately 400–600 species in Ilex [4-8] and a large proportion of species in this genus is locally, narrowly ranging species. For example, about 150 of the 200 species in China are endemic species [7,8], and many of them are confined to very limited ranges, such as on a small mountain range or on an island. Although the hybrid origin of only two narrowly ranging species, I. dabieshanensis in this study and I. x wandoensis in a previous study [18], have been confirmed by molecular means, we believe that many more of these narrowly ranging species probably result from hybridization. This is also suggested by substantial incongruence between the nuclear phylogeny and the plastid phylogeny of this genus [10-12,20]. The fossil record indicates that the genus Ilex was cosmopolitan during the Eocene [9,10,39]. Now this genus is mainly distributed in Asia and Central and South America. As the largest genus of dioecious woody plants, Ilex is a good system for studying speciation, extinction and biogeography [10-12,20]. Once hybrid taxa of this genus are systematically identified, we can assess the role of hybridization in the species diversity and evolution, and precisely estimate the rate of speciation via lineage splitting in this genus.

Conclusions

The molecular data clearly demonstrate that I. dabieshanensis is of hybrid origin and mostly, I. latifolia is the maternal parent. One haplotype of I. cornuta at the nepGS gene is nested with those of I. latifolia, indicating introgression to I. cornuta. Although some narrowly ranging species in this genus, including I. dabieshanensis in this study, are products of interspecific hybridization, precisely assessing the role of hybridization in the species diversity and evolution in Ilex relies on comprehensive identification of hybrid taxa.
  16 in total

1.  Chloroplast-expressed glutamine synthetase (ncpGS): potential utility for phylogenetic studies with an example from Oxalis (Oxalidaceae).

Authors:  E Emshwiller; J J Doyle
Journal:  Mol Phylogenet Evol       Date:  1999-08       Impact factor: 4.286

2.  Median-joining networks for inferring intraspecific phylogenies.

Authors:  H J Bandelt; P Forster; A Röhl
Journal:  Mol Biol Evol       Date:  1999-01       Impact factor: 16.240

3.  Model selection and model averaging in phylogenetics: advantages of akaike information criterion and bayesian approaches over likelihood ratio tests.

Authors:  David Posada; Thomas R Buckley
Journal:  Syst Biol       Date:  2004-10       Impact factor: 15.683

4.  The history of extant Ilex species (Aquifoliaceae): evidence of hybridization within a Miocene radiation.

Authors:  Jean-François Manen; Gabrielle Barriera; Pierre-André Loizeau; Yamama Naciri
Journal:  Mol Phylogenet Evol       Date:  2010-09-24       Impact factor: 4.286

5.  DnaSP v5: a software for comprehensive analysis of DNA polymorphism data.

Authors:  P Librado; J Rozas
Journal:  Bioinformatics       Date:  2009-04-03       Impact factor: 6.937

6.  The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Authors:  J D Thompson; T J Gibson; F Plewniak; F Jeanmougin; D G Higgins
Journal:  Nucleic Acids Res       Date:  1997-12-15       Impact factor: 16.971

7.  Nuclear DNA-based markers for plant evolutionary biology.

Authors:  A E Strand; J Leebens-Mack; B G Milligan
Journal:  Mol Ecol       Date:  1997-02       Impact factor: 6.185

8.  Adaptive introgression of abiotic tolerance traits in the sunflower Helianthus annuus.

Authors:  Kenneth D Whitney; Rebecca A Randell; Loren H Rieseberg
Journal:  New Phytol       Date:  2010-03-19       Impact factor: 10.151

9.  Adaptive introgression of herbivore resistance traits in the weedy sunflower Helianthus annuus.

Authors:  Kenneth D Whitney; Rebecca A Randell; Loren H Rieseberg
Journal:  Am Nat       Date:  2006-04-28       Impact factor: 3.926

10.  Adaptation by introgression.

Authors:  Michael L Arnold; Noland H Martin
Journal:  J Biol       Date:  2009-10-13
View more
  9 in total

1.  Complete chloroplast genome of Ilex dabieshanensis: Genome structure, comparative analyses with three traditional Ilex tea species, and its phylogenetic relationships within the family Aquifoliaceae.

Authors:  Ting Zhou; Kun Ning; Zhenghai Mo; Fan Zhang; Yanwei Zhou; Xinran Chong; Donglin Zhang; Yousry A El-Kassaby; Jian Bian; Hong Chen
Journal:  PLoS One       Date:  2022-05-19       Impact factor: 3.752

2.  Molecular Evidence for Natural Hybridization between Cotoneaster dielsianus and C. glaucophyllus.

Authors:  Mingwan Li; Sufang Chen; Renchao Zhou; Qiang Fan; Feifei Li; Wenbo Liao
Journal:  Front Plant Sci       Date:  2017-05-09       Impact factor: 5.753

3.  Exceptionally high rates of positive selection on the rbcL gene in the genus Ilex (Aquifoliaceae).

Authors:  Xin Yao; Yun-Hong Tan; Jun-Bo Yang; Yan Wang; Richard T Corlett; Jean-François Manen
Journal:  BMC Evol Biol       Date:  2019-10-21       Impact factor: 3.260

4.  Molecular evidence of the hybrid origin of Cryptocoryne ×purpurea Ridl. nothovar. purpurea (Araceae).

Authors:  Rusly Rosazlina; Niels Jacobsen; Marian Ørgaard; Ahmad Sofiman Othman
Journal:  PLoS One       Date:  2021-01-21       Impact factor: 3.240

5.  Comparative analysis and phylogenetic investigation of Hong Kong Ilex chloroplast genomes.

Authors:  Bobby Lim-Ho Kong; Hyun-Seung Park; Tai-Wai David Lau; Zhixiu Lin; Tae-Jin Yang; Pang-Chui Shaw
Journal:  Sci Rep       Date:  2021-03-04       Impact factor: 4.379

6.  Molecular evidence for natural hybridization between Rumex crispus and R. obtusifolius (Polygonaceae) in Korea.

Authors:  Gauri Shankar Bhandari; Chong-Wook Park
Journal:  Sci Rep       Date:  2022-03-31       Impact factor: 4.379

7.  Comparative analysis of complete Ilex (Aquifoliaceae) chloroplast genomes: insights into evolutionary dynamics and phylogenetic relationships.

Authors:  Kewang Xu; Chenxue Lin; Shiou Yih Lee; Lingfeng Mao; Kaikai Meng
Journal:  BMC Genomics       Date:  2022-03-14       Impact factor: 3.969

8.  The chromosome-level holly (Ilex latifolia) genome reveals key enzymes in triterpenoid saponin biosynthesis and fruit color change.

Authors:  Ke-Wang Xu; Xue-Fen Wei; Chen-Xue Lin; Min Zhang; Qiang Zhang; Peng Zhou; Yan-Ming Fang; Jia-Yu Xue; Yi-Fan Duan
Journal:  Front Plant Sci       Date:  2022-08-22       Impact factor: 6.627

9.  Integral Phylogenomic Approach over Ilex L. Species from Southern South America.

Authors:  Jimena Cascales; Mariana Bracco; Mariana J Garberoglio; Lidia Poggio; Alexandra M Gottlieb
Journal:  Life (Basel)       Date:  2017-11-22
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.