Xerotolerant Cladosporium sphaerospermum Are Predominant on Indoor Surfaces Compared to Other Cladosporium Species.

Indoor fungi are a major cause of cosmetic and structural damage of buildings worldwide and prolonged exposure of these fungi poses a health risk. Aspergillus, Penicillium and Cladosporium species are the most predominant fungi in indoor environments. Cladosporium species predominate under ambient conditions. A total of 123 Cladosporium isolates originating from indoor air and indoor surfaces of archives, industrial factories, laboratories, and other buildings from four continents were identified by sequencing the internal transcribed spacer (ITS), and a part of the translation elongation factor 1α gene (TEF) and actin gene (ACT). Species from the Cladosporium sphaerospermum species complex were most predominant representing 44.7% of all isolates, while the Cladosporium cladosporioides and Cladosporium herbarum species complexes represented 33.3% and 22.0%, respectively. The contribution of the C. sphaerospermum species complex was 23.1% and 58.2% in the indoor air and isolates from indoor surfaces, respectively. Isolates from this species complex showed growth at lower water activity (≥ 0.82) when compared to species from the C. cladosporioides and C. herbarum species complexes (≥ 0.85). Together, these data indicate that xerotolerance provide the C. sphaerospermum species complex advantage in colonizing indoor surfaces. As a consequence, C. sphaerospermum are proposed to be the most predominant fungus at these locations under ambient conditions. Findings are discussed in relation to the specificity of allergy test, as the current species of Cladosporium used to develop these tests are not the predominant indoor species.

Introduction

Indoor fungal growth represents a global problem. For instance, about 25% of dwellings of social housing in the European Union show fungal growth [1, 2]. This causes disfigurement of the building materials and poses a health threat for the occupants and particularly for asthmatic and allergic patients [3, 4]. Indoor fungal growth is strongly increased after incidents of water damage caused for instance by flooding or leakage [5-8].

In outdoor air samples, species belonging to the genera Aspergillus, Penicillium and Cladosporium are commonly occurring. These genera are also predominant in indoor environments, indicating a strong correlation in fungal presence between indoor and outdoor air [9-12]. Penicillium chrysogenum and Aspergillus versicolor are particularly abundant in the indoor environment after water damage, while Cladosporium species dominate under ambient conditions [7, 13–15]. Cladosporium are widespread fungi. In nature, they are often found on dead plant material and on plant surfaces and are therefore considered as phylloplane fungi [16-18]. They have also been isolated from hypersaline environments, hence Cladosporium halotolerans [19, 20], and from soil and rocks such as artic rock [21-24]. These fungi can also be isolated from man-made products such as paint, food, textiles, books, glass windows and wall paper [25].

The genus Cladosporium comprises three species complexes, namely C. cladosporioides, C. herbarum and C. sphaerospermum, representing 169species [25]. The Cladosporium species complexes can be distinguished based on morphology and DNA sequences of the internal transcribed spacer (ITS), translation elongation factor 1α (TEF) and actin (ACT) loci [19, 20, 25, 26]. It has been stated that C. cladosporioides is the most abundant fungus in outdoor air [13]. As the composition of indoor species reflects the composition of the outdoor species we would expect to find C. cladosporioides. However, pilot studies of indoor samples at our institute suggested that members of the C. sphaerospermum species complex were predominant in the indoor environment. This prompted us to study a larger number of isolates collected over 8 years from locations with fungal problems. We identified these isolates using the sequences of 69 species from Bensch et. al. [25]. These 69 species comprise 2 species from outside a species complex and 7, 21 and 39 species from the C, sphaerospermum, C. herbarum and C. cladosporioides species complexes, respectively. We here show that C. sphaerospermum is the most predominant Cladosporium species complex in the indoor environment in general and on indoor surfaces in particular. The latter may be explained by the higher xerotolerance of this species complex when compared to C. cladosporioides and C. herbarum. This is of interest as most allergy tests are focused on Cladosporium herbarum, which has not been identified during this study.

Materials and Methods

Isolation of organisms

Isolates of indoor Cladosporium species were taken from the research collection of the Applied and Industrial Mycology (DTO) group of the CBS Fungal Biodiversity Centre. The isolates were collected during a period of time from 2006 to 2013 on request from residents or owners who noticed indoor fungal problems. The isolates originated from indoor environments including archives, industrial factories, laboratories, and other buildings with or without water damage (Table 1). In these situations usually both swab and air samples were collected. Air samples were taken by using a MAS-100 (Merck) air sampler. This samples an amount of air depending on the size of the room ranging from 15 to 1000 liter. The air is sampled on 2% malt extract agar supplemented with penicillin and streptomycin (MEA p/s) (Oxoid) or on dichloran 18% glycerol agar (DG18) (Oxoid). Samples of indoor surfaces were taken by using a sterile cotton swab or sellotape [27] and were also grown on MEA p/s or DG18. Strains were stored at -80°C in 30% glycerol, 0.025% Tween 80 and 0.025% agar or 30% glycerol, 0.01% Tween 80, 5 mM N-(2-acetamido)-2-aminoethanesulfonic acid (ACES), pH 6.8.

Table 1

Isolates of Cladosporium species identified and used in this study.

Species complex	Identified species	DTO nr.	Isolation	CBS nr.		Geographical origin	ITS	TEF	ACT
Cladosporioides	C. acalyphae	086-C5	December-08		S	s Hertogenbosch, The Netherlands	KP701887	KP701764	KP702010
Cladosporioides	C. angustisporum	127-E6	April-09		A	USA	KP701935	KP701812	KP702057
Cladosporioides	C. australiense	072-C8	July-08	139572	A	Amsterdam, The Netherlands	KP701873	KP701750	KP701996
Cladosporioides	C. australiense	082-E3	November-08		A	Amsterdam, The Netherlands	KP701878	KP701755	KP702001
Cladosporioides	C. australiense	090-D2	January-09		S	Rijswijk, The Netherlands	KP701899	KP701776	KP702022
Cladosporioides	C. australiense	109-E8	October-09		S	Denmark	KP701914	KP701791	KP702037
Cladosporioides	C. australiense	255-F3	March-13		S	Amersfoort, The Netherlands	KP701978	KP701855	KP702100
Cladosporioides	C. cladosporioides	039-G6	April-07	112388	A	Germany	KP701868	KP701745	KP701991
Cladosporioides	C. cladosporioides	071-G1	July-08	139571	Indoor	Greece	KP701872	KP701749	KP701995
Cladosporioides	C. cladosporioides	082-F1	November-08		A	Weert, The Netherlands	KP701879	KP701756	KP702002
Cladosporioides	C. cladosporioides	090-C6	January-09		S	Rijswijk, The Netherlands	KP701898	KP701775	KP702021
Cladosporioides	C. cladosporioides	102-A4	May-09		S	Hungary	KP701905	KP701782	KP702028
Cladosporioides	C. cladosporioides	109-I4	October-09		S	Denmark	KP701920	KP701797	KP702043
Cladosporioides	C. cladosporioides	109-I6	October-09		S	Denmark	KP701922	KP701799	KP702045
Cladosporioides	C. cladosporioides	127-D8	April-09		A	The Netherlands	KP701933	KP701810	KP702055
Cladosporioides	C. cladosporioides	147-A9	Winter 2009		Indoor	Hungary	KP701941	KP701818	KP702063
Cladosporioides	C. delicatulum	082-F3	November-08	139574	A	Weert, The Netherlands	KP701880	KP701757	KP702003
Cladosporioides	C. delicatulum	134-D3	June-10		Indoor	Algeria	KP701939	KP701816	KP702061
Cladosporioides	C. delicatulum	145-C4	November-10		Indoor	Germany	KP701940	KP701817	KP702062
Cladosporioides	C. delicatulum	167-H5	May-11		A	Poland	KP701964	KP701841	KP702086
Cladosporioides	C. globisporum	220-D4	August-12	139587	S	Utrecht, The Netherlands	KP701967	KP701844	KP702089
Cladosporioides	C. inversicolor	072-C9	July-08	139573	A	Amsterdam, The Netherlands	KP701874	KP701751	KP701997
Cladosporioides	C. inversicolor	108-F8	September-09		Indoor	France	KP701908	KP701785	KP702031
Cladosporioides	C. perangustum	220-D5	August-12	139588	S	Utrecht, The Netherlands	KP701968	KP701845	KP702090
Cladosporioides	C. perangustum	127-E1	April-09		A	USA	KP701934	KP701811	KP702056
Cladosporioides	C. pseudocladosporioides	084-F1	December-08	139575	Indoor	Germany	KP701881	KP701758	KP702004
Cladosporioides	C. pseudocladosporioides	079-F4	October-08		S	s Hertogenbosch, The Netherlands	KP701877	KP701754	KP702000
Cladosporioides	C. pseudocladosporioides	150-C1	February-11		A	Portugal	KP701943	KP701820	KP702065
Cladosporioides	C. pseudocladosporioides	151-D1	February-11		A	Portugal	KP701946	KP701823	KP702068
Cladosporioides	C. pseudocladosporioides	151-G7	February-11		A	Portugal	KP701949	KP701826	KP702071
Cladosporioides	C. subuliforme	130-H8	May-10		A	Thailand	KP701938	KP701815	KP702060
Cladosporioides	C. tenuissimum	109-A1	October-09		A	Thailand	KP701910	KP701787	KP702033
Cladosporioides	C. tenuissimum	130-F6	May-10		A	Thailand	KP701937	KP701814	KP702059
Cladosporioides	Unidentified	056-H7	August-07		S	Utrecht, The Netherlands	KP701871	KP701748	KP701994
Cladosporioides	Unidentified	072-E4	July-08		A	Amsterdam, The Netherlands	KP701875	KP701752	KP701998
Cladosporioides	Unidentified	084-F2	December-08		Indoor	Germany	KP701882	KP701759	KP702005
Cladosporioides	Unidentified	086-B3	December-08		S	s Hertogenbosch, The Netherlands	KP701886	KP701763	KP702009
Cladosporioides	Unidentified	108-G8	October-09		A	Thailand	KP701909	KP701786	KP702032
Cladosporioides	Unidentified	109-E7	October-09		S	Denmark	KP701913	KP701790	KP702036
Cladosporioides	Unidentified	109-F2	October-09		S	Denmark	KP701915	KP701792	KP702038
Herbarum	C. allicinum	109-I5	October-09	139578	S	Denmark	KP701921	KP701798	KP702044
Herbarum	C. allicinum	121-H1	January-10	139580	Indoor	Germany	KP701930	KP701807	a
Herbarum	C. allicinum	073-C8	July-08		Indoor	Greece	KP701876	KP701753	KP701999
Herbarum	C. allicinum	084-F3	December-08		Indoor	Germany	KP701883	KP701760	KP702006
Herbarum	C. allicinum	086-D5	December-08		S	s Hertogenbosch, The Netherlands	KP701888	KP701765	KP702011
Herbarum	C. allicinum	089-B9	January-09		A	Rijssen, The Netherlands	KP701891	KP701768	KP702014
Herbarum	C. allicinum	089-G4	January-09		A	Eindhoven, The Netherlands	KP701894	KP701771	KP702017
Herbarum	C. allicinum	089-G6	January-09		A	Eindhoven, The Netherlands	KP701895	KP701772	KP702018
Herbarum	C. allicinum	089-H3	January-09		A	Eindhoven, The Netherlands	KP701896	KP701773	KP702019
Herbarum	C. allicinum	090-D3	January-09		S	Rijswijk, The Netherlands	KP701900	KP701777	KP702023
Herbarum	C. allicinum	101-A1	May-09		S	The Netherlands	KP701903	KP701780	KP702026
Herbarum	C. allicinum	106-C2	July-09		A	Amsterdam, The Netherlands	KP701906	KP701783	KP702029
Herbarum	C. allicinum	109-E6	October-09		S	Denmark	KP701912	KP701789	KP702035
Herbarum	C. allicinum	109-F3	October-09		S	Denmark	KP701916	KP701793	KP702039
Herbarum	C. allicinum	109-F5	October-09		S	Denmark	KP701918	KP701795	KP702041
Herbarum	C. allicinum	110-B7	October-09		A	Denmark	KP701923	KP701800	KP702046
Herbarum	C. allicinum	111-A5	October-09		A	Denmark	KP701924	KP701801	KP702047
Herbarum	C. allicinum	249-G3	March-13		S	The Hague, The Netherlands	KP701975	KP701852	KP702097
Herbarum	C. ramotenellum	089-C1	January-09	139577	A	Rijssen, The Netherlands	KP701892	KP701769	KP702015
Herbarum	C. ramotenellum	255-G5	March-13	139590	S	Utrecht, The Netherlands	KP701983	KP701860	KP702105
Herbarum	C. ramotenellum	109-F4	October-09		S	Denmark	KP701917	KP701794	KP702040
Herbarum	C. ramotenellum	151-G3	February-11		A	Portugal	KP701947	KP701824	KP702069
Herbarum	C. ramotenellum	151-G6	February-11		A	Portugal	KP701948	KP701825	KP702070
Herbarum	C. ramotenellum	152-D9	February-11		A	Portugal	KP701950	KP701827	KP702072
Herbarum	C. ramotenellum	249-F5	March-13		S	The Hague, The Netherlands	KP701972	KP701849	KP702094
Herbarum	C. sinuosum	109-I2	October-09		S	Denmark	KP701919	KP701796	KP702042
Herbarum	C. tenellum	127-D7	January-09	139582	A	USA	KP701932	KP701809	KP702054
Herbarum	Unidentified	090-H8	January-09		S	Utrecht, The Netherlands	KP701901	KP701778	KP702024
Sphaerospermum	C. dominicanum	255-H5	March-13	139591	S	Utrecht, The Netherlands	KP701987	KP701864	KP702109
Sphaerospermum	C. dominicanum	249-F4	March-13		S	The Hague, The Netherlands	KP701971	KP701848	KP702093
Sphaerospermum	C. dominicanum	255-F7	March-13		S	Utrecht, The Netherlands	KP701979	KP701856	KP702101
Sphaerospermum	C. halotolerans	147-B9	Winter 2009	139583	Indoor	Hungary	KP701942	KP701819	KP702064
Sphaerospermum	C. halotolerans	161-D3	May-11	139585	S	Gilze, The Netherlands	KP701955	KP701832	KP702077
Sphaerospermum	C. halotolerans	164-A6	August-11	139586	S	Veenendaal, The Netherlands	KP701963	KP701840	KP702085
Sphaerospermum	C. halotolerans	220-D7	August-12	139589	S	Utrecht, The Netherlands	KP701969	KP701846	KP702091
Sphaerospermum	C. halotolerans	049-E7	September-07		S	Utrecht, The Netherlands	KP701869	KP701746	KP701992
Sphaerospermum	C. halotolerans	102-A1	May-09		S	Hungary	KP701904	KP701781	KP702027
Sphaerospermum	C. halotolerans	109-D3	October-09		A	Thailand	KP701911	KP701788	KP702034
Sphaerospermum	C. halotolerans	114-H7	December-09		S	Thailand	KP701925	KP701802	KP702048
Sphaerospermum	C. halotolerans	114-I3	December-09		S	Thailand	KP701926	KP701803	KP702049
Sphaerospermum	C. halotolerans	117-H3	January-10		Indoor	The Netherlands	KP701929	KP701806	KP702052
Sphaerospermum	C. halotolerans	127-E8	April-09		A	USA	KP701936	KP701813	KP702058
Sphaerospermum	C. halotolerans	153-C3	February-11		S	Utrecht, The Netherlands	KP701952	KP701829	KP702074
Sphaerospermum	C. halotolerans	160-I2	March-11		S	Utrecht, The Netherlands	KP701953	KP701830	KP702075
Sphaerospermum	C. halotolerans	161-D5	May-11		S	Gilze, The Netherlands	KP701957	KP701834	KP702079
Sphaerospermum	C. halotolerans	161-D6	May-11		S	Gilze, The Netherlands	KP701958	KP701835	KP702080
Sphaerospermum	C. halotolerans	220-D3	August-12		S	Utrecht, The Netherlands	KP701966	KP701843	KP702088
Sphaerospermum	C. halotolerans	249-F9	March-13		S	The Hague, The Netherlands	KP701974	KP701851	KP702096
Sphaerospermum	C. halotolerans	249-G4	March-13		S	The Hague, The Netherlands	KP701976	KP701853	KP702098
Sphaerospermum	C. halotolerans	255-F8	March-13		S	Utrecht, The Netherlands	KP701980	KP701857	KP702102
Sphaerospermum	C. halotolerans	255-G4	March-13		S	Utrecht, The Netherlands	KP701982	KP701859	KP702104
Sphaerospermum	C. halotolerans	255-G6	March-13		S	Utrecht, The Netherlands	KP701984	KP701861	KP702106
Sphaerospermum	C. halotolerans	255-H3	March-13		S	Utrecht, The Netherlands	KP701985	KP701862	KP702107
Sphaerospermum	C. halotolerans	257-F4	March-13		S	Utrecht, The Netherlands	KP701989	KP701866	KP702111
Sphaerospermum	C. langeronii	124-D5	February-10	139581	A	Ospel, The Netherlands	KP701931	KP701808	KP702053
Sphaerospermum	C. langeronii	085-H6	December-08		A	s Hertogenbosch, The Netherlands	KP701885	KP701762	KP702008
Sphaerospermum	C. sphaerospermum	084-F4	December-08	139576	Indoor	Germany	KP701884	KP701761	KP702007
Sphaerospermum	C. sphaerospermum	117-G5	January-10	139579	Indoor	The Netherlands	KP701927	KP701804	KP702050
Sphaerospermum	C. sphaerospermum	150-H8	February-11	139584	A	Portugal	KP701944	KP701821	KP702066
Sphaerospermum	C. sphaerospermum	017-C7	May-06		S	Eindhoven, The Netherlands	KP701867	KP701744	KP701990
Sphaerospermum	C. sphaerospermum	049-H5	September-07		S	Utrecht, The Netherlands	KP701870	KP701747	KP701993
Sphaerospermum	C. sphaerospermum	086-E7	December-08		Indoor	Utrecht, The Netherlands	KP701889	KP701766	KP702012
Sphaerospermum	C. sphaerospermum	086-E8	December-08		Indoor	Utrecht, The Netherlands	KP701890	KP701767	KP702013
Sphaerospermum	C. sphaerospermum	089-E9	January-09		A	Eindhoven, The Netherlands	KP701893	KP701770	KP702016
Sphaerospermum	C. sphaerospermum	090-A1	January-09		A	Eindhoven, The Netherlands	KP701897	KP701774	KP702020
Sphaerospermum	C. sphaerospermum	090-I1	January-09		S	Utrecht, The Netherlands	KP701902	KP701779	KP702025
Sphaerospermum	C. sphaerospermum	106-D4	July-09		A	Amsterdam, The Netherlands	KP701907	KP701784	KP702030
Sphaerospermum	C. sphaerospermum	117-H2	January-10		Indoor	The Netherlands	KP701928	KP701805	KP702051
Sphaerospermum	C. sphaerospermum	150-I8	February-11		A	Portugal	KP701945	KP701822	KP702067
Sphaerospermum	C. sphaerospermum	153-B7	February-11		S	Utrecht, The Netherlands	KP701951	KP701828	KP702073
Sphaerospermum	C. sphaerospermum	160-I4	March-11		S	Utrecht, The Netherlands	KP701954	KP701831	KP702076
Sphaerospermum	C. sphaerospermum	161-D4	May-11		S	Gilze, The Netherlands	KP701956	KP701833	KP702078
Sphaerospermum	C. sphaerospermum	161-D7	May-11		S	Gilze, The Netherlands	KP701959	KP701836	KP702081
Sphaerospermum	C. sphaerospermum	161-D8	May-11		S	Gilze, The Netherlands	KP701960	KP701837	KP702082
Sphaerospermum	C. sphaerospermum	161-D9	May-11		S	Gilze, The Netherlands	KP701961	KP701838	KP702083
Sphaerospermum	C. sphaerospermum	194-A4	April-12		S	Utrecht, The Netherlands	KP701965	KP701842	KP702087
Sphaerospermum	C. sphaerospermum	244-C6			S	Germany	KP701970	KP701847	KP702092
Sphaerospermum	C. sphaerospermum	249-F7	March-13		S	The Hague, The Netherlands	KP701973	KP701850	KP702095
Sphaerospermum	C. sphaerospermum	249-G5	March-13		S	The Hague, The Netherlands	KP701977	KP701854	KP702099
Sphaerospermum	C. sphaerospermum	255-G3	March-13		S	Utrecht, The Netherlands	KP701981	KP701858	KP702103
Sphaerospermum	C. sphaerospermum	255-H4	March-13		S	Utrecht, The Netherlands	KP701986	KP701863	KP702108
Sphaerospermum	C. sphaerospermum	255-H7	March-13		S	Utrecht, The Netherlands	KP701988	KP701865	KP702110
Sphaerospermum	Unidentified	162-A4	June-11		S	Arnhem, The Netherlands	KP701962	KP701839	KP702084

Strains with a CBS number are deposited in the CBS strain collection. A and S represent air and swab samples, respectively, and samples taken from unknown indoor sources are indicated with “Indoor”. The GenBank numbers of the ITS, TEF and ACT sequences are shown in the last three columns. Strains used for aw experiments are underlined. aDTO 121-H1 is identified using the sequences of ITS and TEF only.

Growth on media with lowered water activity

Water activity (aw) of the medium was set between 0.99 and 0.75 by substitution of water with 0–50% glycerol (v/v). A volume of 23 ml of medium was poured in Petri dishes with vents (Greiner, Bio-One B. V., Alphen aan de Rijn, The Netherlands) and left to solidify for 24 h on the bench with the lid closed. The aw of control (non-inoculated) plates of the different glycerol-agar mixtures was determined before and after growth experiments using a Novasina labmaster-aw (Novasina, Lachen, Switzerland) and samples with a diameter of 5 cm. The aw changed only marginally during 3 weeks of storage (ranging between a decrease of 0.01 aw unit in 5% glycerol plates and an increase of 0.03 units in 50% glycerol plates).

Agar plates were inoculated with 3 μl spore solution containing 1 x 106 spores ml -1 harvested from 7-days-old MEA-grown cultures. Conidia were collected in 10 mM ACES, 0.02% Tween 80. The spore suspension was filtered over sterile glass wool to remove hyphal fragments. Spores were counted using a Bürker-Türk haemocytometer and the suspension was diluted to 1 x 106 spores ml -1.

DNA sequencing and molecular analysis

Genomic DNA was isolated from 7-days-old cultures using the Ultraclean Microbial DNA isolation kit (MoBio Laboratories, USA) according to the manufacturer’s instructions. ITS, ACT, and TEF loci were amplified, using the primers shown in Table 2 [28-31], as described earlier in Houbraken and Samson (2011) [32]. The fragments were sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA). The products were analyzed on an ABI Prism 3730 XL DNA Sequencer (Applied Biosystems, USA). Sequences were assembled by using the forward and reverse sequences with the program SeqMan from the LaserGene 9 package (DNAstar, USA). The ITS, ACT, and TEF sequences were concatenated resulting in 1132 nucleotide long sequences. They were aligned to sequences of 70 taxa described by Bench et al. (2012) [25] using the online version of MAFFT [33]. The resulting alignments were manually improved and phylogenetic analyses were conducted using MEGA version 5 software [34]. A phylogenetic tree (S1 Fig) was made using pairwise deletion neighbor joining with 1000 bootstrap repetitions and the nucleotide substitution model, Tamura Nei, with gamma distribution parameter 4.

Table 2

Primers used for PCR and sequencing.

Primer:	Locus:	Primer sequence:	Reference:
V9G	Internal Transcribed Spacer	TTACGTCCCTGCCCTTTGTA	[29, 31]
LS266	Internal Transcribed Spacer	GCATTCCCAAACAACTCGACTC	[29, 31]
ACT-512F	Actin	ATGTGCAAGGCCGGTTTCGC	[28]
ACT-783R	Actin	TACGAGTCCTTCTGGCCCAT	[28]
EF1-728F	Translation Elongation factor 1 alpha	CATCGAGAAGTTCGAGAAGG	[28]
EF2	Translation Elongation factor 1 alpha	GGARGTACCAGTSATCATGTT	[30]

Statistics

A Pearson’s Chi-square test was performed using Microsoft Office Professional Plus Excel 2010.

Results

Identification of Cladosporium species of indoor origin

The Cladosporium collection of the Applied and Industrial Mycology group of the CBS Fungal Biodiversity Centre includes 67 strains from indoor surfaces (swab samples), 39 strains from air samples, and 17 isolates from an unknown indoor origin (Table 1). Out of the 123 indoor Cladosporium isolates, 74 originate from the Netherlands, and 49 from Denmark, France, Germany, Greece, Hungary, Poland, Portugal, Thailand, Algeria and The United States of America. The 123 isolates were identified based on the ITS, ACT and TEF sequences and a phylogenetic tree was constructed (S1 Fig). The collection consisted of 55, 41 and 27 isolates belonging to the species complexes of C. sphaerospermum, C. cladosporioides and C. herbarum, respectively (Table 3). Nine isolates could not be identified to species level since the sequences did not align well with any of the type species used for comparison and might represent new species. From these species, seven grouped in the C. cladosporioides species complex, and one in the C. herbarum and one in the C. sphaerospermum species complex. A total number of 19 different species were identified, of which C. sphaerospermum was most common, followed by C. halotolerans and Cladosporium allicinum (Fig 1). To compare the species distribution of swab and air samples, the 17 strains of unknown indoor origin were excluded. The C. sphaerospermum species complex made up more than 44.7% of the total number of 106 isolates and even 58.2% of the swab isolates (Table 3). The C. cladosporioides species complex comprised 33.3% of the indoor isolates and 22.4% of the swab isolates. The C. herbarum species complex comprised 22.0% of the indoor isolates and 19.4% of the swab isolates (Table 3). A Pearson’s Chi-square test shows significant increased numbers (p-value ≤ 0.05) of C. sphaerospermum species complex in swab samples compared to air samples. This was not observed in the case of the C. herbarum and C. cladosporioides species complexes.

Table 3

The number of isolates from indoor air and surface samples from the 3 species complexes.

Species complex	Surface	%	Air	%	Unknown	%	Total	%
C. sphaerospermum	39	58.2%	9	23.1%	7	41.2%	55	44.7%
C. cladosporioides	15	22.4%	18	46.2%	8	47.0%	41	33.3%
C. herbarum	13	19.4%	12	30.8%	2	11.8%	27	22.0%
Total	67	100%	39	100%	17	100%	123	100%

Fig 1

Incidence of Cladosporium species within the population of indoor isolates.

The origin of the samples (air, indoor surface or unknown origin) is also shown.

Growth of indoor Cladosporium species at lower water activity

Growth of 22 indoor isolates of Cladosporium was compared on media with water activity (aw) values ranging from 0.75 to 0.99. These isolates include 9, 8 and 5 isolates of the C. sphaerospermum, C. cladosporioides and C. herbarum species complexes, respectively, which represent 14 different species (Fig 2). Moreover, the selection made up 7 air samples, 9 swab samples and 6 indoor samples of which the origin (air or swab) is not known. The minimal aw needed to enable growth during a 3-week-period, ranged from 0.82 to 0.87 for the selected Cladosporium species (Table 4). The air isolates showed a minimal aw of 0.82 to 0.87, while the swab samples showed a minimal aw of 0.82 to 0.85. All isolates of C. sphaerospermum and C. halotolerans grew at aw ≥ 0.82. Interestingly, these are also the two most abundant species in indoor air and swab samples. Cladosporium dominicanum and Cladosporium langeronii that also belong to the C. sphaerospermum species complex grew at aw ≥ 0.85. All selected species from the C. herbarum species complex (i.e. C. allicinum, Cladosporium ramotenellum and Cladosporium tenellum and an unidentified species) also grew at aw ≥ 0.85. Cladosporium globisporum and Cladosporium perangustum of the C. cladosporioides species complex grew at aw ≥ 0.85, while Cladosporium australiense, Cladosporium cladosporioides, Cladosporium delicatulum and Cladosporium inversicolor only grew at aw ≥ 0.87. The ability to grow at a particular water activity even differed within a species. Cladosporium pseudocladosporioides CBS 139575 could grow at aw of ≥ 0.85, while C. pseudocladosporioides CBS 139580 grew at aw of ≥ 0.87 (Table 4). Fig 2 summarizes the data and shows that the isolates from the C. sphaerospermum species complex, that are most abundant on indoor surfaces, grow at the lowest water activity. Notably, growth of C. cladosporioides at water activity of 0.98 is clearly faster compared to that of C. halotolerans (Fig 3 and S2 Fig). This shows that the modest xerophily of the C. sphaerospermum species complex is not the result of its higher growth rates compared to C. cladosporioides and C. herbarum.

Fig 2

Schematic dendrogram showing the minimal water activity needed for growth of 22 selected indoor Cladosporium species.

Green, red and yellow represent the C. cladosporioides, C. herbarum and C. sphaerospermum species complexes, respectively.

Table 4

Growth of 22 isolates of Cladosporium on MEA with different water activity.

Species	Strain nr.	Growth rate in increase of Ø (mm day -1) at aw opt	aw opt	aw min
C. allicinum	139578	4.40	0.98	0.85
C. australiense	139572	4.84	0.98	0.87
C. cladosporioides	139571	4.91	0.98	0.87
C. delicatulum	139574	1.98	0.98	0.87
C. dominicanum	139591	1.67	0.94	0.85
C. globisporum	139587	4.24	0.98	0.85
C. halotolerans	139583	3.98	0.98	0.82
C. halotolerans	139585	3.13	0.96	0.82
C. halotolerans	139586	3.80	0.96	0.82
C. halotolerans	139589	3.91	0.96	0.82
C. inversicolor	139573	3.51	0.98	0.87
C. langeronii	139581	1.07	0.94	0.85
C. perangustum	139588	4.35	0.98	0.85
C. pseudocladosporioides	139575	5.66	0.98	0.85
C. pseudocladosporioides	139580	5.53	0.98	0.87
C. ramotenellum	139577	4.16	0.98	0.85
C. ramotenellum	139590	4.40	0.98	0.85
C. sphaerospermum	139576	4.47	0.96	0.82
C. sphaerospermum	139579	3.72	0.96	0.82
C. sphaerospermum	139584	3.45	0.96	0.82
C. tenellum	139582	3.55	0.98	0.85
Unidentified herbarum	DTO 090-H8	2.83	0.96	0.85

Growth rate (increase in diameter, Ø) in mm day-1 is shown for each isolate at the optimal aw at 25°C.

Fig 3

Increase in colony diameter in mm day-1 of Cladosporium cladosporioides CBS 139571 and Cladosporium halotolerans CBS 139586 at varying aw at 25°C.

Discussion

Cladosporium species are among the most abundant fungi in outdoor and indoor air [8, 11, 13]. In fact, C. cladosporioides was reported to be the most predominant fungus in houses in Ontario and Atlanta [11, 13]. Recently, classification of the genus Cladosporium has been revised on the basis of morphology and multi-locus sequencing [19, 20, 25, 26]. This novel classification was used in our study where we sequenced the same genes and compared the data. Our data showed that members of the C. sphaerospermum species complex are the most predominant indoor fungi, which were found in 44.7% of the indoor samples and 58% of indoor swabs. Notably, moderate xerotolerancy of the species (0.82–0.85) correlated with the presence of these species on indoor surfaces.

Generally, indoor levels of fungi are lower than outdoor and are related to the outdoor species composition. The composition of fungi in the indoor environment is highly similar to the outdoor air in well-ventilated houses [6, 8, 9, 13, 35, 36]. Indoor surfaces have been described as passive collectors of airborne fungi of outdoor origin. Yet, different surface types harbor different fungal populations. This indicates that the composition of fungal populations on surfaces can deviate from that of the outdoor and indoor air. This is supported by our finding that C. sphaerospermum species complex isolates are more prominent on indoor surfaces when compared to air samples. These effects might be more pronounced in winter when air replacement with outdoor air in dwellings is markedly lower [8].

Cladosporium species are not reported as producers of mycotoxins. Nonetheless, they may represent a threat to health. Cladosporium species from all three species complexes are reported to cause fungal allergies [4, 37–41], especially in patients with severe asthma [3, 42]. The dominance of the C. sphaerospermum species complex in indoor environments is of interest as C. herbarum is the most studied species in allergy research [43, 44]. Cell extracts of C. herbarum are used for allergy tests, particularly in skin prick tests [37, 44]. Not much is known about the Cladosporium proteins raising allergy. Enolase, aldehyde dehydrogenase and mannitol dehydrogenase (MDH) are known allergens from C. herbarum [43]. The C. herbarum MDH shows an identity of 83.9% with the Cladosporium fulvum MDH [45] and 92.6% identity with the same locus in an isolate of C. sphaerospermum isolated from blood culture and of which the full genome is sequenced [46]. However, we would like to stress that the identification of C. sphaerospermum in the abovementioned study is based on the sequence of the ITS region. By using BLAST we have also identified the sequences of the TEF, ITS and ACT loci. These sequences were aligned to data of Bensch et. al. and group in the phylogenetic tree with C. halotolerans as is shown in S1 Fig. [25]. Therefore, we propose to evaluate cross-reactivity of the allergens of the different Cladosporia. Specifically the common indoor fungi, C. sphaerospermum, C. halotolerans and C. allicinum, should be evaluated to assess whether the screening panels of these fungi have to be adapted.

Phylogram based on neighbor joining analysis showing all used isolates, including C. sphaerospermum UM843, supplemented with reference sequences from Bensch et al. (2012).

Statistical support was calculated by using 1000 bootstrap replicates. Bootstrap values below 70% are not shown. This phylogram was made using pairwise deletion and the nucleotide substitution model, Tamura Nei, with gamma distribution parameter 4.

(EPS)

Click here for additional data file.

The growth speed (increase of colony diameter in mm day-1) of 22 Cladosporium species at different aw at 25°C.

(EPS)

Click here for additional data file.