Antibiosis of Trichoderma spp strains native to northeastern Mexico against the pathogenic fungus Macrophomina phaseolina.

Sampling of agricultural soils from the Mexican northeastern region was performed to detect Trichoderma spp., genetically characterize it, and assess its potential use as a biologic control agent against Macrophomina phaseolina. M. phaseolina is a phytopathogen that attacks over 500 species of cultivated plants and causes heavy losses in the regional sorghum crop. Sampling was performed immediately after sorghum or corn harvest in an area that was approximately 170 km from the Mexico-USA border. Sixteen isolates were obtained in total. Using colony morphology and sequencing the internal transcribed spacers (ITS) 1 and 4 of 18S rDNA, 14 strains were identified as Trichoderma harzianum, T. koningiopsis and T. virens. Subsequently, their antagonistic activity against M. phaseolina was evaluated in vitro, and 11 isolates showed antagonism by competition and stopped M. phaseolina growth. In 4 of these isolates, the antibiosis phenomenon was observed through the formation of an intermediate band without growth between colonies. One strain, HTE808, was identified as Trichoderma koningiopsis and grew rapidly; when it came into contact with the M. phaseolina colony, it continued to grow and sporulated until it covered the entire petri dish. Microscopic examination confirmed that it has a high level of hyperparasitism and is thus considered to have high potential for use in the control of this phytopathogen.

Introduction

Trichoderma spp. is a fungus that can be isolated from soil and agricultural waste and can form opportunistic interactions with and cause hyperparasitism in other fungi (Monte, 2001; Samuels, 2006). This fungus is frequently used in the textile industry, and agricultural reports have indicated that it promotes vegetable growth and facilitates the absorption of water, mineral salts, nutrients and the use of carbohydrates. It also produces secondary metabolites such as antibiotics, mycotoxins, and phytotoxins (Lifshitz ; Benhamou and Chet, 1996; Mukherjee ; Shoresh and Harman, 2008a., 2008b). These substances are involved in the antagonism phenomenon as a result of either competition or antibiosis or through hyperparasitism using structures called appresoria, which release enzymes (glucanases, chitobioses and chitinases) or antibiotics (viridin, gliotoxin or peptaibols) (Howell ; Mukherjee ). These factors encourage the use of Trichoderma spp. in controlling agricultural crop phytopathogens (Benitez ). The increase in the number of its isolates, its high phenotypic variability, and its similarity with Hypocrea and Gliocladium complicate the identification of Trichoderma spp. through classic taxonomy. With the recent application of nucleic acid-based identification techniques, the number of described Trichoderma species has tripled. Various methods have been used in these studies, including the following sequences: (ITS) the 5 introns of the protein gene, which encodes the elongation alpha 1 (tef1) translation factor; the gene that codes for actin (gene act); calmodulin (gene cal); and one partial exon of the gene ech42 for chitinase (Bailey and Lumsden, 1998; Castle ; Hermosa ; Lu ; Vera ; Druzhinina ; Samuels ). Macrophomina phaseolina (Tassi) Goid is a phytopathogenic filamentous fungus that belongs to the anamorphic Ascomycota Botryosphaeriaceae family (Crous ; Arora ) and produces both sclerotia and pycnidia. M. phaseolina is responsible for the plant disease called charcoal rot, which affects both roots and stems. M. phaseolina is widely distributed in tropical regions, specifically in areas that are subjected to water stress, where it infects hundreds of different hosts (Songa ) and causes severe economic losses (Smith and Carvil, 1997). In Mexico, M. phaseolina is found in both the northern region, where the climate is mostly hot and dry, and in the south, where the humidity is high and where the temperatures range from 30 °C in the summer to 5 °C in winter. This microorganism penetrates host tissues through mechanical pressure exerted by the spore germ tube and the sclerotia hyphae and through the dissolution of the cell wall via processes that are mediated by secreted enzymes (Ammon ). Therefore, the present study was conducted to isolate native strains of Trichoderma spp. that are present in northeastern Mexican agricultural soils and to evaluate their in vitro antagonistic capacity against M. phaseolina.

Materials and Methods

Origin of the strains

Forty-two samples were obtained from approximately 2 kg of soil from the top 15 cm of lands recently cultivated with maize. To isolate the fungus, a technique developed in this laboratory was used, which consists of depositing 150 g of soil into 180-mL Styrofoam cups, adding 10 maize seeds (Pioneer 3025) and soaking with sterile deionized water according to their needs. The cups were covered and observed for 15 days, after which they were checked to detect colonies with the typical morphology of Trichoderma spp. on the seeds and in the soil (Barnett and Hunter, 1998; Samuels ). The isolations were performed on potato dextrose agar PDA (Difco, Sparks, MD), and only the colonies with different morphological characteristics were selected for further analysis. The HMP5 strain of M. phaseolina used in this study was isolated from bean plants (Phaseolus vulgaris L.) in Cotaxtla, México, and was provided by the Plant Biotechnology Laboratory of the Genomics Biotechnology Center of the IPN.

Antagonism

The fungi were cultivated on PDA (Difco, Sparks, MD) in petri dishes first individually and then in confrontation. The growth rate was measured every 12 h. Antagonism tests were performed according to the methodology described by Acevedo (1995), which involves placing a 7-mm-diameter agar disc with a seven-day-old M. phaseolina mycelium and an agar disc with a four-day-old Trichoderma mycelium at adjacent points of a PDA (Difco, Sparks, MD) petri dish. Each test was replicated three times, and statistical analysis (Mean comparison, Thukey p = 0.05) was performed using the SAS program. Graphs were made using Microsoft Excel XP and GraphPad Prism 4.00.

DNA extraction, ITS amplification and DNA sequencing

Isolates of Trichoderma spp. were grown in 500 mL Erlenmeyer flask, with 50 mL of Luria-Bertani broth (Difco, Sparks, MD), incubated at 27 °C with 200 rpm shaking. The 72-h culture was centrifuged, and the biomass obtained was prepared for DNA extraction. The Hoffman and Wriston (1987) method was used, which consists of transferring the biomass to an Eppendorf tube, washing with deionized sterile water and discarding the supernatant. The cells were lysed through chemical and physical treatment and were then centrifuged at 12,000 rpm followed by RNAse addition. The obtained DNA was stored in 10:1 TE buffer at −20 °C until used. The quantity of DNA was analyzed using a 1% agarose gel in a horizontal electrophoresis unit (Bio-Rad Laboratories Inc., Hercules, CA) at 100 V for 50 min. The gel was observed in an ultraviolet transilluminator, and the image was captured with the Kodak Digital Science® 1D program (Kodak Company, Rochester, NY). PCR was performed in a final volume of 50 μL using 1 μL of genomic DNA (50 ng), 5 μL of 10X Buffer, 1.5 μL of magnesium (50 mM), 1 μL of mixed dNTPs (10 mM), 1 μL of each primer (100 mM) and 0.4 μL of the enzyme Taq DNA polymerase (5 U/μL), completing the volume with sterile milliQ water. For amplification of the ITS1-18S-ITS4 region of Trichoderma genome, the primer pair T/ITS1 TCTGTAGGTGAACCTGCGG and T/ITS4 TCCTCCGCTTATTGATATGC was used. The amplification program consisted of one cycle of 3 min at 94 °C and 35 cycles of 1 min at 94 °C, 1 min at 53 °C and 1 min at 72 °C. There was a final extension step of 1 min at 72 °C. The PCR was performed in a Peltier MJ Research Thermal Cycler® (MJ Research/Bio-Rad, Hercules, CA). We proceeded to visualize the PCR fragments on a 1% agarose gel, adding 0.1 μL SYBR gold (Thermo Fisher Scientific Inc., Waltham, MA) and 0.4 μL Orange loading dye (Thermo Fisher Scientific Inc., Waltham, MA). We loaded 5 μL of each sample in the gel, which was run in a horizontal electrophoresis unit (Bio-Rad Laboratories Inc., Hercules, CA) at 80 V for 1 h. The gels were digitized using the Kodak Digital Science® 1D program (Kodak Company, Rochester, NY). The PCR products at a 50 ng/μL concentration were sequenced in the Applied System Model 3130® column sequencer (Thermo Fisher Scientific Inc., Waltham, MA). For species-level identification, the obtained data were compared with the reference sequences deposited in the NCBI GenBank and in the ISTH TricoOKEY databases. The Trichoderma species was determined based on concordance with these databases.

Phylogenetic analysis

After sequencing, the ITS1-18S-ITS4 region of Trichoderma isolates were compiled SeqMan software (DNASTAR Inc., Madison, WI) and edited using the BioEdit software (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Multiple alignments were performed using the ClustalW software (http://www.ebi.ac.uk/clustalw/). Each sequence type was compared by a BLAST search with those available in GenBank (http://www.ncbi.nlm.nih.gov) and those in the ISTH TricoOKEY databases to determine approximate phylogenetic affiliations. Evolutionary distances were calculated using the Kimura two-parameter model. The phylogenetic tree was constructed with a neighbor-joining method using MEGA 4.0.

Results

A total of 42 soil samples were obtained and processed, from which 16 strains were isolated based on their similarity of morphology to Trichoderma spp. (Figure 1). These isolates were coded HTE801 to HTE816. To identify the species, sequence typing was performed, and the sequences obtained from each isolate were aligned and compared with the sequences of the GenBank database from NCBI and the TricoOKEY database from ISTH.

Figure 1

Trichoderma spp. colonies obtained from soils with different crops and agronomic conditions.

Isolate identification by this method showed that the strains coded from HTE801 to HTE807 and from HTE810 to HTE816 correspond to T. harzianum and that HTE808 corresponds to T. koningiopsis and HTE809 to T. virens (Figure 2). These results show that there is no association among the geographical origins of the sample, the cultivated species, growing condition and the isolated fungus.

Figure 2

Neighbor-joining phylogenetic tree of Trichoderma spp. isolates based on sequences from the ITS1-18S-ITS4 region.

Growth kinetics of assessed fungi: Trichoderma spp

The data obtained from the tests performed when cultivating each of the Trichoderma spp. strains individually shows that generally between 96 and 120 h after seeding, the mycelium completely covers the petri dish surface (Figure 3).

Figure 3

Mycelial growth (cm) of Trichoderma spp. after inoculation growing by itself and in confrontation with M. phaseolina. The Percentage Inhibition of Radial Growth of M. Phaseolina (PIRGM) was determined as follows: PIRGM = [(R1-R2)/R1] × 100 where, R1 = radial growth of the pathogen and R2 = radial growth of the pathogen against Trichoderma spp; The Percentage of Radial Growth Acceleration of Trichoderma (PRGAT) was determined as follows: PRGAT= [(R2-R1)/R2] × 100 where, R1 = Radial growth of Trichoderma spp. and R2 = radial growth of Trichoderma spp. against the pathogen. Red lines indicate the growth of Trichoderma spp. and blue lines indicate the growth of Trichoderma spp. against M. phaseolina.

The growth rate curve is exponential up to 96 h and stabilizes thereafter. HTE801, HTE807 and HTE808 are considered fast growing because they cover the petri dish within 96 h after seeding, whereas a lower growth rate is observed for HTE809, with 132 h required post-inoculation for complete coverage. In most instances where the Trichoderma spp. is grown in the same petri dish as M. phaseolina, the fungus has the same developmental kinetics, except with strains such as HTE810, where a phenomenon that has not yet been reported in assays from the confrontation of Trichoderma spp. with other fungi is observed. Therefore, there are several mechanisms involved in Trichoderma antagonism, namely antibiosis, whereby the antagonistic fungus produces antibiotics and competes for nutrients. In the case of mycoparasitism, Trichoderma directly attacks the plant pathogen by excreting lytic enzymes such as chitinases, β-1, 3 glucanases and proteases (Haran ). Because the skeleton of pathogenic fungi cell walls contains chitin, glucans and proteins, enzymes that hydrolyze these components must be present in a successful antagonist to play a significant role in cell wall lysis of the pathogen. Filamentous fungal cell walls also contain lipids and proteins. It therefore was expected that antagonistic fungi synthesize proteases might act on the host cell wall (Lorito ).

Growth kinetics of assessed fungi: M. phaseolina

M. phaseolina is a fungus that has an exponential kinetic growth in PDA (Difco, Sparks, MD) media and covers the entire dish 120 h post-inoculation. The analysis of variance was performed using a Tukey test (p = 0.05), which was performed by comparing the growth data of the M. phaseolina strain by itself and in antagonism with the different Trichoderma spp. strains, showed that at 60 h post-inoculation, the control and confrontation tests exhibit similar growth, except for strain HTE805, which develops more slowly. At the 72nd h, only nine of the evaluated strains (HTE801, HTE808, HTE813 and HTE816) came into contact with the Trichoderma spp. colonies (Figure 4). In all other treatments, contact was observed at the 84th h post-inoculation.

Figure 4

Mycelial growth (cm) of M. phaseolina growing by itself and in confrontation with different Trichoderma spp strains. The Percentage Inhibition of Radial Growth of M. Phaseolina (PIRGM) was determined as follows: PIRGM = [(R1-R2)/R1] × 100 where, R1 = radial growth of the pathogen and R2 = radial growth of the pathogen against Trichoderma spp; The Percentage of Radial Growth Acceleration of Trichoderma (PRGAT) was determined as follows: PRGAT= [(R2-R1)/R2] × 100 where, R1 = Radial growth of Trichoderma spp. and R2 = radial growth of Trichoderma spp. against the pathogen. Red lines indicate the exponential growth of M. phaseolina and blue lines indicate the growth of M. phaseolina against Trichoderma spp.

A statistical analysis of the growth kinetics between the M. phaseolina strain (Figure 4) growing by itself and in confrontation showed that strains HTE801 and HTE803 of Trichoderma spp. increased the phytopathogen colony development rate. As observed in Figure 4, for strains HTE805, HTE809 and HTE813, immediately before the contact between the colonies of M. phaseolina and Trichoderma spp., the detected growth rate of the phytopathogen decreased, which modified the exponential growth line until it stabilized.

Antagonism tests

From the antagonism tests between Trichoderma spp. and M. phaseolina, the following four phenomena were detected: antagonism through competition, antibiosis, hyperparasitism caused by Trichoderma spp. over M. phaseolina and the developmental delay of T. harzianum HTE810 when grown in competition with M. phaseolina. These tests were repeated three times, and the results are statistically significant. Competition is observed when the two fungi grow in the petri dish until their mycelia come into contact, and the Trichoderma spp. initiates the formation of a barrier, which prevents the growth of M. phaseolina. Over time, the barrier consolidates, thereby preventing the advance of the phytopathogen (Figure 5).

Figure 5

Details of the growth of Trichoderma spp. (bottom green colony), showing the beginning (left) of the formation of a barrier at the contact site with the mycelium of M. phaseolina (upper dark part).

Antagonism through competition

All of the T. harzianum and T. virens strains that were studied underwent antagonism by competition. Both Trichoderma species stopped the growth of the fungus M. phaseolina at the site of contact by forming a barrier that prevents M. phaseolina development.

Antibiosis

From the confrontation between the Trichoderma spp HTE815 strain and M. phaseolina, it is observed that at 48 h and without contact between mycelia, a zone of growth inhibition exists and the culture medium changes color, which could be due to secondary metabolite excretion. As shown in Figure 6, a narrow band without growth can form between the fungi, even when they are far from physical contact.

Figure 6

Growth and sporulation of Trichoderma spp. on M. phaseolina and the intersection point between them.

Hyperparasitism

Mycoparasitism involves morphological changes, such as coiling and formation of appressorium-like structures, which serve to penetrate the host. Differential antagonistic activity has been observed for various Trichoderma spp., which demonstrates semi-specificity in the interaction of Trichoderma with M. phaseolina. Our results revealed that of the 16 strains tested, only T. koningiopsis (HTE808) shows antagonism by hyperparasitism. Microscopically, T. koningiopsis hyphae are rolled into phytopathogenic M. phaseolina hyphae. This is a desirable trait for agricultural purposes because this strain (HTE808) has potential for use in phytopathogen control.

Discussion

The isolates obtained showed the formation of concentric rings that are typical of Trichoderma spp. colonies, where the green color of the conidia is interleaved with the white of the mycelium, which is consistent with the characteristics previously described for this fungus (Barnett and Hunter, 1998; Druzhinina ; Samuels, 2006). However, although the colony morphology serves to identify fungi of this genus, it is insufficient to distinguish the species, which makes it necessary to confirm the species through molecular methods (Ospina ; Druzhinina , 2006). The identification of the isolates in this study yielded three species, of which T. harzianum was the most frequently sampled. The presence of T. harzianum had already been reported in this region of the country (Larralde-Corona ), and it is the species with the widest distribution (Hermosa ; Harman ). Additionally, the TichoOKEY database could only be used to compare the sequences of some T. harzianum, T. virens and T. koningiopsis strains because, for sequencing the strains HTE801, HTE804, HTE805, HTE810 and HTE814, it was necessary to draw upon the NBCI GenBank database, where the identification was corroborated. The antagonism phenomenon observed in these isolates, where the strains of Trichoderma spp. did not allow the growth of the M. phaseolina colonies, confirm the competition, antibiosis and hyperparasitism phenomena that have been reported for Trichoderma spp. (Hjeljord and Tronsmo, 1998; Hermosa ; Benitez ; Harman, 2006; Hoitink ). Two phenomena that have not been previously reported were also observed; the first involves a strong decrease in the growth of the T. harzianum colony strain HTE810 when cultivated in confrontation tests with M. phaseolina (Figure 3). The other phenomenon detected is counter to the previous model of interaction, namely the induction rather than repression, of M. phaseolina colony growth in the presence of the T. harzianum strain HTE801 and, to a lesser extent, HTE803. In both cases, the acceleration is statistically significant (Tukey, p = 0.05; Figure 3).

Antagonism through antibiosis was detected in strains HTE807, HTE810, HTE815 and HTE809 of Trichoderma spp., which show growth-free spaces between both fungi, as well as a change in coloring in the culture medium. These strains correspond to T. harzianum and T. virens, respectively. The growth-free zone is possibly due to Trichoderma spp. producing metabolites such as viridin and its derivatives, which function as antimicrobials (Benitez ; Harman, 2006; Hoitink ; Vinale ). Finally, it was observed in T. harzianum strain HTE810 that the M. phaseolina strain HMP5 has a statistically significantly decreased growth rate, which was the initial impetus of these trials. We have not found reports of this response against T. harzianum.

Conclusions

This sampling shows that Trichoderma is a fungus that can be isolated from soil and that there is no relationship between the species and the conditions under which agriculture is carried out in this region. Of the detected fungi, T. harzianum is the most frequent species, with T. koningiopsis and T. virens following in frequency. From the antagonism test results, T. harzianum and T. virens show antagonistic activity through space competition, while T. koningiopsis showed a high level of hyperparasitism on M. phaseolina, demonstrating a strong potential for use as a control agent. The M. phaseolina HMP5 strain decreased the T. harzianum HTE810 growth when cultivated in a confrontation test.