Literature DB >> 26790152

1,25(OH)2D3 Deficiency Induces Colon Inflammation via Secretion of Senescence-Associated Inflammatory Cytokines.

Yun Liu1, Lulu Chen1, Chunchun Zhi1, Ming Shen2, Weiwei Sun1, Dengshun Miao1, Xiaoqin Yuan1.   

Abstract

Epidemiological studies showed that 1,25-Dihydroxyvitamin D[1,25(OH)2D3] insufficiency appears to be associated with aging and colon cancer while underlying biological mechanisms remain largely unknown. Inflammatory bowel disease is one of the risk factors for colon cancer. In this study, we investigated whether 1,25(OH)2D3 deficiency has an impact on the colon of 25-hydroxyvitamin D 1α-hydroxylase knockout [Cyp27b1(-/-)] mice fed on a rescue diet (high calcium, phosphate, and lactose) from weaning to 10 months of age. We found that 1,25(OH)2D3 deficient mice displayed significant colon inflammation phenotypes including shortened colon length, thinned and disordered mucosal structure, and inflammatory cell infiltration. DNA damage, cellular senescence and the production of senescence-associated inflammatory cytokines were also increased significantly in the colon of Cyp27b1(-/-)mice. Furthermore, the levels of ROS in the colon were increased significantly, whereas the expression levels of antioxidative genes were down-regulated dramatically in the colon of Cyp27b1(-/-)mice. Taken together, our results demonstrated that 1,25(OH)2D3 deficiency could induce colon inflammation, which may result from increased oxidative stress and DNA damage, subsequently, induced cell senescence and overproduction of senescence-associated secretory factors. Therefore, our findings suggest that 1,25(OH)2D3 may play an important role in preventing the development and progression of colon inflammation and colon cancer.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26790152      PMCID: PMC4720393          DOI: 10.1371/journal.pone.0146426

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Colorectal cancer is the third most commonly diagnosed cancer in USA and its incidence is higher in men than in women and significantly increases with age[1]; median age at diagnosis is about 70 years in developed countries[2]. Despite strong hereditary components, colonic inflammation is an important risk and progression factor of colon cancer. Chronic inflammation affects colon cancer development likely through the production of tumor-promoting cytokines, tumor cell invasive behavior, cellular proliferation and the promotion of angiogenesis[3]. Studies have shown that colorectal cancer is closely linked to diet and a so-called western lifestyle[4]. Vitamin D status of an individual is also influenced by both diet and lifestyle[5]. Epidemiological studies have consistently shown an inverse association between serum vitamin D concentrations and risk of colorectal cancer[6, 7]. Higher serum vitamin D levels also correlate with reduced risk for developing inflammatory diseases such as inflammatory bowel disease[8, 9]. A previous study has shown that Cyp27b1-/- mice were more susceptible to DSS-induced colitis with increased IL-1 and IL-17 cytokines[10]. Vitamin D receptor (VDR) deficiency resulted in severe inflammation of the gastrointestinal tract in IL-10 KO mice which spontaneous develops colitis[11]. Vitamin D is a prohormone that can be metabolically converted from 25-hydroxyvitamin D by the enzyme 1α-hydroxylase [1α(OH)ase, encoded by Cyp27b1, to the active form, 1,25-dihydroxyvitamin D3[1,25(OH)2D3][12, 13]. Besides its function in the physiological regulation of Ca2+ and Pi transport and bone mineralization[14], 1,25(OH)2D3 plays multiple biological activities by binding VDR, a high-affinity nuclear receptor that alters the transcription target genes[5]. During the past decade, there are a number of evidence indicating an association between low levels of vitamin D and age associated diseases such as cognitive decline[15], osteoporosis[16], osteoarthritis[17], cardiovascular disease[18], hypertension[19], diabetes[20], and cancer[21]. As persons age, the risk for vitamin D deficiency significantly increases. The percent of older adults suffering from vitamin D deficiency ranges from 20 to 100% in the United States[22]. This indicates that vitamin D may play an important role in diseases that was associated with aging. Our previous data showed that disruption of Cyp27b1 gene in mice induced premature aging associated with multiple defects such as growth retardation, osteoporosis, hypophosphatemia, skin atrophy, temporomandibular joint (TMJ) osteoarthritis(OA), etc[17, 23]. These ageing-like symptoms of Cyp27b1-/-mice were similar to that of Klotho deficient mice. Studies showed that Klotho, an anti-aging gene, is regulated by vitamin D[24] which also supports the concept that vitamin D may have a function in ageing process. It is generally accepted that cellular senescence is accompanied by a striking increase in the secretion of over 40 factors involved in intercellular signaling. This phenotype has been termed the “senescence-associated secretory phenotype”, or SASP[25]. SASP factors involving interleukins (IL-6, IL-8), growth factors (HGF), secreted proteases (MMP3) which turn senescent cells into pro-inflammatory cells can affect tissue microenvironments and stimulate tumor progression by promoting the proliferation and tumorigenesis of epithelial cells, stimulating angiogenesis, triggering an epithelial to mesenchymal transition, accelerating the invasion of transformed cells[26]. Cougnoux and his colleagues found that colibactin-producing E. coli enhanced colon tumor growth in both xenograft and AOM/DSS models by inducing the emergence of senescent cells secreting growth factors including HGF, FGF and GM-CSF, suggesting that SASP has a role in colon cancer development process[27]. We have previously shown that 1,25(OH)2D3 deficient (Cyp27b1-/-) mice fed with a “rescue” diet containing 2% calcium, 1.25% phosphorus, and 20% lactose to normalize the levels of serum calcium, phosphorus and parathyroid hormone(PTH), exhibited an erosive TMJ OA phenotype resulting from DNA damage, cellular senescence and production of senescence-associated inflammatory cytokines[17]. This suggests that 1,25(OH)2D3 deficiency could affect the disease progress by changing tissue microenviroment via inducing cellular senescence. In this study we investigated the influence of 1,25(OH)2D3 deficiency itself on colons by comparing the colon phenotype between Cyp27b1-/- mice and their wild-type littermates maintained on the rescue diet from weaning to 10 months of age. We found that Cyp27b1-/- mice developed colonic inflammation and that stromal cells of the lamina propria exhibited a senescence phenotype. The senescent cells accompanied by genotoxic damage led to SASP and some factors involved in SASP participated in the progression of colon cancer. These findings support the hypothesis that 1,25(OH)2D3 deficiency leads to colonic inflammation through secretion of senescence-associated inflammatory cytokines by senescent cells. These results implicate that insufficient 1,25(OH)2D3 may accelerate colon cancer progression by inducing colonic inflammation.

Materials and Methods

Mice and Genotyping

Cyp27b1-/- mice were generated through breeding of heterozygous mice. The genotype of the mice was confirmed by PCR using mouse tail samples as previously described[23]. Wild-type littermates were used as control in all experiments. Animals were maintained on a 12-hour light/12-hour dark cycle under pathogen-free conditions. Male Cyp27b1-/- and wild-type littermates of 8–10 months of age were used in this study. After weaning, they were fed with rescue diet (TD96348 Teklad, Madison, WI) containing 2% calcium, 1.25% phosphorus, and 20% lactose until 8–10 months old. We confirmed that serum calcium and phosphorus levels were normalized in the Cyp27b1-/- mice and the littermates fed with the rescue diet. Animal welfare and experimental procedures were approved by the Institutional Animal Care and Use Committee of Nanjing Medical University (Approval ID 20111201).Genotyping was performed by PCR analyses of genomic DNA isolated from mouse tails. Genotyping forward and reverse primer sets were: 5'-GAAGTCCCTCCTGACACAGAAACCT-3' and 5'-CTCATAGAGTGTCCAGGAGAGCGTA-3'(cyp27b1), and 5'-ACAACAGACAATCGGCTGCTC-3' and 5'-CTCATAGAGTGTCCAGGAGAGCGTA-3'(neo).

Tissue Collection and Analysis

Following euthanasia, full length of colon (from caecum to rectum) were removed and washed in PBS to remove fecal matter and then either: 1) fixed in 4% formalin and embedded in paraffin according to standard procedure and then paraffin-embedded tissues were cut 5 μm thick for HE staining and immunohistochemistry; 2) snap frozen in liquid nitrogen before RNA and protein extraction.

Measurements of Serum Calcium, Phosphorus and 1,25(OH)2D3

Before mice were sacrificed, serum was obtained by retroorbital bleeding from anesthetized mice. Serum calcium and phosphorus levels were analyzed by an autoanalyzer (Beckman Synchron 67; Beckman Instruments). Serum 1,25(OH)2D3 level was measured by radioimmunoassay (DiagnosticProducts, Los Angeles, CA).

Immunohistochemistry

Immunohistochemistry was performed on paraffin embedded colon tissues using specific antibodies (summarized in S1 Table). Dewaxed and rehydrated paraffin-embedded sections were incubated with methanol: hydrogen peroxide (1:10) to block endogenous peroxidase activity and then washed in Tris-buffered saline (pH 7.6). The slides were then incubated with the primary antibodies overnight at room temperature. After rinsing with Tris-buffered saline for 15 min, tissues were incubated with secondary antibody (biotinylated goat anti-rabbit IgG, Sigma). Sections were then washed and incubated with the Vectastain Elite ABC reagent (Vector Laboratories. Burlingame, CA) for 45 min. Staining was developed using 3, 3-diaminobenzidine (2.5 mg/ml) followed by counterstaining with Mayer's hematoxylin. 10 high-power fields (400× magnification) were randomly selected within each slide. Data are expressed as the average percentage of positive staining cells.

β-Galactosidase (β-Gal) Staining

Pre-embedding β-Gal staining was performed following a modified version of a previously described method[28, 29]. Briefly, fresh colon tissues were removed and washed in PBS to remove fecal matter. Then the tissues were fixed in fix solution (2% paraformaldehyde and 0.2% glutaraldehyde in PBS) for 30 min on ice with shaking. Following fix, tissues were washed three times for 30 min in wash buffer (2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet-P40 (NP-40) in PBS) and incubated at 37°C in fresh senescence associated β-Gal (SA-β-Gal) staining solution (0.5 mg/ml 5-bromo-4-chloro-3-indolyl β-D-galactoside (X-Gal), 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide in wash buffer) for 15hr with shaking and protection from light. After completion of staining, tissues were washed three times in PBS and embedded in paraffin according to standard procedure. Paraffin-embedded tissues were cut 5 μm thick and counterstained with nuclear fast red. 10 high-power fields (400× magnification) were randomly selected within each slide. Data are expressed as the average percentage of positive staining cells.

RNA Isolation and Real-Time RT-PCR

RNA was isolated from frozen colon tissue with TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Reverse transcription reactions were performed with the PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara Bio,Shiga, Japan).To determine the relative expression of genes of interest, real-time PCR was performed using SYBR green reagents in an ABI 7300 sequence detector (Applied Biosystems, Foster City, CA). The sequences of PCR primers used were listed in Table 1. GAPDH gene was used as the internal control. Efficiency of amplification for all primers was validated by determining the slope of CT versus dilution series.
Table 1

Specific primers used for Q-PCR.

GenesPrimersSequences (5′–3′)
IL-1αForwardCGGGAGGAGACGACTCTAAAT
ReverseCACGAACAGTTGTGAATCTGAGA
IL-1βForwardGAAATGCCACCTTTTGACAGTG
ReverseCTGGATGCTCTCATCAGGACA
IL-6ForwardCTGCAAGAGACTTCCATCCAG
ReverseAGTGGTATAGACAGGTCTGTTGG
MMP-3ForwardTTAAAGACAGGCACTTTTGGCG
ReverseCCCTCGTATAGCCCAGAACT
MMP-13ForwardTGTTTGCAGAGCACTACTTGAA
ReverseCCCCCGCATGAGCGAGAACACTGAC
CathepsinKForwardGAAGAAGACTCACCAGAAGCAG
ReverseTCCAGGTTATGGGCAGAGATT
IL-8ForwardCCAAGGAAAACTGGGTGCAGAG
ReverseGGCACAGGGGAACAAGGACT
HGFForwardATGTGGGGGACCAAACTTCTG
ReverseGGATGGCGACATGAAGCAG
SOD1ForwardATTACAGGATTAACTGAAGG
ReverseCAATGATGGAATGCTCTC
SOD2ForwardGACCTGCCTTACGACTATG
ReverseGAAGAGCGACCTGAGTTG
Prdx3ForwardGGTTGCTCGTCATGCAAGTG
ReverseCCACAGTATGTCTGTCAAACAGG
Txnrd1ForwardCCCACTTGCCCCAACTGTT
ReverseGGGAGTGTCTTGGAGGGAC
Catalase:ForwardAGCGACCAGATGAAGCAGTG
ReverseTCCGCTCTCTGTCAAAGTGTG
GCLForwardGGGGTGACGAGGTGGAGTA
ReverseGTTGGGGTTTGTCCTCTCCC
HO1ForwardAAGCCGAGAATGCTGAGTTCA
ReverseGCCGTGTAGATATGGTACAAGGA
NQO1ForwardAGGATGGGAGGTACTCGAATC
ReverseAGGCGTCCTTCCTTATATGCTA
Txn1ForwardCATGCCGACCTTCCAGTTTTA
ReverseTTTCCTTGTTAGCACCGGAGA
Nrf2ForwardTCTTGGAGTAAGTCGAGAAGTGT
ReverseGTTGAAACTGAGCGAAAAAGGC
KlothoForwardTGTTCTGCTGCGAGCTGTTAC
ReverseCCGGACTCACGTACTGTTTTT
GAPDHForwardTGGATTTGGACGCATTGGTC
ReverseTTTGCACTGGTACGTGTTGAT

Western Blot Analysis

Lysates from colon tissues were separated on SDS-PAGE, transferred to polyvinylidene fluoride (PVDF) membranes and blotted with primary antibodies (summarized in S2 Table), followed by appropriate secondary antibodies and chemiluminescent detection.

Intracellular ROS Analysis

For analysis of intracellular ROS, total colonic cells from 10-month-old mice were incubated with 5 mMdiacetyldichlorofluorescein (DCFDA) (Invitrogen) and placed in a shaker at 37°C for 30 min, followed immediately by flow cytometric analysis in a FACS calibur flow cytometer (BectonDickinson, Heidelberg, Germany)

Oxidative Stress Levels

Colon tissues from 10-month mice were homogenized in cold saline. Homogenate (10%) was centrifuged at 4000 rpm at 4°C for 10 min. Supernatant was used for measurements of hydrogen peroxide (H2O2)(A064 H2O2 detection kit) and total superoxide dismutase (T-SOD) (A001-1SOD detection kit) Detection kits were from Nanjing Jiancheng Bioengineering Institute in China. All examinations were performed according to the manufacturer’s instructions.

Statistical Analysis

All data are presented as Mean ± SEM. Student’s t test was used for comparisons. P < 0.05 was considered statistically significant.

Results

Effect of 1,25(OH)2D3 Deficiency on Serum Biochemistry

Cyp27b1 knockout mice (Cyp27b1-/-) were identified by genotyping with genomic DNA (Fig 1A) and Cyp27b1 mRNA expression levels were dramatically lower in Cyp27b1-/- mice than their wild-type littermates demonstrated by RT-qPCR (Fig 1B). In order to exclude possible effects of extracellular calcium and/or phosphorus and/or PTH, mice were fed on a rescue diet containing 2% calcium, 1.25% phosphorus, and 20% lactose from weaning to 10-month-old. We measured serum calcium and phosphorus levels and found no difference between WT and Cyp27b1-/- mice (Fig 1C and 1D) whereas serum 1,25(OH)2D3 levels were undetectable in 10-month-old Cyp27b1-/- mice (Fig 1E). Therefore, Cyp27b1-/- mice had normal serum calcium and phosphorus levels after fed on the rescue diet and an effect of Cyp27b1 knockdown on colon may only result from 1,25(OH)2D3 deficiency itself.
Fig 1

Effect of 1,25(OH)2D3 deficiency on serum biochemistry.

(A) Deletion efficiency of the Cyp27b1 allele was analyzed using genomic DNA from the tail. (B) Quantitative PCR assay for Cyp27b1 mRNA in colons. (C) Serum calcium, (D) serum phosphorus and (E) serum 1,25(OH)2D3 from 10-month-old Cyp27b1-/- and WT mice (n = 5; mean±SEM). **: p< 0.01.

Effect of 1,25(OH)2D3 deficiency on serum biochemistry.

(A) Deletion efficiency of the Cyp27b1 allele was analyzed using genomic DNA from the tail. (B) Quantitative PCR assay for Cyp27b1 mRNA in colons. (C) Serum calcium, (D) serum phosphorus and (E) serum 1,25(OH)2D3 from 10-month-old Cyp27b1-/- and WT mice (n = 5; mean±SEM). **: p< 0.01.

Effect of 1,25(OH)2D3 Deficiency on Colonic Inflammation

To investigate whether 1,25(OH)2D3 deficiency resulted in colonic inflammation, we compared body weight, colon length and colon histologic structure between WT and Cyp27b1-/- mice. Fig 2A showed that Cyp27b1-/-mice were significantly lighter than WT mice at all time points examined. Full colon length was shorter in Cyp27b1-/- mice (Fig 2B and 2C) and the ratio of colon length vs body weight was also decreased in Cyp27b1-/- mice (Fig 2D). Histologic results showed the thinner mucosa with disordered structure including crypt damage, decrease of goblet cells and submucosal edema in Cyp27b1-/- mice (Fig 2E). Immunohistochemical studies further demonstrated that Cyp27b1-/- mice had increased inflammatory cell infiltration compared with wild-type mice (Fig 2F and 2G, CD3+ T cells 26.25%versus 10.84%, P = 0.0105; F4/80+ cells: 32.82% versus 8.66%, P = 0.0176). These data suggest that 1,25(OH)2D3 deficiency lead to a colonic inflammation.
Fig 2

1,25(OH)2D3 deficiency induced chronic colonic inflammation.

(A) Body weight from 3 month, 6 month and 10 month mice of Cyp27b1-/- and WT. The full length of colon (B and C) and the ratio of length vs body weight (D) from WT and Cyp27b1-/- mice with 10 month age. Values are mean ± SEM, n = 8. *P < 0.05, * * P < 0.01. (E) HE staining of colon section from WT and Cyp27b1-/- mice. Magnification, ×200. Bar, 50μm. Immunohistochemical analyses of CD3 (F) and F4/80 (G) expression in colon tissues from the WT and Cyp27b1-/- mice at 10 month. Magnification, ×400. Bar, 25μm. The histogram shows the mean percentage of the CD3 or F4/80 positive cells determined from five randomly selected fields. Magnification, ×400. Bar, 25μm. Values are mean ± SEM, n = 5. *P < 0.05.

1,25(OH)2D3 deficiency induced chronic colonic inflammation.

(A) Body weight from 3 month, 6 month and 10 month mice of Cyp27b1-/- and WT. The full length of colon (B and C) and the ratio of length vs body weight (D) from WT and Cyp27b1-/- mice with 10 month age. Values are mean ± SEM, n = 8. *P < 0.05, * * P < 0.01. (E) HE staining of colon section from WT and Cyp27b1-/- mice. Magnification, ×200. Bar, 50μm. Immunohistochemical analyses of CD3 (F) and F4/80 (G) expression in colon tissues from the WT and Cyp27b1-/- mice at 10 month. Magnification, ×400. Bar, 25μm. The histogram shows the mean percentage of the CD3 or F4/80 positive cells determined from five randomly selected fields. Magnification, ×400. Bar, 25μm. Values are mean ± SEM, n = 5. *P < 0.05.

Effect of 1,25(OH)2D3 Deficiency on DNA Damage and Cellular Senescence

Our previous study has shown that 1,25(OH)2D3 deficient mice exhibited DNA damage and senesence in chondrocytes and osteoblasts[17]. In order to investigate whether this situation occurred in colon tissue, the DNA damage markers 8-hydroxyguanosine(8-OHdG) and γ-H2AX, were examined by immunohistochemical staining in paraffin sections of colon tissue from 10-month-old Cyp27b1-/- and their wild-type littermates. β-Gal staining were also performed for checking SA-β-gal, the marker of cellular senescence. Results revealed that the percentages of 8-OHdG, γ-H2AX and SA-β-gal positive cells were increased significantly in Cyp27b1-/- mice compared with wild-type mice (Fig 3A–3C). These positive cells were both localized in crypt and lamina propria. These observations imply that 1,25(OH)2D3 deficiency may induce DNA damage and cellular senescence of colonic epithelial and stromal cells.
Fig 3

1,25(OH)2D3 deficiency induced DNA damage and cellular senescence.

Immunohistochemical analyses of 8-OHdG (A) γH2AX (B) expression and analysis of SA-β-gal positive cells (C) in the colon from the WT and Cyp27b1-/- mice. The positive cells in lamina proppria are marked by arrow. The histogram shows the mean percentage of the 8-OHdG or γH2AX, SA-β-gal positive cells determined from five randomly selected fields. Magnification, ×400. Bar, 25μm. Values are mean ± SEM, n = 5. *P < 0.05. (D): Western blot analyses of colonic γH2AX expression in the WT and Cyp27b1-/- mice, β-actin was used as a loading control.

1,25(OH)2D3 deficiency induced DNA damage and cellular senescence.

Immunohistochemical analyses of 8-OHdG (A) γH2AX (B) expression and analysis of SA-β-gal positive cells (C) in the colon from the WT and Cyp27b1-/- mice. The positive cells in lamina proppria are marked by arrow. The histogram shows the mean percentage of the 8-OHdG or γH2AX, SA-β-gal positive cells determined from five randomly selected fields. Magnification, ×400. Bar, 25μm. Values are mean ± SEM, n = 5. *P < 0.05. (D): Western blot analyses of colonic γH2AX expression in the WT and Cyp27b1-/- mice, β-actin was used as a loading control.

Effect of 1,25(OH)2D3 Deficiency on the Production of Senescence-Associated Inflammatory Cytokine

Since senescent cells with persistent DNA damage secrete senescence-associated inflammatory cytokines, we sought to investigate whether these cytokines were secreted in 1,25(OH)2D3 deficiency mice. As shown in Fig 4F, the gene expression levels of IL-1α, IL-1β, IL-6, IL-8, HGF1,MMP-3 and MMP13 were all up-regulated significantly in colon from Cyp27b1-/- mice when compared with the wild-type mice. Immunohistochemical staining showed that there were significantly more IL-1α, IL-6, IL-8, HGF1, MMP-3 positive cells observed in colon sections of the Cyp27b1-/- mice than those of wild-type mice (Fig 4A–4E).Since nuclear factor-κB (NF-κB) was found to be a master regulator of SASP[30]. We further measured the expression of NF-κB-p105/p50 by immunoblotting and found that NF-κB-p105/p50 expression levels in colon were up-regulated in Cyp27b1-/- mice relative to WT mice (Fig 4G).These observations implicate that 1,25(OH)2D3 deficiency-induced colonic inflammation may result from overproduction of senescence-associated inflammatory cytokines.
Fig 4

1,25(OH)2D3 deficiency induced the genes expression of the senescence-associated inflammatory cytokines.

Immunohistochemical analyses of IL-1ɑ (A) IL-6 (B) IL-8 (C) HGF1 (D) MMP3 (E) expressions in the colon from the WT and Cyp27b1-/- mice. Positive cells in lamina propria were labeled by arrow. The histogram shows the mean percentage of the positive area determined from five randomly selected fields. Magnification, ×400. Bar, 25μm. Values are mean ± SEM, n = 5. *P < 0.05, ** P < 0.01. (F) Real-time RT-PCR was performed on extracts of colon from WT and Cyp27b1-/- mice for the gene expression of IL-1α, IL-1β, IL-6, IL-8, HGF1, MMP-3 and MMP-13. (G) Western blot analyses of colonic NF-κB (p105 and p50) expression in the WT and Cyp27b1-/- mice, β-actin was used as a loading control.

1,25(OH)2D3 deficiency induced the genes expression of the senescence-associated inflammatory cytokines.

Immunohistochemical analyses of IL-1ɑ (A) IL-6 (B) IL-8 (C) HGF1 (D) MMP3 (E) expressions in the colon from the WT and Cyp27b1-/- mice. Positive cells in lamina propria were labeled by arrow. The histogram shows the mean percentage of the positive area determined from five randomly selected fields. Magnification, ×400. Bar, 25μm. Values are mean ± SEM, n = 5. *P < 0.05, ** P < 0.01. (F) Real-time RT-PCR was performed on extracts of colon from WT and Cyp27b1-/- mice for the gene expression of IL-1α, IL-1β, IL-6, IL-8, HGF1, MMP-3 and MMP-13. (G) Western blot analyses of colonic NF-κB (p105 and p50) expression in the WT and Cyp27b1-/- mice, β-actin was used as a loading control.

Effect of 1,25(OH)2D3 Deficiency on Redox Balance

Imbalances between ROS and antioxidants can lead to oxidative stress that induces DNA damage response. Increased ROS and H2O2 levels were observed in colon tissue from Cyp27b1-/- mice compared to wild-type mice (Fig 5A and 5B).We also measured the important antioxidant of SOD and found the total colonic SOD in Cyp27b1-/- mice was decreased (Fig 5C). Then, we checked the levels of other antioxidants and found that the expression levels of antioxidant genes including SOD1, SOD2, GPX1, GSR, Txnrd1, GCL, Prdx3, HO1, catalase and NQO1 and of SOD2 and Prdx2 proteins were all down-regulated significantly in Cyp27b1-/- mice (Fig 5D and 5E). Nrf2, which is a redox-sensitive transcription factor that activates many genes that encode antioxidant and detoxifying enzymes, was also down-regulated dramatically in Cyp27b1-/- mice (Fig 5D). These data indicate that 1,25(OH)2D3 appears to function as an antioxidant to remove ROS and maintain intracellular redox balance.
Fig 5

1,25(OH)2D3 deficiency induced the ROS production and decreased antioxidants.

(A) Flow cytometry analysis of ROS in colons from the three groups of 10-month-old mice. (B) H2O2 and (C) Total SOD level of colons measured by spectrophotometry. (D)Real-time RT-PCR was performed on extracts of colon from WT and Cyp27b1-/- mice for the gene expression of antioxidants. (E) Western blot analyses of colonic SOD2 and Prdx2 expression in the WT and Cyp27b1-/- mice, β-actin was used as a loading control.

1,25(OH)2D3 deficiency induced the ROS production and decreased antioxidants.

(A) Flow cytometry analysis of ROS in colons from the three groups of 10-month-old mice. (B) H2O2 and (C) Total SOD level of colons measured by spectrophotometry. (D)Real-time RT-PCR was performed on extracts of colon from WT and Cyp27b1-/- mice for the gene expression of antioxidants. (E) Western blot analyses of colonic SOD2 and Prdx2 expression in the WT and Cyp27b1-/- mice, β-actin was used as a loading control.

Discussion

A strong association between low level vitamin D and high risk of colon cancer and colonic inflammatory disease has been found in various epidemiological studies[1, 18, 20]. Animal studies have demonstrated that 1,25(OH)2D3 supplement could reduce cancer incidence in several rodent models of colon cancer[31-33] including Cyp27b1 knockout mice[10] which could develop severe colitis induced with DSS. It has been demonstrated that vitamin D has an anti-cancer effect in colon cancer; however, the underlying mechanism is still unclear. One of important mechanisms by which 1,25(OH)2D3 exerts its anti-neoplastic activity is to interfere with Wnt/β-catenin signaling[34, 35] which was abnormally activated in 93% of colon cancer[36]. Studies indicated that Wnt/β-catenin signaling was often influenced by inflammatory factors such as IL-1β and HGF[37, 38]. The other mechanism is to inhibit inflammation. Vitamin D supplementation has been linked to decreased circulating proinflammatory cytokines in patients with colorectal adenomas[39]. Meeker and his colleagues found that dietary vitamin D supplementation had a preventive effect on inflammation-associated colon cancer by lowering inflammatory cytokines induced in response to Hb in Smad3-/- mice[33]. These suggest that 1,25(OH)2D3 might exert cancer preventive activity by interrupting the link between inflammation and cancer. Liu and his colleague had showed that 1,25(OH)2D3 deficient mice developed DSS-induced colitis[20]. In the present study, we discovered that Cyp27b1-/- mice, fed on the rescue diet to normalize the serum levels of calcium and phosphorus, automatically underwent chronic colonic inflammation leading to weight loss, shortened colon length and inflammatory cell infiltration. These suggest that 1,25(OH)2D3 may act to protect against the onset of colitis. Besides its role in anti-tumorigenesis, 1,25(OH)2D3 also has an anti-aging effect. Previous studies have shown that Cyp27b1-/- mice displayed premature aging including growth retardation, osteoporosis, TMJ-OA, etc[23, 40]. This phenotype was thought to result from DNA damage induced senescence. Consistently, our current study also demonstrated that DNA damage markers 8-OHdG and γ-H2AX, and cellular senescence marker SA-β-gal were increased, suggesting that 1,25(OH)2D3 deficiency may result in increased DNA damage and senescence of colonic cells. Low serum vitamin D levels have been associated with an elevation in levels of 8-OHdG, a marker of oxidative DNA damage[41].1,25(OH)2D3 reduces the level of γ-H2AX and ATM activation after induction of DNA damage by H2O2 or by N-nitroso-NFigmethylurea[42, 43]. Our finding of increased 8-OHdG and γ-H2AX in colon of Cyp27b1-/- mice further supports the notion that 1,25(OH)2D3 deficiency may induce oxidative stress to cause DNA damage ultimately leading to the senescence phenotype of the colonic cells. Oxidative stress could induce DNA damage. 1,25(OH)2D3 has been reported to function as anti-oxidant. Treatment of several cell lines with 1,25(OH)2D3 has been shown to induce enzymes involved in protection against oxidative damage such as thioredoxin reductase1 (TXNRD1), the enzyme which maintains thioredoxin in the reduced state and limits intracellular oxidant stress[44]. 1,25(OH)2D3 was also observed to attenuate H2O2‐induced increase of γH2AX in lymphocytes[43]. Consistent with previous studies, our results showed that increased oxidative stress including higher levels of intracellular ROS and H2O2 in Cyp27b1-deficient colons which may result from down-regulation of some endogenous antioxidant genes, including SOD1, SOD2, Gpx1,GSR, Prdx3 and catalase. Interestingly, we also observed that expression of two anti-oxidants, Nrf2 and Klotho, was down-regulated significantly at mRNA level. Nrf2, nuclear factor erythroid 2-related factor 2, is a redox-sensitive transcription factor that activates many genes encoding antioxidant and detoxifying enzymes such as SOD1, SOD2, catalase, glutamate cysteine ligase (GCL), haemoxygenase 1 (HO1), NAD(P)H quinone oxidase 1 (NQO1), and peroxyredoxins (Prdx)[45]. Klotho, an anti-aging gene, was revealed to significantly enhance the expression of the thioredoxin/peroxiredoxin (Trx/Prx) system with the greatest effect on the induction of Prx-2 that acts to reduce ROS[46]. Klotho mutant mice (C3H) with a severe decline in cognition were also discovered to be associated with an increase in oxidative stress[40]. Coincidently, several studies have shown that expression of Nrf2 and Klotho was both regulated by 1,25(OH)2D3[24, 47–49], suggesting that 1,25(OH)2D3 acting in conjunction with Klotho and Nrf2 regulates expression of many of the antioxidant systems that prevent oxidative stress by removing ROS. Our data indicate that 1,25(OH)2D3 deficiency induced the increase in ROS formation may result from the reduction of antioxidant gene expression by down-regulating Nrf2 and Klotho. We observed that DNA damage induced cell senescence as evidenced by increased SA-β-gal in Cyp27b1 deficient colon. The higher levels of SA-β-gal in colon of Cyp27b1-/- mice suggest that this type of persistent DNA damage may accelerate the senescence process. Senescent cells with persistent DNA damage were accompanied by a striking increase in the secretion of more than 40 factors including a variety of proinflammatory cytokines (most notably IL-1ɑ, IL-1β, IL-6, and IL-8), chemokines (chemoattractants and macrophage inflammatoryproteins), growth factors (HGF, TGFβ, GM-CSF) and matrix-remodeling enzymes influencing their environment. This phenotype has been termed the “senescence-associated secretory phenotype”, or SASP[50]. As expected, we found that the gene expression levels of IL-1α, IL-1β, IL-6, IL-8, HGF1, MMP-3 and MMP-13 and the percentage of those factors positively stained cells were all increased significantly in colon from Cyp27b1-/- mice compared to their wild-type littermates. We also found that NF-κB signaling was activated in Cyp27b1-/- mice, which is consistent with a previous study showing that NF-κB signaling is the major signaling pathway for transcriptional regulation of SASP[51]. Many SASP factors were shown to have oncogenic properties, mostly by affecting the tumor microenvironment. For instances, irradiation of stromal cells could affect the invasive phenotype of pancreatic cancer through secreting HGF and other growth factors to modify tumor-stromal interactions[52]. IL‑6 and IL‑8 that are secreted from senescent cells could promote tumorigenesis in premalignant cells[25, 53]. IL-1was generated following activation of the inflammasome in senescent cells. IL-1ɑ is a key mediator of SASP activation and can control activation of IL-6 and IL-8[54]. MMP3 could promote tumorigenesis in neighboring premalignant epithelial cells through paracrine effects[55]. In summary, our current study demonstrated that 1,25(OH)2D3 deficient mice display a chronic inflammation in colon tissue, which may result from increased oxidative stress and DNA damage, and subsequently, induced cell senescence and overproduction of senescence-associated secretory factors including some pro-inflammatory factors and matrix metalloproteinases. Therefore, the findings from this study disclose a potential mechanism of 1,25(OH)2D3 in protection against colitis and colon cancer.

Primary antibodies used in Immunohistochemistry.

(DOC) Click here for additional data file.

Primary antibodies used in Western Blotting.

(DOC) Click here for additional data file.
  55 in total

1.  Z/AP, a double reporter for cre-mediated recombination.

Authors:  C G Lobe; K E Koop; W Kreppner; H Lomeli; M Gertsenstein; A Nagy
Journal:  Dev Biol       Date:  1999-04-15       Impact factor: 3.582

2.  The nutritional status of astronauts is altered after long-term space flight aboard the International Space Station.

Authors:  Scott M Smith; Sara R Zwart; Gladys Block; Barbara L Rice; Janis E Davis-Street
Journal:  J Nutr       Date:  2005-03       Impact factor: 4.798

3.  Bacterial genotoxin colibactin promotes colon tumour growth by inducing a senescence-associated secretory phenotype.

Authors:  Antony Cougnoux; Guillaume Dalmasso; Ruben Martinez; Emmanuel Buc; Julien Delmas; Lucie Gibold; Pierre Sauvanet; Claude Darcha; Pierre Déchelotte; Mathilde Bonnet; Denis Pezet; Harald Wodrich; Arlette Darfeuille-Michaud; Richard Bonnet
Journal:  Gut       Date:  2014-03-21       Impact factor: 23.059

4.  The selenoprotein thioredoxin reductase is expressed in peripheral blood monocytes and THP1 human myeloid leukemia cells--regulation by 1,25-dihydroxyvitamin D3 and selenite.

Authors:  N Schütze; J Fritsche; R Ebert-Dümig; D Schneider; J Köhrle; R Andreesen; M Kreutz; F Jakob
Journal:  Biofactors       Date:  1999       Impact factor: 6.113

5.  Targeted ablation of the 25-hydroxyvitamin D 1alpha -hydroxylase enzyme: evidence for skeletal, reproductive, and immune dysfunction.

Authors:  D K Panda; D Miao; M L Tremblay; J Sirois; R Farookhi; G N Hendy; D Goltzman
Journal:  Proc Natl Acad Sci U S A       Date:  2001-06-19       Impact factor: 11.205

6.  Stromal-epithelial interactions in aging and cancer: senescent fibroblasts alter epithelial cell differentiation.

Authors:  Simona Parrinello; Jean-Philippe Coppe; Ana Krtolica; Judith Campisi
Journal:  J Cell Sci       Date:  2005-01-18       Impact factor: 5.285

7.  A biomarker that identifies senescent human cells in culture and in aging skin in vivo.

Authors:  G P Dimri; X Lee; G Basile; M Acosta; G Scott; C Roskelley; E E Medrano; M Linskens; I Rubelj; O Pereira-Smith
Journal:  Proc Natl Acad Sci U S A       Date:  1995-09-26       Impact factor: 11.205

8.  Chemoprevention of chemically-induced mammary and colon carcinogenesis by 1alpha-hydroxyvitamin D5.

Authors:  Genoveva Murillo; Rajendra G Mehta
Journal:  J Steroid Biochem Mol Biol       Date:  2005-07-26       Impact factor: 4.292

Review 9.  Vitamin D and bone health.

Authors:  M F Holick
Journal:  J Nutr       Date:  1996-04       Impact factor: 4.798

10.  Vitamin D(3) promotes the differentiation of colon carcinoma cells by the induction of E-cadherin and the inhibition of beta-catenin signaling.

Authors:  H G Pálmer; J M González-Sancho; J Espada; M T Berciano; I Puig; J Baulida; M Quintanilla; A Cano; A G de Herreros; M Lafarga; A Muñoz
Journal:  J Cell Biol       Date:  2001-07-23       Impact factor: 10.539

View more
  11 in total

Review 1.  Senescence: Pathogenic Driver in Chronic Obstructive Pulmonary Disease.

Authors:  Melissa Rivas; Gayatri Gupta; Louis Costanzo; Huma Ahmed; Anne E Wyman; Patrick Geraghty
Journal:  Medicina (Kaunas)       Date:  2022-06-17       Impact factor: 2.948

2.  1, 25-dihydroxy-vitamin D3 with tumor necrosis factor-alpha protects against rheumatoid arthritis by promoting p53 acetylation-mediated apoptosis via Sirt1 in synoviocytes.

Authors:  Xin Gu; Bingjie Gu; Xianhui Lv; Zhenzhen Yu; Rong Wang; Xiaoli Zhou; Wanxin Qiao; Zhiyuan Mao; Guoping Zuo; Qing Li; Dengshun Miao; Jianliang Jin
Journal:  Cell Death Dis       Date:  2016-10-20       Impact factor: 8.469

3.  Vitamin D deficiency in the ApcPirc/+ rat does not exacerbate colonic tumorigenesis, while low dietary calcium might be protective.

Authors:  Amy A Irving; Elizabeth G Duchow; Lori A Plum; Hector F DeLuca
Journal:  Dis Model Mech       Date:  2018-03-07       Impact factor: 5.758

4.  1,25(OH)2D3 deficiency-induced gut microbial dysbiosis degrades the colonic mucus barrier in Cyp27b1 knockout mouse model.

Authors:  Wenjing Zhu; Jiayao Yan; Chunchun Zhi; Qianwen Zhou; Xiaoqin Yuan
Journal:  Gut Pathog       Date:  2019-02-20       Impact factor: 4.181

5.  Hypovitaminosis Din Postherpetic Neuralgia-High Prevalence and Inverse Association with Pain: A Retrospective Study.

Authors:  Jen-Yin Chen; Yao-Tsung Lin; Li-Kai Wang; Kuo-Chuan Hung; Kuo-Mao Lan; Chung-Han Ho; Chia-Yu Chang
Journal:  Nutrients       Date:  2019-11-15       Impact factor: 5.717

Review 6.  Effects of Vitamin D Supplementation on Inflammation, Colonic Cell Kinetics, and Microbiota in Colitis: A Review.

Authors:  Patricia Mae Garcia; Jeff Moore; David Kahan; Mee Young Hong
Journal:  Molecules       Date:  2020-05-14       Impact factor: 4.411

7.  Probing the Scope and Mechanisms of Calcitriol Actions Using Genetically Modified Mouse Models.

Authors:  Dengshun Miao; David Goltzman
Journal:  JBMR Plus       Date:  2020-12-05

8.  Seasonal Variation in Vitamin D in Association with Age, Inflammatory Cytokines, Anthropometric Parameters, and Lifestyle Factors in Older Adults.

Authors:  Leticia Elizondo-Montemayor; Elena C Castillo; Carlos Rodríguez-López; José R Villarreal-Calderón; Merit Gómez-Carmona; Sofia Tenorio-Martínez; Bianca Nieblas; Gerardo García-Rivas
Journal:  Mediators Inflamm       Date:  2017-09-14       Impact factor: 4.711

9.  The TNF-α antagonist etanercept reverses age-related decreases in colonic SERT expression and faecal output in mice.

Authors:  Bhavik Anil Patel; Sara Fidalgo; Chunfang Wang; Leena Parmar; Kasonde Mandona; Annabelle Panossian; Melanie S Flint; Richard N Ranson; M Jill Saffrey; Mark S Yeoman
Journal:  Sci Rep       Date:  2017-02-15       Impact factor: 4.379

10.  Insulin resistance in vitamin D-deficient mice is alleviated by n-acetylcysteine.

Authors:  Zhao-Hui Cui; Qi Yuan; Li Mao; Feng-Li Chen; Feng Ji; Sha Tao
Journal:  Oncotarget       Date:  2017-06-28
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.