Rickettsia amblyommii infecting Amblyomma sculptum in endemic spotted fever area from southeastern Brazil.

The Rickettsia bacteria include the aetiological agents for the human spotted fever (SF) disease. In the present study, a SF group Rickettsia amblyommii related bacterium was detected in a field collected Amblyomma sculptum (Amblyomma cajennense species complex) tick from a Brazilian SF endemic site in southeastern Brazil, in the municipality of Juiz de Fora, state of Minas Gerais. Genetic analysis based on genes ompA,ompB and htrA showed that the detected strain, named R. amblyommii str. JF, is related to the species R. amblyommii.

Over the past 14 years, the number of rickettsial species identified in South America increased from three to more than 10. Initially, only occurrences of Rickettsia prowazekii, Rickettsia typhi, and Rickettsia rickettsii were historically reported, followed by most recent detection ofRickettsia felis, Rickettsia parkeri,Rickettsia belli, Rickettsia massiliae,Rickettsia rhipicephali, and Rickettsia amblyommiifrom different environmental samples (Labruna 2009).

Among those cited, six species belong to the spotted fever group (SFG), including the known human pathogens R. rickettsii, R. felis,R. Parkeri, and R. massiliae, each causing specific rickettsiosis, whereas R. rhipicephali and R. amblyommii are classified as with still unknown/unclear pathogenicity (Merhej et al. 2014).

R. rickettsii is the aetiologic agent of the Rocky Mountain SF, the most severe of all tick-borne rickettsiosis (Parola et al. 2005). In Brazil this species causes the Brazilian SF (BSF), a disease that in the last 14 years was reported in 1,421 cases throughout Brazil, according to official data of the Information System on Notifiable Diseases (dtr2004.saude.gov.br/sinanweb/). During the period of 1995-2004, there were 334 laboratory-confirmed cases of BSF with a 31% lethality rate in the Southeast Region of Brazil. Additional 128 cases, with lethality of 29%, were confirmed from 2005-2007 only in the state of São Paulo (Labruna 2009). In the state of Minas Gerais other BSF cases were also confirmed and in the endemic area of the city of Juiz de Fora, 24 cases were actually confirmed between 2001-2014 (dtr2004.saude.gov.br/sinanweb/). According to Pacheco et al. (2011), 17 cases were notified between 1995-2008, with a lethality of 29%.

Ticks are the most important vectors for SF transmission. In South America, the tickAmblyomma cajen- nense has been considered to be the most frequent vector related with SF cases. Interestingly recent genetic and morphological/microscopic analyses showed evidence that A. cajennense in fact represents a complex grouping six tick species (A. cajennensesensu lato ors.l.) (Beati et al. 2013,Nava et al. 2014).

The endemicity of BSF leads Juiz de Fora Health Office to promote a constant environmental monitoring of ticks. Forty-eight horses fed A. sculptumticks were obtained during this vigilance and the specimens were identified according to the new description of species that belong to the A. cajennense complex (Nava et al. 2014). The neighbourhoods known as Previdenciários and Monte Castelo were visited and both areas had confirmed human BSF cases. Sampled ticks were processed for molecular analysis and initially submitted to DNA extraction as described elsewhere [method with NaCl (Aljanabi & Martinez 1997)].

Rickettsia infected ticks were identified by polymerase chain reaction (PCR) screening for the rickettsial ompA, ompB andhtrA genes in 25 μL conventional PCR reactions under the temperature/time cycle: 94ºC 3 min and 30 s (94ºC 30 s, 55ºC 30 s, 72ºC 1 min/Kb] 40X, 72ºC 7 min, 20ºC ∞. R. parkeri str. AT#24 DNA was used as a positive control. The primers used were Rr190.70F and Rr190.602R (Regnery et al. 1991) for ompA gene, Rr1175F and Rr2608R (Blair et al. 2004) for htrAgene and ompB3064-F (5’ggtatagccggaataggttttgacg, present study) and ompB4271-R (5’tcagttttagtgataccgatagcagc, present study) for ompB gene. PCR products were purified using HiYieldTM Gel/PCR DNA Mini Kit according to manufacturer (Real GenomicsTM, New Zealand), sequenced in both directions on an automated ABI 3130xl Genetic Analyser (Applied Biosystems®, USA) and using the same primers applied for the initial PCR amplifications. Sequence edition was performed with Lasergene software packages (DNASTAR, USA).

One A. sculptum female was positive for Rickettsiainfection as determined by the PCR tests. PCR amplicons of 512 bp, 1,208 bp, and 434 bp were obtained using the primer sets for ompA, ompB andhtrA, respectively.

A phylogenetic tree was constructed with concatenated ompA,ompB and htrA sequences, neighbour-joining methods [MEGA 5.2 (Tamura et al. 2011)], and Kimura two-parameter model to estimate genetic divergence (Kimura 1980) and bootstrap values were obtained from 1,000 randomly generated trees. The resulting tree showed that the presently identified strain, here named R.amblyommii str. JF, is most closely related to R. amblyommii (Figure).

Phylogenetic tree of concatenated spotted fever group rickettsiaeompA, ompB and htrAgenes constructed by neighbour-joining method with Kimura two-parameter as evolution model and based on the nucleotide sequences. The GenBank accession codes are presented in parenthesis. The numbers at nodes are the bootstrap values obtained from 1,000 re-samplings. Bootstrap values bellow 70% are not present.

The first detection of R. amblyommii occurred after analysis ofAmblyomma americanum ticks in the United States of America (Burgdorfer et al. 1981). After that, R. amblyommii and other genetically related species were found in a wide variety of tick species in different countries in the New World (Labruna et al. 2007, Zanettii et al. 2008, Hun et al. 2011, Saraiva et al. 2013). In the present study, aR. amblyommii related infection was characterised in an A. sculptum sample, an A. cajennense-complex species abundantly observed in Juiz de Fora. Other bacteria genetically related to R. amblyommii was previously found associated with A. cajennenses.l. from Brazil (Labruna et al. 2004, Soares et al. 2015) and Alves et al. (2014) provided the first description of R. amblyommii-like infection in A. sculptumtick.

Despite the amount of studies on Rickettsia performed in thousands of ticks sampled in southeastern Brazil (Guedes et al. 2005, Gehrke et al. 2009, Pacheco et al. 2009), the present paper is the first report of a R. amblyommii related SFG infecting A. sculptum in this region.

Several reports indicate that R. amblyommii is commonly found in ticks parasitising human (Jiang et al. 2010, Lee et al. 2014) and the observed R. amblyommii in Juiz de Fora could distinctly represent an unusual rickettsiosis agent. Primarily nonpathogenic Rickettsia is able to cause disease under some circumstances, as reported for R. parkeri(Paddock et al. 2004). The pathogenic potential of R. amblyommii and genotypically similar strains is still speculative, but increasingly studies have associate these bacteria to rickettsiosis cases (Taylor et al. 1985, Yevich et al. 1995, Billeter et al. 2007, Apperson et al. 2008).

The potential pathogenic capacity of R. amblyommii would bring major concerns in terms of public health since this bacterium can infect a variety of vertebrate hosts with wide distribution, including species with dense populations and commonly found in parks or recreational areas (Blanton et al. 2014).

Despite that not all ticks can actively feed and parasitise humans, serological data obtained from dogs and horses showed the circulation of R. amblyommiiin domestic animals (Barrett et al. 2014). Frequent infestation of these animals with specific tick species could facilitate the transmission of this bacterium to humans. Indeed, ticks frequently found on dogs and horses have been reported to be able to support R.amblyommii infection (Bermúdez et al. 2009, Eremeeva et al. 2009) and this bacterium seems to be well adapted to its hosts, presenting highly successful transmission rates (Burgdorfer et al. 1981, Saraiva et al. 2013).

Taking together, these observations suggest that this bacterium may be involved in cases of atypical SF cases and show the need for further studies to elucidate its real pathogenic potential. Although the R. amblyommii pathogenic status remains unclear, the present study brings new contribution to the understanding of its complex vector/host network.