Przemysław Sitarek1, Ewa Skała1, Halina Wysokińska1, Marzena Wielanek2, Janusz Szemraj3, Monika Toma4, Tomasz Śliwiński4. 1. Department of Biology and Pharmaceutical Botany, Medical University of Łódź, Muszyńskiego 1, 90-151 Łódź, Poland. 2. Department of Plant Physiology and Biochemistry, Faculty of Biology and Environmental Protection, University of Łódź, Banacha 12/16, 90-237 Łódź, Poland. 3. Department of Medical Biochemistry, Medical University of Łódź, Mazowiecka 6/8, 92-215 Łódź, Poland. 4. Department of Molecular Genetics, University of Łódź, Pomorska 141/143, 90-236 Łódź, Poland.
Abstract
Leonurus sibiricus L. has been used as a traditional and medicinal herb for many years in Asia and Europe. This species is known to have antibacterial, anti-inflammatory, and antioxidant activity and has demonstrated a reduction of intracellular reactive oxygen species. All tested extracts of L. sibiricus showed protective and DNA repair stimulating effects in Chinese hamster ovary (CHO) cells exposed to H2O2. Preincubation of the CHO cells with 0.5 mg/mL of plant extracts showed increased expression level of antioxidant genes (SOD2, CAT, and GPx). LC-MS/MS and HPLC analyses revealed the presence of nine phenolic compounds in L. sibiricus plant extracts: catechin, verbascoside, two flavonoids (quercetin and rutin), and five phenolic acids (4-hydroxybenzoic acid, chlorogenic acid, caffeic acid, p-coumaric acid, and ferulic acid). The roots and aerial parts of in vitro L. sibiricus plant extracts, which had the strongest antioxidant properties, may be responsible for stimulating CHO cells to repair oxidatively induced DNA damage, as well as protecting DNA via enhanced activation of the antioxidant genes (SOD2, CAT, and GPx) regulating intracellular antioxidant capacity. The content of phenolic compounds in in vitro raised plants was greater than the levels found in plants propagated from seeds.
Leonurus sibiricus L. has been used as a traditional and medicinal herb for many years in Asia and Europe. This species is known to have antibacterial, anti-inflammatory, and antioxidant activity and has demonstrated a reduction of intracellular reactive oxygen species. All tested extracts of L. sibiricus showed protective and DNA repair stimulating effects in Chinese hamster ovary (CHO) cells exposed to H2O2. Preincubation of the CHO cells with 0.5 mg/mL of plant extracts showed increased expression level of antioxidant genes (SOD2, CAT, and GPx). LC-MS/MS and HPLC analyses revealed the presence of nine phenolic compounds in L. sibiricus plant extracts: catechin, verbascoside, two flavonoids (quercetin and rutin), and five phenolic acids (4-hydroxybenzoic acid, chlorogenic acid, caffeic acid, p-coumaric acid, and ferulic acid). The roots and aerial parts of in vitro L. sibiricus plant extracts, which had the strongest antioxidant properties, may be responsible for stimulating CHO cells to repair oxidatively induced DNA damage, as well as protecting DNA via enhanced activation of the antioxidant genes (SOD2, CAT, and GPx) regulating intracellular antioxidant capacity. The content of phenolic compounds in in vitro raised plants was greater than the levels found in plants propagated from seeds.
Leonurus sibiricus L., commonly known as “Chinese Motherwort,” is a species valued for its medicinal properties, belonging to the family Lamiaceae. The plant naturally grows in Japan, Korea, China, Vietnam, and southern Siberia [1, 2]. The aerial parts of L. sibiricus collected during the flowering stage are the raw materials [2] and have been used for the treatment of menstrual irregularities, amenorrhea, malaria, hypertension, and myocardial ischemia [3]. This species is also known to have antibacterial, anti-inflammatory, and antioxidant activity [4-7] and has demonstrated a reduction of intracellular reactive oxygen species [7, 8]. The medicinal properties are attributed mainly to the presence of phenolic acids (e.g., chlorogenic acid, ferulic acid, and caffeic acid), iridoid and phenylpropanoid glycosides (e.g., leonoside A, leonoside E, verbascoside), flavonoids (e.g., wogonin, quercetin, and hyperoside), alkaloids (e.g., leonurine and stachydrine), and labdanediterpenoids (e.g., leosibirone A and leosibirone B) [1, 9]. The aim of this study was to evaluate the antioxidative and DNA repair stimulating abilities of aqueous methanol extracts from the aerial part and roots of in vitro raised plants grown under greenhouse conditions (harvested at flowering stage) against H2O2-induced oxidative DNA damage in CHO cells, using comet assay. These properties were compared with those of extracts from seed-derived plants of L. sibiricus (in vivo plants) which were at the same developmental stages and grown under identical conditions as in vitro derived plants. The study also evaluates the expression of three antioxidant genes encoding superoxide dismutase (SOD2), catalase (CAT), and glutathione peroxidase (GPx) in CHO cells using RT-PCR. LC-MS/MS and HPLC methods were used to investigate the production of phenolic compounds (phenolic acids, flavonoids, and phenylethanoid glycoside) in the aerial part and roots of the L. sibiricus plants.
2. Materials and Methods
2.1. Establishment of L. sibiricus Plants
In vitro L. sibiricus plants were initiated from shoot tips of 5-week-old in vitro cultured shoots. Explants of about 1 cm in length were placed on Murashige and Skoog (MS) [10] agar (0.7%) medium supplemented with 0.1 mg/L indole-3-acetic acid (IAA) and 0.5 mg/L 6-benzylaminopurine (BAP) and subcultured every 5 weeks for 6 successive passages. For rooting, 5-week-old shoots longer than 1 cm were excised from shoot cultures and transferred individually into MS agar medium supplemented with 0.5 mg/L IAA. The cultures were maintained under a photoperiod of 16 h light (at 40 μmol m−2 s−1) at 26°C ± 2°C in a culture room. After 5 weeks, the rooted shoots were transferred into pots (10 cm diameter) containing a sterilized mixture of soil, sand, and peat (4 : 3 : 3 v/v/v) and kept in a greenhouse for 6 months. L. sibiricus plants obtained from seeds from the same source as those used for shoot culture initiation were also grown in greenhouse for 6 months. The botanical identity of plants was confirmed by Skała according to the Flora of China (http://www.efloras.org/). A voucher specimen was deposited at the Department of Biology and Pharmaceutical Botany, Medical University of Łódź, Poland. All plants were harvested at the flowering stage.
2.2. Plant Materials and Extract Preparation
In this study, four different extracts, two from the aerial parts and roots of plants obtained in vitro (AP and R in vitro plants, resp.) and two from the aerial parts and roots of plant obtained from seeds (AP and R in vivo plants, resp.) grown in the greenhouse for 6 months were used. The lyophilized and powdered plant materials (about 10 g dry weight, each) were extracted for 15 minutes with 80% (v/v) aqueous methanol (500 mL) at 35°C using an ultrasonic bath and then twice with 300 mL of the same solvent for 15 min. The extracts were filtered, combined, and evaporated under reduced pressure and then were lyophilized to dryness and kept dry in the dark until further use. The yields (w/w) of extracts were 47.3% and 52.1% for AP and R for in vitro plants, respectively, and 46.8% and 49.7% for AP and R for in vivo plants, respectively, in terms of initial crude plant material dry weight.
2.3. Cell Culture Assays in Chinese Hamster Ovary Cells
Chinese hamster ovary (CHO) cells were obtained from the American Type Culture Collection (Manassas, VA, USA). CHO cells were grown in Ham F10 medium supplemented with 10% fetal bovine serum, 100 IU/mL penicillin, 100 IU/mL streptomycin, and 2 mM L-glutamine in a 5% CO2 humidified atmosphere at 37°C. All experiments were performed by seeding 4 × 105 cells per 25 cm2 flask. Under these conditions, the cell cycle of this line was approximately 12 h.
2.4. MTT Cytotoxicity Assay of L. sibiricus Extracts
The MTT [3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide] cytotoxicity assay was carried out according to Mosmann [11] with some modifications. Approximately 1 × 104 CHO cells were added to each well of a culture microplate. The cells were exposed to AP, R in vitro plant and AP, R in vivo plant extracts for 24 h. At the end of this period, the cells were incubated with MTT (5 mg/mL) for 4 h. The plates were read in a microplate spectrophotometer (OMEGA) at 550 nm. The IC50 values were determined from a dose-response curve based on different extract concentrations (0–6.25 mg/mL). Analyses were performed in triplicate for each concentration.
2.5. DNA Damage and Repair and the Protective Effects of In Vitro and In Vivo Plant Extracts
To assess DNA damage, CHO cells were incubated for 15 min on ice with hydrogen peroxide (H2O2) at a final concentration of 75 μM (positive control). To assess the effectiveness of DNA repair in the CHO cell line, both untreated cells and those exposed to H2O2 were washed in fresh RPMI 1640 medium (Sigma-Aldrich, Germany/USA), preheated to 37°C, and then various concentrations of AR, R in vitro plant and AR, R in vivo plant extracts of L. sibiricus (0.05, 0.1, or 0.5 mg/mL) were added. PBS was the solvent used in in vitro assays as negative control. The samples were centrifuged at 3000 rpm for 10 minutes and washed with PBS. Cells from suspension were taken from suspension and used for testing either immediately or then after 15, 30, 60, and or 120 min. To evaluate the protective effect of the extracts against oxidative DNA damage, CHO cells were preincubated for 15, 30, 60, and 120 min at 37°C, with lyophilized aqueous methanolL. sibiricus plant extracts (AP, R in vitro plant and AP, R in vivo plant extracts) dissolved in PBS and added to the culture medium. The concentrations of plant extracts were 0.05, 0.1, and 0.5 mg/mL. The cells were washed with PBS and treated with H2O2 (75 μM) for 15 min on ice. DNA damage was evaluated by comet assay.
2.6. Comet Assay
The alkaline comet assay was performed as described by Cornetta et al. [12] with minor modifications. Exponentially growing CHO cells were treated for 15–120 min with different concentrations (0.05, 0.1, or 0.5 mg/mL) of the AP, R in vitro plant or AP, R in vivo plant extracts of L. sibiricus. The comet assay was carried out under alkaline conditions: CHO cells were suspended in Low Melting Point (LMP) agarose 0.75% in PBS (Ca- and Mg-free) and spread on microscope slides precoated with 0.5% of normal agarose. The slides were then put in a tank filled with lysis solution (2.5 M NaCl, 0.1 M EDTA, 10 mM Tris, and 1% Triton X-100, pH 10) for 1 h at 4°C and incubated in electrophoresis buffer (0.3 M NaOH and 1 mM EDTA, pH 13) for 30 min to allow unwinding of DNA. Electrophoresis was carried out at 4°C (the temperature of the running buffer did not exceed 12°C) for 25 min at 0.75 V/cm (28 mA). After electrophoresis, the slides were washed in neutralization buffer (0.4 M Tris, pH 7.5), dried, stained with 2 μg/mL DAPI, and covered with a cover slip. To prevent additional DNA damage, all the steps described above were conducted under dimmed light or in the dark. The preparations were observed under 200x magnification. Images of comets for analysis were obtained using a COHU 4910 camera (Cohu, Inc., USA) equipped with a UV-1 filter block comprising an excitation filter (359 nm) and barrier filter (461 nm) connected to a fluorescent microscope (Nikon, Japan). The slides were scored using a Lucia-Comet v. 4.51 PC-based image analysis system (Laboratory Imaging, Czech Republic). Tail DNA was used to quantify the induced DNA damage, which is a measure of the percentage of migrated DNA in the tail [13].
2.7. Expression of SOD2, CAT, and GPx Genes
2.7.1. Treatment of CHO Cells
The experiment was performed by treating CHO cells with 75 μM of H2O2 for 15 min on ice. CHO cells were treated with the four L. sibiricus plant extracts (AP and R in vitro and AP, R in vivo plants) at 0.5 mg/mL to a final concentration of <0.1% PBS in the culture medium for 0 and 24 h. The control cells (negative control) were incubated for 0 and 24 hours with the same final amount of 0.1% PBS in the culture medium. After incubation, the cells were harvested and RT-PCR (reverse transcriptase PCR) was used to evaluate the expression of three antioxidant genes: superoxide dismutase, SOD2; catalase, CAT; and glutathione peroxidase, GPx.
2.7.2. RNA Isolation and RT-PCR (Reverse Transcription)
An RNA isolation kit (Blirt, Poland) was used to extract total RNA from treated and untreated CHO cells. The purity and concentration of the isolated RNA were determined by reading the absorption at 260 and 280 nm, with a ratio in the range 1.8–2.0 being considered high quality. Next, the same amounts of RNA from each sample were mixed in a 10 μL reaction mixture and single-stranded complementary DNA (cDNA) was synthesized by the Fermentas. Complementary cDNA was synthesized using a First Strand cDNA kit according to the manufacturer's instructions. The total PCR mixture was prepared as 50 μL : 25 mM MgCl2, 10 mM primers, 10 mM dNTP, 10x PCR buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl, 11 mM MgCl2, and 0.1% gelatin), TaqNova DNA polymerase (Blirt, Poland), and MilliQ water to make up the volume. The obtained cDNA (2 μL) was used for PCR amplification and specific primers belonging to targeted gene regions (β-actin, SOD2, CAT, and GPx) were designed to amplify and determine the expression level of targeted genes (Table 1). The PCR thermocycler was programmed to the following conditions: 5 min initial denaturation at 95°C; 40 cycles of denaturation (30 s at 94°C); annealing (30 s at 56°C) and extension (1 min at 72°C); a final extension at 72°C for 10 min. The PCR products were run in 1.5% agarose gel, stained by 2% ethidium bromide, visualized via UVP Gel Doc It Imaging system, and analyzed by densitometry. The mRNA levels were determined by measuring the mean optical density (OD) of the RT-PCR product using Gel-Pro Analyzer 3.0 (Media Cybernetics, USA). The β-actin gene was used to evaluate the expression levels of PCR products. The results were normalized with the expression of the β-actin gene and in relation to the positive and negative controls (without cDNA) as shown in Figure 5. The experiments were repeated three times for tested cells. The average relative optical density values were subjected to statistical analyses.
Table 1
Primers used for RT-PCR analysis.
Gene
Primer sequence (5′-3′)
(bp)
SOD2
GTGAACAACCTGAACGCCAC
808
CCTACAGGCCCCCAAAACAT
CAT
CGGGCCTGGCCGATG
853
GCCATTCATGTGCCGATGTC
GPx
CAGTCCACCGTGTATGCCTT
344
GTAAAGAGCGGGTGAGCCTT
β-actin
AGATGGTTGCTGCATCTGCT
425
AGGAAAAACTTCATCATATTCCTGC
Figure 5
HPLC chromatograms of mixture of standard compounds and extract from AP in vivo plant of L. sibiricus. Description of numbered compounds in Table 2.
2.8. HPLC and LC-MS/MS Analyses
Chromatographic analysis was carried out using an HPLC system (Dionex, Sunnyvale, USA) equipped with a photodiode-array detector. Separation of the compounds was achieved on an RP column (aQ Hypersil GOLD, 250 × 4.6 mm, 5 μm) linked with a guard column (GOLD aQ Drop-In guards, 10 × 4 mm, 5 μm, Polygen, Poland) at 25°C using a mobile phase composed of water (A) and methanol (B), both with 0.1% formic acid. The linear gradient was started after 2 min of isocratic elution with 5% B and was slowly increased over 30 min to 55% B, followed by 2 min of isocratic elution and increase to 70% within 10 min, and then after an isocratic step with 70% B for 3 min the gradient was returned to initial 5% B within 3 min to reequilibrate the column for the next 2 min. The flow rate was 1 mL/min, and the absorbance was measured at 230, 280 nm and 310, 325, and 375 nm. LC-MS/MS was carried out using API LC/MS/MS system (Applera, USA) with electrospray ionization (ESI) source equipped with Dionex (Germany) HPLC system. Separation was achieved on aQ Hypersil GOLD column (C18, 2.1 mm × 150 mm, 5 μm) at 30°C using a gradient as described above for HPLC and a flow rate of 0.2 mL/min. Detection was performed in the negative ion mode with the following conditions: drying gas (N2) 11.0 L/min, temperature 350°C, nitrogen nebulizer pressure 40 psi, capillary voltage 4.5 kW, a detector gain of 1600 V, fragmentation voltage 100 V, and full scan range from 100 to 900 m/z. Compounds in L. sibiricus extracts were identified by comparing the retention times, UV spectra, and MS spectra of the analyzed samples with those of reference standards. Quantification was based on the calibration curve for standards constructed over the range of 5–200 μg/mL; the linearity of the calibration curve was verified by the correlation coefficient (r
2 = 0.9994). The standards of HPLC-grade purity (≥96%) were purchased from Sigma-Aldrich (Germany/USA).
2.9. Statistical Methods
The values in this study were expressed as mean ± SE (standard error) from three experiments; that is, the results of three experiments were pooled and the statistical parameters were calculated. The Mann-Whitney U test was used to determine differences between samples with a nonnormal distribution (Kolmogorov-Smirnov test), while the differences between samples with a normal distribution were evaluated using Student's t-test. The results were analyzed using STATISTICA 6.0 software (Statsoft, USA). Statistical comparisons of relative optical densities (OD) were performed using a one-factor analysis of variance (ANOVA) and Dunnett's Multiple Comparison Test (p < 0.001).
3. Results
3.1.
In Vitro Plant Regeneration
L. sibiricus plants were propagated in vitro using shoot tips. Axillary shoots were multiplied on MS medium supplemented with 0.5 mg/L BAP and 0.1 mg/L IAA. The type and concentration of growth regulators were selected on the base of preliminary studies (data not shown). After 5 weeks, from one explant an average of 4.5 shoots, about 3 cm in length were formed. The shoots were rooted on MS medium containing 0.5 mg/L IAA. In total, 97% of the shoots formed an average of 3.2 roots (about 2 cm in length) within 5 weeks. The plantlets were transferred into soil and grown in pots in the greenhouse for 6 months and flowered. The survival rate of the plantlets after 6 months after transfer into ex vitro conditions was about 90%.
3.2. Effect of Plant Extracts on CHO Cells Viability
The readings of the cytotoxicity assay determined spectrophotometrically showed that, after 24 h of treatment, AP and R in vitro plant extracts (range 0–6.25 mg/mL) exerted a cytotoxic effect on CHO cells in both dose-dependent manners (Figure 1). The cell viability was notably decreased at concentrations of 0.47 mg/mL for the R and 1.00 mg/mL for the AR in vitro plant extracts. IC50 values were 1.7 mg/mL and 2.8 mg/mL for the R and AP in vitro plant extracts, respectively (Figure 1). Therefore, concentrations at 0.05, 0.1, and 0.5 mg/mL were chosen for further study by comet assay. CHO cells viability after treatment of R and AP in vivo plant extracts was similar to that obtained for R and AP in vitro plant extracts (data not shown).
Figure 1
Cytotoxicity/viability of CHO cells treated with AP or R in vitro plant extracts (0–6.25 mg/mL) for 24 h. AP and R in vitro plant extracts—80% aqueous methanol extracts of aerial parts and roots of micropropagated plants of L. sibiricus.
3.3. Effect of L. sibiricus Extracts on DNA Damage Repair and Protective Ability against DNA Strand Breaks Induced by H2O2
The antioxidant influence of L. sibiricusR, AP in vitro plant and R, AP in vivo plant extracts was investigated in CHO cells. The percentage of DNA in the comet tail corresponds to the level of DNA strand breaks after H2O2 treatment. Before treatment with plant extracts, the cells were exposed to H2O2 at a concentration of 75 μM for 15 minutes at 4°C. Figures 2(a)–2(c) show the % DNA in tail of the CHO cells incubated with R, AP in vitro plant and R, AP in vivo plant extracts (0.05–0.5 mg/mL) immediately at time 0, as well as after 15, 30, 60, and 120 min incubation. CHO cells treated with H2O2 showed incomplete repair within 2 h and about 5% of the DNA was present in the tail. After incubation, the cells pretreated with H2O2 and plant extract exhibited more efficient DNA repair than those treated with hydrogen peroxide alone (Figure 2). The level of DNA damage induced by H2O2 was decreased and was proportional to increasing concentrations of plant extracts. The relative decrease of DNA damage observed during repair incubation was significantly higher after treatment with the R in vitro plant extract. At the optimal concentration (0.5 mg/mL), the levels of DNA damage were significantly increased to 50% after 15 and 30 min of DNA repair incubation time (Figure 2). After 60 min of the repair incubation, the percentage of DNA in the tail was about 10%. At the same time, the level of DNA damage in CHO cells treated with only H2O2 was about 25% (Figure 2(c)). Pretreatment with R, AP in vitro plant and AP, R in vivo plant extracts resulted in a protective effect against oxidation in CHO cells which increased proportionally with increasing extract concentrations (Figures 3(a)–3(c)). The R and AP in vitro plant extracts had a significantly stronger protective effect than R and AP in vivo plant extracts (Figure 3(c)). The strongest effect was observed for R in vitro plant extracts. After 15 and 30 min of DNA repair incubation time, the levels of DNA damage were significantly increased to 20–30% (Figure 3). After 60 min of the repair incubation, the percentage of DNA in tail was about 5–10%. CHO cells treated with H2O2 and pretreated with extracts showed complete repair within 2 h.
Figure 2
DNA damage and repair in CHO cells with 0.05 mg/mL (a), 0.1 mg/mL (b), and 0.5 mg/mL (c) of L. sibiricus AP, R in vitro plant and AP, R in vivo plant extracts. DNA damage (strand breakage) was induced or not by H2O2 at a concentration of 75 μM at 4°C on ice and measured as a percentage of the tail DNA in the alkaline comet assay.
P < 0.001 by comparing AP in vitro plant with AP in vivo plant extracts and R in vitro plant with R in vivo plant extracts at the appropriate time of incubation. The number of cells scored for each individual was 100. Data is expressed as means ± SE of at least three independent experiments.
Figure 3
The protective effect on CHO cells treatment 0.05 mg/mL (a), 0.1 mg/mL (b), and 0.5 mg/mL (c) of L. sibiricus AP, R in vitro plant and AP, R in vivo plant extracts after 24 h preincubation. DNA damage (strand breakage) was induced or not by H2O2 at a concentration of 75 μM at 4°C and measured as a percentage in the tail DNA in the alkaline comet assay.
P < 0.001 by comparing AP in vitro plant with AP in vivo plant extract and R in vitro plant with R in vivo plant extracts at the appropriate time of incubation. The number of cells scored for each individual was 100. Data is expressed as means ± SE of at least three independent experiments.
3.4. Changes in Expression Level of Antioxidant Genes (SOD2, CAT, and GPx)
The mRNA levels of three antioxidant genes, SOD2, CAT, and GPx, were also determined in CHO cells incubated with 0.5 mg/mL of L. sibiricusR, AP in vitro plant and R, AP in vivo plant extracts after 0 and 24 hours. Before treatment with the plant extracts, the cells were exposed to H2O2 at 75 μM for 15 min. The gene expression level of the SOD2, CAT, and GPx in CHO cells exposed to the R, AP in vitro plant or R, AP in vivo plant extracts immediately after incubation (0 hours) did not differ significantly compared with that observed in control cells. Figure 4 shows that all of the tested extracts were able to increase the expression level of SOD2, CAT, and GPx genes about 2–5-fold after a 24-hour incubation period.
Figure 4
The SOD2 (a), CAT (b), GPx (c), and β-actin mRNA levels in the CHO cell line, incubated in the presence of 0.5 mg/mL AP, R in vitro plant and AP, R in vivo plant extracts of L. sibiricus for 24 h. β-actin was used as an internal control for integrity and equal amount of cDNA used in each PCR. Representative gels from three independent experiments are shown. Before treatment with plant extracts, the cells were exposed to H2O2 at 75 μM for 15 min. The bar graph shows a semiquantitative comparison of the SOD2, CAT,and GPx to β-actin optical density ratio.
P < 0.001 as compared to AP, R in vitro plant and AP, R in vivo plant extracts with control the appropriate time of incubation.
3.5. Identification and Quantification of Phenolic Compounds in L. sibiricus Extracts
The phenolic compounds present in all plant extracts were identified by comparison of retention times, online UV absorption spectra, and mass data with those of the of authentic standard compounds (Table 2). The structural elucidation of phenolic compounds found in L. sibiricus extracts was achieved by negative ionization LC-ESI-MS/MS. MS data showed the quantities of molecular ions [M-H]- and their fragmentation patterns to be consistent with these obtained for nine phenolic standards (Table 2). The main phenolic metabolites in L. sibiricus extracts were identified as the hydroxycinnamic acid derivatives, chlorogenic acid (3) and caffeic acid (4), as well as the flavonolquercetin (8), in extracts from the aerial parts. Quercetin was also found in glycoside form, as rutin (7). Verbascoside (9) was another glycosylated compound identified in the extracts. Additionally, other minor compounds were detected in plant extracts: 4-hydroxybenzoic acid (1), (+)-catechin (2), p-coumaric acid (5), and ferulic acid (6). A typical chromatogram of the methanolic extract of the AP in vivo plants is shown in Figure 5. The contents of five phenolic acids (4-hydroxybenzoic acid, chlorogenic acid, caffeic acid, p-coumaric acid, and ferulic acid), two flavonoids (quercetin and rutin), verbascoside, and catechin in aqueous methanolic AP and R in vitro plant and AP and R in vivo plant extracts of L. sibiricus were determined by HPLC method. The results demonstrated that the aerial parts of the in vitro and in vivo plants contained significantly different levels of phenolic acids, flavonoids, verbascoside, and catechin than the roots (Table 3). In the extracts from the aerial parts, the flavonoid fraction was dominant (2.8–9.7 mg/g DW) with quercetin as the main constituent. In the roots of both the in vitro and in vivo plants, the phenolic acids (7.6–12 mg/g DW) were found to be the most prominent fraction, with chlorogenic acid and caffeic acid as the major compounds (4.4 and 6.5 mg/g DW and 3.2 and 5.5 mg/g DW, resp.) (Table 3). Also, verbascoside was accumulated in higher amounts in the root extracts (0.26–0.37 mg/g DW) than the extracts from aerial parts (0.18–0.19 mg/g DW). Significant quantitative differences in the content of phenolic compounds between in vitro and in vivo plant extracts were also observed. As shown in Table 3, the content of quercetin in the AP in vitro plants extract (9.7 mg/g DW) was about 3.5 times greater than in the AP in vivo plants extract (2.8 mg/g DW). Similarly, the phenolic acid content in the R in vitro plants extract (12.1 mg/g DW) was found to be 1.5 times higher than that of the R in vivo plants extract (7.6 mg/g DW).
Table 2
Phenolic compounds identified in L. sibiricus extracts using HPLC-ESI-MS/MS method.
Contents of phenolic compounds in extracts from aerial part and roots of micropropagated and seed-derived plants of L. sibiricus.
Number
Phenolic compounds
AP in vitromg/g DW
R in vitromg/g DW
AP in vivomg/g DW
R in vivomg/g DW
1
4-Hydroxybenzoic acid
0,090 ± 0,004c
0,041 ± 0,0017b
0,16 ± 0,0073d
0,004 ± 0,0001a
2
(+)-Catechin
0,071 ± 0,0033b
0,1 ± 0,004c
0,184 ± 0,0083d
0,054 ± 0,0024a
3
Chlorogenic acid
4,912 ± 0,246b
6,532 ± 0,306c
3,125 ± 0,054a
4,380 ± 0,187b
4
Caffeic acid
1,235 ± 0,060a
5,480 ± 0,244c
1,361 ± 0,066a
3,222 ± 0,127b
5
p-Coumaric acid
—
0,011 ± 0,0004a
0,019 ± 0,0006a
—
6
Ferulic acid
0,034 ± 0,0152b
0,028 ± 0,0011b
0,027 ± 0,0010b
0,020 ± 0,0006a
7
Rutin
0,018 ± 0,0008a
0,502 ± 0,022b
0,014 ± 0,0005a
0,172 ± 0,0051c
8
Quercetin
9,712 ± 0,372b
—
2,848 ± 0,108a
—
9
Verbascoside
0,188 ± 0,008a
0,373 ± 0,013c
0,180 ± 0,007a
0,255 ± 0,002b
10
Sum of phenolic acids
6,273 ± 0,301b
12,093 ± 0,568c
4,694 ± 0,192a
7,628 ± 0,299b
11
Sum of flavonoids
9,730 ± 0,370d
0,502 ± 0,022b
2,862 ± 0,107c
0,172 ± 0,0051a
AP and R in vitro plant extracts: 80% aqueous methanol extracts of aerial parts and roots of micropropagated plants.
AP and R in vivo plant extracts: 80% aqueous methanol extracts of aerial parts and roots of seed-derived plants.
Different superscript letters within the rows indicate significant differences in the mean values at p < 0.05 (one-way ANOVA by the Mann-Whitney U test).
4. Discussion
L. sibiricus, commonly known as Chinese Motherwort, has important antibacterial, anti-inflammatory, anticarcinogenic, and antioxidant properties [4-7]. Our study had three general aims. Firstly, we investigated DNA repair stimulating and protective effects of aqueous methanolL. sibiricus extracts on H2O2-induced DNA damage in CHO cells. Secondly, we evaluated the expression level of free antioxidant genes encoding SOD2, CAT, and GPx after preincubation with H2O2 of CHO cells with extracts of this plant. Thirdly, we determined the phenolic acids, flavonoids, and verbascoside content in aqueous methanol extracts from the aerial parts and roots of in vitro plants grown under greenhouse conditions and compared them with those from the aerial part and roots of seed-derived plants by HPLC and LC-MS/MS methods.All of tested extracts (AP, R in vitro plants and AP, R in vivo plants) protected CHO cells from H2O2-induced oxidative DNA damage and were able to stimulate DNA repair in these cells, but stronger effects were observed for extracts from the roots and aerial parts of in vitro plants than those from in vivo plants. This could be associated with two times higher contents of phenolic compounds (calculated as the sum of phenolic acids and flavonoids) in in vitro plant extracts (16 mg/g DW in the aerial part and 12.6 mg/g DW in the roots) than in in vivo plant extracts (7.6 mg/g DW in the aerial part and 7.7 mg/g DW in the roots). Additionally, the roots extracts were found to have stronger activity than the aerial part extracts. These differences may be attributed to quantitative variations of individual compounds which were characterized by high antioxidant activity such as chlorogenic acid and caffeic acid. For example, the roots of in vitro derived plants produced 6.53 mg/g DW of chlorogenic acid, while the concentration of the compound in the overground parts of the plants was 4.9 mg/g DW. The same tendency was observed for caffeic acid, its level being 4.5 times higher in the R extract than the AP extract from the in vitro plant. Although phenolic compounds had previously been detected in the aerial parts and roots of L. sibiricus [14], the present study is the first to confirm their presence in the overground and underground parts of micropropagated plants. The polyphenolic compounds are known to be strong antioxidants which act by providing hydrogen atoms from their phenolic hydroxyl groups to scavenge hydroxyl radicals generated from hydrogen peroxide [15, 16] and thus protect DNA from damage induced by H2O2. On the other hand, the mechanism of interactions between these compounds, and any other possible synergistic effects, may enhance the protective effects. Several in vitro and in vivo studies have used comet assay to evaluate the protective activities of phenolic acids such as ferulic acid, chlorogenic acid, and caffeic acid against oxidative DNA damage [17-19], but this is the first study to report the ability of L. sibiricus extracts to protect against DNA damage and stimulate its repair in CHO cells exposed to an agent inducing oxidative stress. The antioxidant properties of the L. sibiricus aerial part extracts have also been confirmed by Chua and Aminah [20], who report that ethanol and aqueous extracts of L. sibiricus have strong antioxidant activities in the autooxidation of the linoleic acid lipid system (LP) and demonstrate xanthine oxidase superoxide scavenging activity (XOD) and 1,2-diphenyl-2-picrylhydrazyl radical scavenging activity (DPPH).H2O2 is known to induce oxidative stress and consequent cell damage via the modulation of gene expression (e.g., SOD2, CAT, and GPx), and this is believed to contribute to the development of inflammation, carcinogenesis, and other conditions [21-23]. The present study uses RT-PCR to analyze changes in genes expression after treatment with extracts from the roots and aerial parts of L. sibiricus plants grown in vitro and in vivo. 24 h incubation of CHO cells with 0.5 mg/mL extracts resulted in a significant increase in mRNA levels of all tested genes as compared with the β-actin gene, but OD (optical density) was significantly higher for both in vitro plant extracts than both in vivo plant extracts. It suggested probably that phenolic compounds contained in L. sibiricus extract may inhibit ROS production and upregulation of SOD, CAT, and GPx genes expression mediated by H2O2. Marimoutou et al. [24] report that the protective action of polyphenolic compounds was associated with an increase in SOD gene expression in 3T3L1 preadipocyte cells. Similarly, Yang et al. [25] revealed that grape seed extract induced a prominent increase in the expression levels and activity of CAT and SOD in H2O2-pretreated PMC cells. The expression of a number of genes involved in antioxidant defense has been found to be influenced by treatment with oxidizing agents. For example, Kobayashi et al. [26] report increased expression of glutamate-cysteine ligase (GCL) along with decreased expression of GPx after treatment with H2O2 of 3T3-L1 cells. The authors speculate that these changes may be associated with increased intracellular concentrations of reduced glutathione (GSH) under oxidative stress.
5. Conclusion
In conclusion, this work demonstrates that all the tested extracts of L. sibiricus protect CHO cells from H2O2-induced oxidative DNA damage. The protective property of these extracts could be caused by the presence of phenolic acids and flavonoids. The antioxidant and DNA repair stimulating mechanism of the R in vitro plant extract is presented in Figure 6. The potential mechanism of activity shows that the R in vitro plant extract, which had the strongest antioxidant properties, may be responsible for stimulating CHO cells to repair oxidative DNA damage, or protecting DNA from oxidative lesions, by elevating the activation of antioxidant genes (SOD2, CAT, and GPx) regulating intracellular antioxidant capacity. Our results also support the hypothesis that natural compounds like polyphenols may actively accumulate in discrete cell structures and display a pleiotropic action in addition to their antioxidant effects on tested cells. However, further in vitro studies are necessary to better clarify its antioxidative mechanism of action.
Figure 6
Schematic illustration of the possible mechanism of the DNA repair stimulating and protective effect of R in vitro plant extract from Leonurus sibiricus against oxidative DNA damage caused by H2O2 in CHO cells.
Authors: Korneel Vandenbroucke; Steven Robbens; Klaas Vandepoele; Dirk Inzé; Yves Van de Peer; Frank Van Breusegem Journal: Mol Biol Evol Date: 2008-01-10 Impact factor: 16.240
Authors: Przemysław Sitarek; Ewa Skała; Monika Toma; Marzena Wielanek; Janusz Szemraj; Tomasz Skorski; Adam J Białas; Tomasz Sakowicz; Tomasz Kowalczyk; Maciej Radek; Halina Wysokińska; Tomasz Śliwiński Journal: Pathol Oncol Res Date: 2016-12-28 Impact factor: 3.201
Authors: Magdalena Kluska; Michał Juszczak; Daniel Wysokiński; Jerzy Żuchowski; Anna Stochmal; Katarzyna Woźniak Journal: Toxicol Res (Camb) Date: 2019-09-10 Impact factor: 3.524
Authors: Tomasz Kowalczyk; Anna Merecz-Sadowska; Patricia Rijo; Vera M S Isca; Laurent Picot; Marzena Wielanek; Tomasz Śliwiński; Przemysław Sitarek Journal: Cells Date: 2021-05-18 Impact factor: 6.600