Literature DB >> 26674414

RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA.

Yalei Cui1, Tianzhi Huang1, Xiaobo Zhang2.   

Abstract

MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex.
© 2015 The Authors.

Entities:  

Keywords:  RNA editing; adenosine deaminase acting on RNA; miRNA-induced silencing complex; virus latency

Mesh:

Substances:

Year:  2015        PMID: 26674414      PMCID: PMC4703055          DOI: 10.1098/rsob.150126

Source DB:  PubMed          Journal:  Open Biol        ISSN: 2046-2441            Impact factor:   6.411


Introduction

Post-transcriptional mechanisms play important roles in the regulation of gene expression. RNA editing is one of the most important mechanisms of post-transcriptional genetic modification and generates a variety of cellular RNA signatures by base substitutions, insertions and deletions. The best characterized form of RNA editing found in mammals is base substitution of C to U (cytosine to uracil) and A to I (adenosine to inosine) [1]. The hydrolytic deamination of adenosine to inosine is catalysed by ADAR (adenosine deaminase acting on RNA) proteins [2]. A-to-I RNA editing is conserved from sea anemones to Homo sapiens and represents an irreversible RNA modification [3]. The targets of ADARs are double-stranded regions of at least 15–20 base pairs [4], and following A-to-I RNA editing, the translational machinery recognizes inosine (I) as guanosine (G), producing different protein isoforms. The RNA editing involved in forming the coding region of the glutamate receptor subunit GluR-B is a well-known example [5]. Alternative ADAR2-mediated editing of GluR-B alters the gene-encoded glutamine (Q) codon CAG to the arginine (R) codon CIG, producing an ion channel that is impermeable to Ca2+ [5]. Additionally, RNA editing of the serotonin (5-HT) receptor 2C (5-HT) affects its G-protein-binding affinity [6]. However, bioinformatic analyses report that the majority of A → I RNA editing sites exist in noncoding sequences, 5′ and 3′ untranslated regions (UTRs), intronic retrotransposon elements and repetitive sequences [7-9], and the role of the RNA editing in these regions is largely unknown. MicroRNAs (miRNAs) also undergo RNA editing [10-12]. MiRNAs, generated from primary genome transcripts, integrate with Argonaut (Ago) to produce miRNA-induced silencing complexes (miRISC) that suppress expression of their target genes [13]. Mature miRNA ‘seed sequences' recognize target sites in mRNA, and miRNAs predominantly target sequences in the 3′ UTR of mRNAs. Binding of the miRISC can cause mRNA destabilization and/or inhibition of translation [14,15]. RNA editing can shield miRNA from recognition and processing by Drosha and Dicer, and even alter the seed sequence, and thus mRNA target. A-to-I editing of the primary transcript of miR-142 shields this miRNA from processing by Drosha, reducing expression of mature miR-142 [12]. Editing of the fold-back double-stranded RNA (dsRNA) structure of primary miR-151 inhibits its cleavage by Dicer, causing accumulation of edited pre-miR-151 intermediate RNA [16]. Editing of primary miR-376 at the +4 and +44 sites within the seed sequences of miRNA-376-5p and -3p strands alters the miRNA's seed sequence, and thus mRNA target [11]. At present, however, the functional consequences of these miRNA editing processes remain unclear. As virus life cycles are short and can be completed within a single cell, a virus may represent a useful model in which to explore the mechanism of RNA editing. A-to-I RNA editing of viral mRNAs has been reported to be crucial for replication of hepatitis D virus (HDV) [17]. And although DNA viruses are reported to encode miRNAs [18,19], the role of viral miRNA editing in virus–host interactions has not been intensively explored. In this study, we characterized miRNA–mRNA interactions in Marsupenaeus japonicus shrimp haemocytes infected with white spot syndrome virus (WSSV). Based on the morphology and genomic composition, WSSV is assigned to a distinct virus family, Nimaviridae [20]. WSSV with 305-kb circular double-stranded genomic DNA has the capacity to encode 180 viral proteins and 89 viral miRNAs [18,19,21]. During WSSV infection, early genes, transcribed before 6 h post-infection, encode the viral regulatory proteins [22,23]. As reported, most of the WSSV miRNAs are transcribed at the early stage of virus infection [18,24]. The viral miRNAs regulate the expressions of the virus and/or host target genes in the WSSV–shrimp interactions [19,24,25]. In the present investigation, it was found that one viral miRNA (WSSV-miRNA-N12) underwent A-to-I RNA editing at its non-seed sequence, and this editing was dependent on the host ADAR. The edited miRNA no longer recognized its target gene, WSSV early gene wsv399, leading to accumulation of off-target miRNA in the Ago complex, thus preventing target gene silencing. At present, the function of wsv399 has not been characterized. The results of this study revealed that the silencing of wsv399 promoted the WSSV infection. In this context, the RNA editing of viral miRNA played an important role in viral latency. Thus, we have characterized a novel example of miRNA editing and miRNA–mRNA interactions in virus-infected animals.

Results

Characterization of miRNAs and mRNAs in the Ago1 complex of shrimp in response to virus infection

To investigate the miRNAs involved in antiviral immunity, shrimp were infected with WSSV, and the RNA contained within shrimp haemocyte Ago1 complexes was sequenced. We confirmed WSSV infection of shrimp (figure 1a), and co-immunoprecipitated the Ago1 complexes of infected haemocytes with an Ago1-specific antibody at 0, 24 and 48 h post-infection. The RNAs (mRNA and miRNA) contained in these complexes were extracted and subjected to deep sequencing. For example, the RNAs extracted from the Ago1 complex of WSSV-infected haemocytes 24 h post-infection were illustrated in figure 1b.
Figure 1.

Host and virus miRNAs and mRNAs in the Ago1 complex. (a) The copy number of WSSV genomic DNA in the haemocytes of virus-infected shrimp pre-infection (0), and 24 and 48 h post-infection was quantified using quantitative real-time PCR. (b) The Ago1 complex of virus-infected shrimp haemocytes was co-immunoprecipitated with Ago1-specific antibody. Then the complex was analysed by western blot analysis (i). The anti-GST antibody was used as a control. RNAs in the Ago1 complex were extracted (ii) and subjected to sequencing. M, protein marker or RNA marker. (c) Size distribution of small RNAs in the Ago1 complex pre-infection (0), and 24 and 48 h post-infection. (d) Percentages of sequence reads of shrimp and viral miRNAs in the Ago1 complex of shrimp pre-infection (0), and 24 and 48 h post-infection. (e) The shrimp miRNA (i) and WSSV-miRNA (ii) expression profiles of WSSV-challenged shrimp pre-infection (0), and 24 and 48 h post-infection The numbers on the right indicated the log10 of the number of copies of miRNAs. (f) Northern blots of selected shrimp and WSSV miRNAs. Total RNAs extracted from the Ago1 complexes of virus-free or WSSV-infected shrimp haemocytes were blotted with the DIG-labelled oligodeoxynucleotide probes pre-infection (0), and 24 and 48 h post-infection. (g) Heat map of differentially expressed shrimp and WSSV genes in the Ago1 complex of shrimp haemocytes. The shrimp were infected with WSSV. mRNAs in the Ago1 complex of shrimp haemocytes were sequenced pre-infection (0), and 24 and 48 h post-infection. The colours indicate the Z-values of genes. (h) Real-time PCR detection of gene expression profiles of shrimp in response to WSSV pre-infection (0), and 24 and 48 h post-infection.

Host and virus miRNAs and mRNAs in the Ago1 complex. (a) The copy number of WSSV genomic DNA in the haemocytes of virus-infected shrimp pre-infection (0), and 24 and 48 h post-infection was quantified using quantitative real-time PCR. (b) The Ago1 complex of virus-infected shrimp haemocytes was co-immunoprecipitated with Ago1-specific antibody. Then the complex was analysed by western blot analysis (i). The anti-GST antibody was used as a control. RNAs in the Ago1 complex were extracted (ii) and subjected to sequencing. M, protein marker or RNA marker. (c) Size distribution of small RNAs in the Ago1 complex pre-infection (0), and 24 and 48 h post-infection. (d) Percentages of sequence reads of shrimp and viral miRNAs in the Ago1 complex of shrimp pre-infection (0), and 24 and 48 h post-infection. (e) The shrimp miRNA (i) and WSSV-miRNA (ii) expression profiles of WSSV-challenged shrimp pre-infection (0), and 24 and 48 h post-infection The numbers on the right indicated the log10 of the number of copies of miRNAs. (f) Northern blots of selected shrimp and WSSV miRNAs. Total RNAs extracted from the Ago1 complexes of virus-free or WSSV-infected shrimp haemocytes were blotted with the DIG-labelled oligodeoxynucleotide probes pre-infection (0), and 24 and 48 h post-infection. (g) Heat map of differentially expressed shrimp and WSSV genes in the Ago1 complex of shrimp haemocytes. The shrimp were infected with WSSV. mRNAs in the Ago1 complex of shrimp haemocytes were sequenced pre-infection (0), and 24 and 48 h post-infection. The colours indicate the Z-values of genes. (h) Real-time PCR detection of gene expression profiles of shrimp in response to WSSV pre-infection (0), and 24 and 48 h post-infection. High-throughput small RNA sequencing yielded an average of 2 318 149 high-quality reads. Most small RNA reads were 20–25 nucleotides (nt) in length, which was typical for products generated by the enzyme Dicer (figure 1c). A total of 1 629 369 high-quality small RNA reads were mapped to known animal miRNAs or WSSV miRNAs, and 55 known shrimp miRNAs [26] and 45 known WSSV miRNAs [18,19] were identified (tables 1 and 2). The remaining nine candidate miRNAs, with no homologue, included seven shrimp putative miRNAs (mja-miR-27, mja-miR-28, mja-miR-29, mja-miR-30, mja-miR-31, mja-miR-32 and mja-miR-33) and two putative WSSV miRNAs (WSSV-miR-N50 and WSSV-miR-N51; tables 1 and 2). The WSSV miRNAs accumulated in shrimp at 24 and 48 h post-infection, and accounted for over 12% of the total small RNAs sequenced at 48 h post-infection (figure 1d). Some shrimp miRNAs were upregulated and some downregulated in response to virus infection, while viral miRNAs were detected only after WSSV infection (figure 1e). To confirm the involvement of these shrimp and viral miRNAs in WSSV infection, the expression of 11 randomly selected miRNAs was detected by northern blotting. The expression patterns of these miRNAs revealed by northern blots were similar to those revealed by sequencing (figure 1f).
Table 1.

Shrimp miRNAs in Ago1 complex.

namesequence (5′–3′)length (nt)references of reported microRNAs
miR-1UGGAAUGUAAAGAAGUAUGGAG22Huang et al. [26]
miR-10aUACCCUGUAGAUCCGAAUUUGU22Huang et al. [26]
miR-100AACCCGUAGAUCCGAACUUGUG22Huang et al. [26]
miR-1000AUAUUGUCCCGUCACAGCAGUA22Huang et al. [26]
miR-12UGAGUAUUACAUCAGGUACUGGU23Huang et al. [26]
miR-122GGAGUGUGACACUGGUGUUUG21
miR-133UUGGUCCCCUUCAACCAGCUGU22Huang et al. [26]
miR-184UGGACGGAGAACUGAUAAGGGC22Huang et al. [26]
miR-190AGAUAUGUUUGAUAUUCUUGGUUG24Huang et al. [26]
miR-193UACUGGCCUGCUAAGUCCCAA21Huang et al. [26]
miR-2aUAUCACAGCCAGCUUUGAUGAGCG24Huang et al. [26]
miR-2001UUGUGACCGUUAUAAUGGGCA21Huang et al. [26]
miR-235UUGCACUUUCCCCGGCCU18
miR-252CUAAGUACUAGUGCCGCAGGAG22Huang et al. [26]
miR-252bCUAAGUAGUAGUGCCGCAGGUAA23Huang et al. [26]
miR-263aAAUGGCACUGGAAGAAUUCACGG23Huang et al. [26]
miR-263bCUUGGCACUGGAAGAAUUCACAUAGU26
miR-275UCAGGUACCUGAUGUAGCGCG21Huang et al. [26]
miR-276UAGGAACUUCAUACCGUGCUCU22Huang et al. [26]
miR-2765UUAGUAACUCCACCACCGUUGG22
miR-278UCGGUGGGACUCUCGUCCGUUU22Huang et al. [26]
miR-2788CACUGCCCUUGGAAAUCCCAAA22
miR-279UGACUAGAUCCACACUCAUCCA22Huang et al. [26]
miR-281CUGUCAUGGAGUUGCUCUCUUU22Huang et al. [26]
miR-282UAGCCUCUCCUUGGCUUUGUCU22Huang et al. [26]
miR-30aUGUAAACCUCCUCGACUGGAAGC23
miR-3017bGCACCGGACUGGCGGGGAA19
miR-305AUUGUACUUCAUCAGGUGCUCGG23Huang et al. [26]
miR-306aUCAGGUACUACGUGACUCUG20
miR-315UUUUGAUUGUUGCUCAGAAGG21Huang et al. [26]
miR-316UGUCUUUUUCUGCUUUGCUGCC22
miR-317UGAACACAGCUGGUGGUAUCUCAGU25Huang et al. [26]
miR-320aAAGCUGGGUUGAGAGGGCGAAUA23
miR-33AUGCAUUGUAGUUGCAUUGCA21Huang et al. [26]
miR-34UGGCAGUGUGGUUAGCUGGUUGU23Huang et al. [26]
miR-378aACUGGACUUGGAGUCAGAAG20
miR-5097GUUCAGGUCCCUGUUUG17
miR-5112UGGGGUGUAGCUCAGUGG18
miR-5592UUCCCGGUCGAUGCACCA18
miR-7UGGAAGACUAGUGAUUUUGUUGUU24Huang et al. [26]
miR-71UGAAAGACAUGGGUAGUGAGAU22Huang et al. [26]
miR-745CAGCUGCCCAAUGAAGGGCUGU22
miR-750CCAGAUCUAACUCUUCCAGCUCA23Huang et al. [26]
miR-8UAAUACUGUCAGGUAAAGAUGUA23Huang et al. [26]
miR-9UCUUUGGUGAUCUAGCUGUAUGA23Huang et al. [26]
miR-92bAAUUGCACUAGUCCCGGCCUG21Huang et al. [26]
miR-965UAAGCGUAUGGCUUUUCCCCUC22Huang et al. [26]
miR-981UUCGUUGUCGUCGAAACCUGCAU23Huang et al. [26]
miR-993GAAGCUCGUUUCUACAGGUAUCU23Huang et al. [26]
miR-995UAGCACCACAGGAUUCAGC19
miR-bantamUGAGAUCAUUGUGAAAGCUGAUUAU25Huang et al. [26]
miR-let-7UGAGGUAGUAGGUUGUAUAGUU22Huang et al. [26]
mja-miR-27AAGCGGGAAACCGCGCUGAGCUU23
mja-miR-28CGCCCUCGGGUCGACGGA18
mja-miR-29AUACAAACAUGACUUCUAU19
mja-miR-30UCGCUCCGAGCUCGGACCCGACC23
mja-miR-31GAGGGAGAAGGACUGGGCGAGGG23
mja-miR-32UGACUAGACUCUUACUCAUCUG22
mja-miR-33UCGCUCCGAGCUCGGACCCGACC23
miR-S6AAUGGUCUAGUGAGGGCACCG21Huang et al. [26]
miR-S7GCGGUAGCCCGGGCAAGA18Huang et al. [26]
miR-S8GUUGACCGAAGCGGAGGAG19Huang et al. [26]
Table 2.

WSSV miRNAs in Ago1 complex.

namesequence (5′–3′)length (nt)references of reported microRNAs
WSSV-miR-N4GGAGCAACAGUCGGUUCUGG20Huang et al. [19]
WSSV-miR-N5CACUUGGCGGUCAUCGUUUUGAA23Huang et al. [19]
WSSV-miR-N6GAAACGACUGUUGCUCCAGAAAC23Huang et al. [19]
WSSV-miR-N7GAUGAUGGAGAAGAAGCGACU21Huang et al. [19]
WSSV-miR-N8GUAGUUGUAGAAUUAACAUCAUCCU25Huang et al. [19]
WSSV-miR-N11AUCAAUUUCUUCCUCUUCUUCCU23Huang et al. [19]
WSSV-miR-N12UUUUAUCGAGAGAAUGAGAAUA22Huang et al. [19]
WSSV-miR-N13ACAUGAUUGACGAUAGGUUGACU23Huang et al. [19]
WSSV-miR-N14GAGGAGGAGGAGGAUGAAGAA21Huang et al. [19]
WSSV-miR-N16AUCCGAUGAGUAUGAUUUUGAUGAU25Huang et al. [19]
WSSV-miR-N17CCUGAAAUGACUGCAGAUUUAUUG24Huang et al. [19]
WSSV-miR-N18GAAGAAGAAUGGUCUCUAAGCA22Huang et al. [19]
WSSV-miR-N19GUGGGAGAAUCAUGUGUAUGGA22Huang et al. [19]
WSSV-miR-N20GUUGUCAAUCAUUGUAUUUUGUC23Huang et al. [19]
WSSV-miR-N22GGGGCGUAAAAAGACUGUAGG21Huang et al. [19]
WSSV-miR-N23GUGGUCUUAACGAAGGGCAUU21Huang et al. [19]
WSSV-miR-N24GUAUGAGUAGUGAUGAAGAAUCA23Huang et al. [19]
WSSV-miR-N26UAUUUGUCUUGGAAGUAACUU21Huang et al. [19]
WSSV-miR-N28UUCGAGUGUCCGAAUAUUCGCGUC24Huang et al. [19]
WSSV-miR-N29AAGAGGACAAAAACACAGGGU21Huang et al. [19]
WSSV-miR-N30AUUGGCCUAGAUGACUCUGUAGAUU25Huang et al. [19]
WSSV-miR-N33GACGUGCGAUAUUUCUGCCUU21Huang et al. [19]
WSSV-miR-N34CACCGACGGCUUUUUUAAUGCA22Huang et al. [19]
WSSV-miR-N36AGUUUCUGUAUUGACAGAUA20Huang et al. [19]
WSSV-miR-N37UUUAGAGCAAUUUCUCGCUCAG22Huang et al. [19]
WSSV-miR-N38UUAGUCGGUAUCGGAAUCAGUG22Huang et al. [19]
WSSV-miR-N39UGAGGAUAGUGGACAUGUUGAA22Huang et al. [19]
WSSV-miR-N40AUCGAGGAUGAACAUGCAAGACA23Huang et al. [19]
WSSV-miR-N41GAAGAAAUUUGGGGUAGGCAUC22Huang et al. [19]
WSSV-miR-N44CGACGACGGAUCUUCUACAUC21Huang et al. [19]
WSSV-miR-N45GAGGACUUUCUAAGCAUGAGAAA23Huang et al. [19]
WSSV-miR-N46AGUGCCAAGAUAACGGUUGAAG22Huang et al. [19]
WSSV-miR-N48ACGAGGAGAUGGUUGGGGACU21Huang et al. [19]
WSSV-miR-N49GUGAGAUUUGGUUUCAUGCCC21Huang et al. [19]
WSSV-miR-73UAGUAGUAAUAAGAAGAGGAAG22He et al. [18]
WSSV-miR-82CUCAGUAUUCCUGUUGUGUAUU22He et al. [18]
WSSV-miR-105CACAACAAGCACUCUCUCUCCU22He et al. [18]
WSSV-miR-110CCUAAAAAAAUCACCGCCUAUU22He et al. [18]
WSSV-miR-134AACCAGAGUUCAUAAACAAGUU22He et al. [18]
WSSV-miR-142UGGUGAUUACAUCCUCUCUCCG22He et al. [18]
WSSV-miR-156UUUUAUGAUACCAUUAAGACAC22He et al. [18]
WSSV-miR-180CCAUAACAAUCAUCUUCAUCAU22He et al. [18]
WSSV-miR-195AUAAAAACAAGUGGAAUAAUUU22He et al. [18]
WSSV-miR-201CGUUGUGCCGUCUCUGAAGAAC22He et al. [18]
WSSV-miR-214AAGAAGAAGAAGAAGAAGAAUAU22He et al. [18]
WSSV-miR-N50GAGCGCACCGAGCGUCUGAGGAA23
WSSV-miR-N51GAGGUUGGCAGAUUCGGCUGCU22
Shrimp miRNAs in Ago1 complex. WSSV miRNAs in Ago1 complex. To investigate potential target genes of shrimp and WSSV miRNAs, the mRNAs in the Ago1 complexes of shrimp haemocytes challenged with WSSV were sequenced at 0, 24 and 48 h post-infection. After removal of repetitive and low-quality reads, a total of 5.21 million high-quality reads were aligned to the assembled expressed sequence tags (ESTs) of shrimp or to the WSSV genome sequence. The results included 265 400 unigenes. Among them, only a small proportion (0.033%) of the reads originated from WSSV transcripts. Cluster analysis revealed that the pattern of mRNA expression changed throughout the time course of WSSV infection (figure 1g). In comparison to uninfected cells (0 h post-infection), 984 genes were significantly differentially expressed (p < 0.01), of which 513 genes were upregulated and 471 were downregulated. To confirm the gene expression profiles of shrimp in response to WSSV infection, three genes were randomly selected for quantitative real-time PCR. The gene expression patterns revealed by quantitative real-time PCR were similar to those revealed by sequencing (figure 1h).

Interactions between miRNAs and mRNAs in the Ago1 complex

In order to evaluate the roles of these miRNAs, their mRNA targets were analysed. Approximately 40% of target RNA tags were aligned to 3′ UTRs and 20% to coding sequences, while only 3–4% were aligned to 5′ UTRs (figure 2a).
Figure 2.

Interactions between miRNAs and mRNAs in Ago1 complex of shrimp. (a) Distribution of target RNA-annotated clusters across transcripts from Ago1 complex of virus-free and virus-infected shrimp pre-infection (0), and 24 and 48 h post-infection. The numbers indicated the time points of virus infection. (b) Numbers of genes targeted by host and virus miRNAs detected at 0, 24 and 48 h post-infection. (c) Function and pathway analyses of genes targeted by miRNAs. GO was performed by comparing the coding sequences of the transcripts in the Ago1 complex with the GO database with the blast E-value of less than 1 × 10−5. KEGG classifications of the genes were simultaneously characterized. (d) Heat map generated from GO analysis of transcripts targeted by the top 20 miRNAs with high expression level. Tree showed the hierarchical clustering of miRNAs based on GO analysis. The colours indicated the significant differences between clusters.

Interactions between miRNAs and mRNAs in Ago1 complex of shrimp. (a) Distribution of target RNA-annotated clusters across transcripts from Ago1 complex of virus-free and virus-infected shrimp pre-infection (0), and 24 and 48 h post-infection. The numbers indicated the time points of virus infection. (b) Numbers of genes targeted by host and virus miRNAs detected at 0, 24 and 48 h post-infection. (c) Function and pathway analyses of genes targeted by miRNAs. GO was performed by comparing the coding sequences of the transcripts in the Ago1 complex with the GO database with the blast E-value of less than 1 × 10−5. KEGG classifications of the genes were simultaneously characterized. (d) Heat map generated from GO analysis of transcripts targeted by the top 20 miRNAs with high expression level. Tree showed the hierarchical clustering of miRNAs based on GO analysis. The colours indicated the significant differences between clusters. Both shrimp genes and WSSV genes were targeted by shrimp miRNAs and WSSV miRNAs (figure 2b). During virus infection, the number of shrimp transcripts targeted by WSSV miRNAs increased from 77 276 (24 h) to 90 835 (48 h) (figure 2b), and the number of WSSV transcripts targeted exclusively by shrimp miRNAs increased from 62 (24 h) to 72 (48 h), while the number of WSSV transcripts targeted by WSSV miRNAs increased from 65 (24 h) to 79 (48 h) (figure 2b). Together, shrimp and WSSV miRNAs targeted 3038–4024 shrimp transcripts, and two WSSV genes (figure 2b). These findings suggested that both host and viral gene expression was regulated by shrimp miRNAs and/or WSSV miRNAs during virus infection. To investigate the functions and pathways of miRNA target genes, the coding sequences of Ago1 complex transcripts were analysed with the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genome (KEGG). The GO analysis revealed that most identified genes were associated with membrane-enclosed lumen, organelles, macromolecular complexes and membranes, while many genes were involved in viral reproduction and immune system processes (figure 2c). The miRNA target genes were classified into 239 KEGG pathways. Some were involved in pathogen–host interactions, the NF-κB cascade, RNA interference, the Toll-like signalling pathway, the JAK–STAT cascade, the Wnt signalling pathway and the Notch signalling pathway (figure 2c). The 20 most highly expressed miRNAs targeted genes involved in host immunity including phagocytosis, endocytosis, virus–host interaction, apoptosis, autophagy, NF-κB and RNAi (figure 2d). These data suggest that these miRNAs played important roles in immunity.

Viral miRNA editing mediated by host adenosine deaminase acting on RNA

To further characterize these viral miRNAs, their sequences were compared to the WSSV genomic DNA sequence. Sequence analysis identified one A-to-G editing site in WSSV-miRNA-N12 (figure 3a). It was the only case of WSSV-miRNA editing based on sequence analysis. The sequencing data showed that the percentage of the edited WSSV-miR-N12 accounted for 31% (24 h post-infection) and 5.8% (48 h post-infection) of the total WSSV-miRNA-N12 sequences. A-to-G editing is prevalent in human mRNAs. Analysis of the predicted hairpin structure revealed that the precursor of WSSV-miRNA-N12 could form a fold-back structure (figure 3b) which can be edited by ADAR, which catalyses A-to-I RNA editing in humans [4]. To investigate the mechanism of viral miRNA (WSSV-miRNA-N12) editing, the shrimp ADAR gene was cloned (GenBank accession no. AHK23065.1). The shrimp ADAR contained two dsRNA-binding domains and one dsRNA adenosine deaminase domain. Neighbour-joining phylogenetic tree analysis indicated that ADAR was highly conserved in animals (figure 3c).
Figure 3.

Viral miRNA editing mediated by host adenosine deaminase acting on RNA (ADAR). (a) Comparison of WSSV-miR-N12 mature sequence with the WSSV genomic DNA sequence. The editing site was coloured. (b) The predicted hairpin structure of WSSV-miRNA-N12 precursor using mFold software (http://frontend.bioinfo.rpi.edu/applications/mfold/). Red indicates the mature sequence of WSSV-miRNA-N12. Green indicates the potential A-to-I editing site. (c) Neighbour-joining phylogenetic tree analysis of ADAR proteins of vertebrates and invertebrates. Bootstrap values are shown. The bar represents the distance. hsa, Homo sapiens; mmu, Mus musculus; xtr, Xenopus (Silurana) tropicalis; gga, Gallus gallus; dre, Danio rerio; dme, Drosophila melanogaster; ame, Apis mellifera; cel, Caenorhabditis elegans; zne, Zootermopsis nevadensis. (d) Western blot analysis of the expressed shrimp ADAR protein in insect cells. The plasmid expressing the V5-ADAR fusion protein and the synthetic WSSV-miRNA-N12 precursor were cotransfected into insect cells. The synthetic WSSV-miRNA-N12 precursor alone was included in the transfection as a control. The expression of shrimp ADAR was detected by the V5 antibody. M, protein marker. (e) The involvement of shrimp ADAR in the RNA editing of viral miRNA. The total RNAs were extracted from insect cells transfected with the plasmid expressing the shrimp ADAR protein and/or the synthetic WSSV-miRNA-N12 precursor. Then the precursor of WSSV-miRNA-N12 was cloned and sequenced. The positions of the edited site and the unedited site are indicated with arrows.

Viral miRNA editing mediated by host adenosine deaminase acting on RNA (ADAR). (a) Comparison of WSSV-miR-N12 mature sequence with the WSSV genomic DNA sequence. The editing site was coloured. (b) The predicted hairpin structure of WSSV-miRNA-N12 precursor using mFold software (http://frontend.bioinfo.rpi.edu/applications/mfold/). Red indicates the mature sequence of WSSV-miRNA-N12. Green indicates the potential A-to-I editing site. (c) Neighbour-joining phylogenetic tree analysis of ADAR proteins of vertebrates and invertebrates. Bootstrap values are shown. The bar represents the distance. hsa, Homo sapiens; mmu, Mus musculus; xtr, Xenopus (Silurana) tropicalis; gga, Gallus gallus; dre, Danio rerio; dme, Drosophila melanogaster; ame, Apis mellifera; cel, Caenorhabditis elegans; zne, Zootermopsis nevadensis. (d) Western blot analysis of the expressed shrimp ADAR protein in insect cells. The plasmid expressing the V5-ADAR fusion protein and the synthetic WSSV-miRNA-N12 precursor were cotransfected into insect cells. The synthetic WSSV-miRNA-N12 precursor alone was included in the transfection as a control. The expression of shrimp ADAR was detected by the V5 antibody. M, protein marker. (e) The involvement of shrimp ADAR in the RNA editing of viral miRNA. The total RNAs were extracted from insect cells transfected with the plasmid expressing the shrimp ADAR protein and/or the synthetic WSSV-miRNA-N12 precursor. Then the precursor of WSSV-miRNA-N12 was cloned and sequenced. The positions of the edited site and the unedited site are indicated with arrows. As previously reported, a primary miRNA or a precursor miRNA can be the substrate of ADAR–RNA editing [12,16]. To explore the involvement of shrimp ADAR in viral miRNA editing, a construct expressing the shrimp ADAR protein and a synthetic precursor of WSSV-miRNA-N12 were cotransfected into insect cells, then WSSV-miRNA-N12 was sequenced. Western blots revealed that ADAR was expressed differentially in insect cells (figure 3d). The total insect cell RNAs were extracted and the WSSV-miRNA-N12 precursor was cloned. Sequencing revealed that 17 of 120 clones isolated from cotransfected cells possessed copies of WSSV-miRNA-N12 that had undergone A-to-G RNA editing, while no edited WSSV-miRNA-N12 was detected in 60 clones isolated from cells transfected with WSSV-miRNA-N12 precursor alone (figure 3e). These findings indicated that the shrimp ADAR protein could edit viral miRNAs.

The role of viral miRNA editing in virus latency

To explore the role of viral miRNA editing in viral replication, the time-course of expression of unedited and edited WSSV-miR-N12 s was investigated in more detail. Northern blotting indicated that both the unedited and edited WSSV-miR-N12 s were detected in WSSV-infected shrimp at 6 h post-infection (figure 4a), suggesting that this viral miRNA was expressed and the miRNA editing occurred at the early stage of WSSV infection. The results showed that the frequency of viral miRNA editing increased before 18 h post-infection and decreased after 24 h post-infection (figure 4a). To evaluate the effects of this miRNA on WSSV replication in shrimp, its expression was silenced using anti-miRNA oligonucleotide (AMO)-WSSV-miR-N12 (figure 4b). Silencing of WSSV-miR-N12 expression significantly reduced WSSV copy number (figure 4c) and significantly decreased shrimp mortality (figure 4d), indicating that expression of WSSV-miR-N12 contributed to viral replication.
Figure 4.

(Overleaf.) The role of viral miRNA editing in virus latency. (a) Viral miRNA detected in shrimp infected with WSSV. The expressions of edited and unedited WSSV-miR-N12 were examined by northern blot pre-infection (0 h), and post-infection (6, 12, 18, 24, 36 and 48 h). The percentages of edited and unedited viral miRNA were evaluated. (b) The silencing of viral miRNA expression. The expression of WSSV-miR-N12 in WSSV-infected shrimp was silenced by AMO-WSSV-miR-N12. The silencing was examined by northern blot pre-infection (0), and 12, 24, 36 and 48 h post-infection. U6 was used as a control. (c) Effects of WSSV-miR-N12 on the WSSV replication in shrimp. Shrimp were simultaneously injected with WSSV and AMO-WSSV-miR-N12. WSSV alone and AMO-WSSV-miR-N12-scrambled were used as controls. The shrimp were subjected to real-time PCR to detect the WSSV copies 12, 24, 36 and 48 h post-infection. The numbers indicated the time points post-infection. (d) Cumulative mortalities of WSSV-challenged shrimp after the injection of AMO-WSSV-miR-N12. Each point represented the mean of triplicate assays. (e) The overexpression of viral miRNA. The edited and unedited WSSV-miR-N12 mimics were co-injected with WSSV into shrimp, respectively. Edited and unedited WSSV-miR-N12 were detected pre-infection (0), and 12, 24, 36 and 48 h post-infection by northern blots. U6 was used as a control. (f) The shrimp were simultaneously injected with WSSV and the unedited or edited WSSV-miR-N12, and the WSSV copies in shrimp were monitored by quantitative real-time PCR at 12, 24, 36 and 48 h post-infection (g) The accumulative mortalities of WSSV-infected shrimp treated with the unedited or edited WSSV-miR-N12 were monitored 1–5 days post-infection. All the assays were repeated three times (*p < 0.05; **p < 0.01).

(Overleaf.) The role of viral miRNA editing in virus latency. (a) Viral miRNA detected in shrimp infected with WSSV. The expressions of edited and unedited WSSV-miR-N12 were examined by northern blot pre-infection (0 h), and post-infection (6, 12, 18, 24, 36 and 48 h). The percentages of edited and unedited viral miRNA were evaluated. (b) The silencing of viral miRNA expression. The expression of WSSV-miR-N12 in WSSV-infected shrimp was silenced by AMO-WSSV-miR-N12. The silencing was examined by northern blot pre-infection (0), and 12, 24, 36 and 48 h post-infection. U6 was used as a control. (c) Effects of WSSV-miR-N12 on the WSSV replication in shrimp. Shrimp were simultaneously injected with WSSV and AMO-WSSV-miR-N12. WSSV alone and AMO-WSSV-miR-N12-scrambled were used as controls. The shrimp were subjected to real-time PCR to detect the WSSV copies 12, 24, 36 and 48 h post-infection. The numbers indicated the time points post-infection. (d) Cumulative mortalities of WSSV-challenged shrimp after the injection of AMO-WSSV-miR-N12. Each point represented the mean of triplicate assays. (e) The overexpression of viral miRNA. The edited and unedited WSSV-miR-N12 mimics were co-injected with WSSV into shrimp, respectively. Edited and unedited WSSV-miR-N12 were detected pre-infection (0), and 12, 24, 36 and 48 h post-infection by northern blots. U6 was used as a control. (f) The shrimp were simultaneously injected with WSSV and the unedited or edited WSSV-miR-N12, and the WSSV copies in shrimp were monitored by quantitative real-time PCR at 12, 24, 36 and 48 h post-infection (g) The accumulative mortalities of WSSV-infected shrimp treated with the unedited or edited WSSV-miR-N12 were monitored 1–5 days post-infection. All the assays were repeated three times (*p < 0.05; **p < 0.01). To investigate the influence of viral miRNA editing on virus infection, the edited and unedited WSSV-miR-N12 were overexpressed in shrimp, which were then infected with WSSV. Northern blotting confirmed that the edited and unedited WSSV-miR-N12 were overexpressed in shrimp (figure 4e). Significantly more copies of the WSSV genome were detected in shrimp in which unedited WSSV-miR-N12 was overexpressed than shrimp infected with WSSV alone. However, the number of copies of the WSSV genome detected in shrimp in which edited WSSV-miR-N12 was overexpressed did not differ significantly from shrimp infected with WSSV alone (figure 4f), indicating that WSSV-miR-N12 promotes WSSV infection and that WSSV-miR-N12 editing could cause WSSV latency in shrimp. Shrimp mortality analysis generated similar results (figure 4g). These findings suggest that A-to-I editing of viral miRNA (WSSV-miR-N12) could reduce viral replication in the shrimp, and cause virus latency.

The mechanism of viral miRNA editing in the miRNA-induced silencing complex

To investigate the mechanism of viral miRNA editing in the miRISC, WSSV-miR-N12 target genes were predicted. The prediction results indicated that the WSSV wsv399 gene could be targeted by WSSV-miR-N12 (figure 5a). To evaluate the direct interaction between WSSV-miR-N12 and wsv399, the EGFP gene and the 3′UTR of the wsv399 gene or its mutant were cloned, generating the EGFP-wsv399-3′UTR construct and the EGFP-wsv399-3′UTR-mutation construct (figure 5b). Co-transfection of WSSV-miR-N12 mimic and the EGFP-wsv399-3′UTR or EGFP-wsv399-3′UTR-mutation revealed that the fluorescence intensity of insect cells cotransfected with WSSV-miR-N12 and EGFP-wsv399-3′UTR was significantly weaker than that of controls (figure 5c), indicating that WSSV-miR-N12 directly targeted the wsv399 gene. To illustrate the effect of viral miRNA editing on the direct interaction of viral miRNA with its target gene, the edited WSSV-miR-N12 and the EGFP-wsv399-3′UTR were cotransfected into insect cells. We found that the wsv399 gene was not targeted by the edited WSSV-miR-N12 (figure 5d), indicating that the base change at the miRNA +16 site inhibited target mRNA recognition.
Figure 5.

(Overleaf.) The mechanism of viral miRNA editing in virus infection. (a) The region of the viral gene wsv399 3′UTR targeted by WSSV-miR-N12. The seed sequence of WSSV-miR-N12 is underlined. (b) Constructs of EGFP-wsv399-3′UTR and EGFP-wsv399-3′UTR-mutation. The sequence targeted by WSSV-miR-N12 is underlined. (c) Direct interaction between WSSV-miR-N12 and wsv399 gene in insect cells. Insect High Five cells were cotransfected with the WSSV-miR-N12 mimic or WSSV-miR-N12-mimic-scrambled and EGFP, EGFP-wsv399-3′UTR or EGFP-wsv399-3′UTR-mutation. At 36 h after cotransfection, the fluorescence of cells was examined. (d) The interaction between the edited WSSV-miR-N12 and wsv399 gene in insect cells. Insect High Five cells were cotransfected with the edited WSSV-miR-N12 mimic and EGFP-wsv399-3′UTR. WSSV-miR-N12-mimic-scrambled, EGFP and EGFP-wsv399-3′UTR-mutation were used as controls. At 36 h after cotransfection, the fluorescence of cells was evaluated. (e) The interaction between edited or unedited viral miRNA and host Ago1 protein. The unedited or edited WSSV-miRNA-N12 was incubated with recombinant shrimp Ago1 protein, then separated by native polyacrylamide gel and stained with ethidium bromide to visualize the miRNA (top), followed by staining with Coomassie blue (bottom). The wedges indicated the concentration gradient of recombinant protein used. (f) The interaction between viral miRNA and its target gene in the miRISC. The unedited or edited WSSV-miRNA-N12 and the 3′UTR of the wsv399 gene were incubated with shrimp Ago1 protein. Subsequently, the mixture was separated by agarose gel and stained with ethidium bromide to show the miRNA and target gene, followed by staining with Coomassie blue (bottom). The wedges indicate concentrations of recombinant protein used. (g) Northern blot analysis of expression profiles of the wsv399 gene in WSSV-infected shrimp. The shrimp were challenged with WSSV. Numbers indicated the time points post-infection. Shrimp β-actin was used as a control. (h) Silencing of wsv399 expression in WSSV-infected shrimp. The wsv399-siRNA and WSSV was co-injected into WSSV-infected shrimp. Then the shrimp haemolymph was subjected to northern blot analysis to detect the expression level of the wsv399 gene. Numbers indicate the time points post-infection. Shrimp β-actin was used as a control. (i) Effect of wsv399 gene silencing on WSSV copies in shrimp. The shrimp were simultaneously injected with WSSV and wsv399-siRNA, followed by detections of virus copies with quantitative real-time PCR. As controls, WSSV alone and wsv-399-siRNA-scrambled were included in the injections. (j) Accumulative mortalities of WSSV-infected shrimp. At different times post-infection, the accumulative mortalities of shrimp were monitored daily. Numbers showed the time points post-infection. (k) The detection of ADAR expression in virus-challenged shrimp. Shrimp were infected with WSSV. At different times post-infection, the ADAR mRNA level was evaluated with quantitative real-time PCR. (l) The examination of wsv399 expression. The wsv399 mRNA in shrimp treated with WSSV and unedited or edited WSSV-miR-N12 was quantified with quantitative real-time PCR. In all panels, the statistically significant differences between treatments were represented with asterisks (*p < 0.05; **p < 0.01).

(Overleaf.) The mechanism of viral miRNA editing in virus infection. (a) The region of the viral gene wsv399 3′UTR targeted by WSSV-miR-N12. The seed sequence of WSSV-miR-N12 is underlined. (b) Constructs of EGFP-wsv399-3′UTR and EGFP-wsv399-3′UTR-mutation. The sequence targeted by WSSV-miR-N12 is underlined. (c) Direct interaction between WSSV-miR-N12 and wsv399 gene in insect cells. Insect High Five cells were cotransfected with the WSSV-miR-N12 mimic or WSSV-miR-N12-mimic-scrambled and EGFP, EGFP-wsv399-3′UTR or EGFP-wsv399-3′UTR-mutation. At 36 h after cotransfection, the fluorescence of cells was examined. (d) The interaction between the edited WSSV-miR-N12 and wsv399 gene in insect cells. Insect High Five cells were cotransfected with the edited WSSV-miR-N12 mimic and EGFP-wsv399-3′UTR. WSSV-miR-N12-mimic-scrambled, EGFP and EGFP-wsv399-3′UTR-mutation were used as controls. At 36 h after cotransfection, the fluorescence of cells was evaluated. (e) The interaction between edited or unedited viral miRNA and host Ago1 protein. The unedited or edited WSSV-miRNA-N12 was incubated with recombinant shrimp Ago1 protein, then separated by native polyacrylamide gel and stained with ethidium bromide to visualize the miRNA (top), followed by staining with Coomassie blue (bottom). The wedges indicated the concentration gradient of recombinant protein used. (f) The interaction between viral miRNA and its target gene in the miRISC. The unedited or edited WSSV-miRNA-N12 and the 3′UTR of the wsv399 gene were incubated with shrimp Ago1 protein. Subsequently, the mixture was separated by agarose gel and stained with ethidium bromide to show the miRNA and target gene, followed by staining with Coomassie blue (bottom). The wedges indicate concentrations of recombinant protein used. (g) Northern blot analysis of expression profiles of the wsv399 gene in WSSV-infected shrimp. The shrimp were challenged with WSSV. Numbers indicated the time points post-infection. Shrimp β-actin was used as a control. (h) Silencing of wsv399 expression in WSSV-infected shrimp. The wsv399-siRNA and WSSV was co-injected into WSSV-infected shrimp. Then the shrimp haemolymph was subjected to northern blot analysis to detect the expression level of the wsv399 gene. Numbers indicate the time points post-infection. Shrimp β-actin was used as a control. (i) Effect of wsv399 gene silencing on WSSV copies in shrimp. The shrimp were simultaneously injected with WSSV and wsv399-siRNA, followed by detections of virus copies with quantitative real-time PCR. As controls, WSSV alone and wsv-399-siRNA-scrambled were included in the injections. (j) Accumulative mortalities of WSSV-infected shrimp. At different times post-infection, the accumulative mortalities of shrimp were monitored daily. Numbers showed the time points post-infection. (k) The detection of ADAR expression in virus-challenged shrimp. Shrimp were infected with WSSV. At different times post-infection, the ADAR mRNA level was evaluated with quantitative real-time PCR. (l) The examination of wsv399 expression. The wsv399 mRNA in shrimp treated with WSSV and unedited or edited WSSV-miR-N12 was quantified with quantitative real-time PCR. In all panels, the statistically significant differences between treatments were represented with asterisks (*p < 0.05; **p < 0.01). To explore the capacity of unedited or edited WSSV-miR-N12 to be loaded onto the host Ago1 protein during the assembly of miRISC, the viral miRNA was incubated with the shrimp Ago1 protein. Electrophoretic mobility shift assay (EMSA) results revealed that both the unedited and edited WSSV-miRNA-N12 bound the Ago1 protein (figure 5e), and the base change at the miRNA +16 site did not inhibit assembly of the miRISC. To further investigate the interaction between viral miRNA and its target gene in the miRISC, the 3′UTR of the wsv399 gene and the unedited or edited WSSV-miRNA-N12 were incubated with Ago1 protein. EMSA data revealed that the wsv399 3′UTR interacted with the unedited WSSV-miRNA-N12, but not the edited WSSV-miRNA-N12 (figure 5f), confirming that the RNA editing of viral miRNA inhibited miRISC target recognition. In order to characterize the role of the wsv399 gene in WSSV infection, expression of wsv399 was measured in virus-infected shrimp. Northern blots also revealed that wsv399 mRNA was detected at 6 h post-infection (figure 5g), indicating that wsv399 was transcribed during the early stage of infection. Expression of wsv399 was silenced by injection of the sequence-specific siRNA (wsv399-siRNA) into WSSV-infected shrimp (figure 5h), which caused significantly more copies of the virus to be produced than in shrimp injected with WSSV alone or WSSV+wsv399-siRNA-scrambled (figure 5i). Knockdown of wsv399 expression also significantly increased mortality of WSSV-infected shrimp (figure 5j). These data illustrate that expression of the wsv399 gene negatively regulates WSSV infection in shrimp. To refine the mechanism of virus replication control by wsv399/WSSV-miR-N12/ADAR, the ADAR expression in virus-free and WSSV-challenged shrimp was characterized. The quantitative real-time PCR data indicated that ADAR was upregulated in shrimp before 18 h post-infection and downregulated after 24 h post-infection (figure 5k), which was in accordance with the editing frequency of WSSV-miR-N12 (figure 4g). The results showed that the wsv399 mRNA level was upregulated in shrimp treated with WSSV and edited WSSV-miR-N12 at the early stage of WSSV infection and subsequently downregulated (figure 5l), which was consistent with that in shrimp treated with WSSV alone (figure 5l). When the WSSV-infected shrimp were treated with the unedited WSSV-miR-N12, the wsv399 mRNA level decreased (figure 5l). These results demonstrated that the virus could exploit the host ADAR to edit the viral miRNA, leading to increase of viral wsv399 gene expression and further inhibition of the WSSV replication at the early stage of virus infection. Taken together, the findings revealed that RNA editing of viral miRNA induced virus latency by preventing miRISC recognition of mRNA (figure 6).
Figure 6.

The model for the role of ADAR-mediated RNA editing of viral miRNA in virus–host interaction.

The model for the role of ADAR-mediated RNA editing of viral miRNA in virus–host interaction.

Discussion

Virus replication, one of the most key steps in the virus life cycle, is elaborately regulated by virus. During the virus replication process, miRNAs are required [19,24,25]. In this investigation, the results revealed that the RNA editing of viral miRNA played an important role in the virus replication, showing the elaborate mechanism of virus replication regulated by miRNA. miRNAs have been reported to influence both virus replication and pathogenicity, and host innate antiviral immune responses [27]. Studying the regulation of miRNA expression, including RNA editing of miRNA, can further reveal the function of miRNA. A-to-I RNA editing, catalysed by the ADAR enzyme, can generate RNA diversity post-transcriptionally [28,29]. Our study indicated that a viral miRNA, WSSV-miR-N12, underwent A-to-I RNA editing at the +16 site, and that RNA editing of WSSV-miR-N12 influenced virus latency. WSSV-miR-N12 could promote virus replication by targeting the WSSV early gene, wsv399. The role of wsv399 in the WSSV–shrimp interaction has not been identified. Our study revealed that wsv399 expression inhibited the WSSV infection. Although the edited WSSV-miR-N12 bound Ago just like the unedited WSSV-miR-N12, the edited WSSV-miR-N12-coupled Ago could not interact with the target gene wsv399. As a result, WSSV-miR-N12 editing at the early stage of virus infection promoted the expression of viral wsv399 gene, leading to the inhibition of WSSV replication and subsequently affecting virus latency. In this context, our study presented a novel aspect of viral miRNA editing which could act as a mechanism to promote virus latency. miRNAs, loaded into the miRISC, are thought to target multiple mRNAs, affecting the translation or stability of several target genes [30]. Although computer algorithms that constrain searches for mRNA sites complementary to the miRNA ‘seed’ region to the 3′UTR of mRNA can identify potential matches, accurately predicting the mRNA target of miRNAs remains difficult [31,32]. Different computer algorithms generate divergent target sets with high false-positive rates, and usually contradict one another [33,34]. Recently, miRNA overexpression or knockdown studies have beenombined with proteome analysis to identify miRNA targets [31,35]. However, these studies have identified a relatively small number of proteins, and the results of miRNA overexpression or knockdown studies do not distinguish between primary miRNA effects and secondary effects. Also, it is known that not all miRNAs load onto Ago proteins and bind target genes. Therefore, it has become important to use a combination of target identification methods to reveal the spectrum of miRNA targets. With an aim to understand the role of miRNAs in virus–host interactions, in this study we characterized the miRNAs and mRNAs loaded into the Ago complex of WSSV-infected shrimp haemocytes. Many miRNAs and their target genes were identified based on the miRNA–mRNA interactions facilitated by the Ago complex. Therefore, we presented an efficient strategy for the comprehensive analysis of miRNA-mediated regulation of gene expression in virus–host interactions. Our findings reveal that while A-to-I editing of WSSV-miR-N12 did not affect binding to shrimp Ago, edited WSSV-miR-N12 could not recognize the target gene via A : U Watson–Crick pairing. The change to G : U pairing at the +16 site weakened the interaction between miRNA and its target gene. Previous studies have reported that even a single G : U base-pair change in the seed region can reduce the efficiency of target recognition, and miRNA 3′ pairing with the target favours contiguous Watson–Crick pairs uninterrupted by wobbles, bulges or other mismatches at 12–17 sites [36,37]. Our findings reveal a novel regulatory aspect of miRNA editing in the miRNA–target interaction. The mechanism merits further study.

Material and methods

Shrimp culture and white spot syndrome virus infection

Marsupenaeus japonicus shrimp (about 15 g each) were reared in groups of 20 individuals in air-pumped circulating seawater at 25°C. Then three shrimp were randomly chosen for the WSSV detection using PCR with the WSSV-specific primers (5′-TTGGTTTCATGCCCGAGATT-3′ and 5′-CCTTGGTCAGCCCC TTGA-3′). Virus-free shrimp were infected with WSSV as previously described [26]. Before infection, and 24 and 48 h post-infection, shrimp haemocytes were collected. WSSV copies were quantified by quantitative real-time PCR, as previously described [26].

Recombinant expression of shrimp Ago1 in Escherichia coli and antibody preparation

The Ago1 gene of M. japonicus was amplified with primers 5′-AAGGATCCATGTACCCTGTC GGGCAGCCACC-3′ (BamHI, underlined) and 5′-AACTCGAGTTAAGCAAAGTACATGACTCT GTTCGT-3′ (XhoI, underlined) and cloned into the pGEX-4T-2 vector downstream of glutathione S-transferase (GST). Gene expression and protein purification were achieved by following the manufacturer's protocols (Amersham Biosciences, USA). Purified GST or GSTAgo1 proteins were used as antigen to immunize mice to prepare antibody. Antiserum titres were evaluated by enzyme-linked immunosorbent assay, the immunoglobulin fraction was purified with protein A–Sepharose (Bio-Rad, USA) and antibody specificity was evaluated by western blot.

Co-immunoprecipitation of shrimp Ago1

Shrimp haemocytes were collected and UV (ultraviolet) irradiated at 254 nm, then lysed in lysis buffer (20 mM Tris–Cl, 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, pH 7.5). The cross-linked lysate was treated with 15 µl of RNAsin (Promega, USA) and incubated on ice for 10 min, then 30 µl of RQ1 DNAse was added (Promega). After 5 min at 37°C the Ago1–RNA complex was immunoprecipitated using the polyclonal antibody against GST or GSTAgo1 for 16 h at 4°C, followed by incubation with protein A–Sepharose (GE Healthcare, USA) for 30 min at 4°C. After washing in lysis buffer, the Ago1–RNA complex was eluted with elution buffer (50 mM glycine, pH 2.8) and subjected to western blot. RNAs (including mRNA and miRNA) were extracted from the complex using a mirVanaPTMP miRNA isolation kit according to the manufacturer's instructions (Ambion, USA). After separation on a 15% polyacrylamide–8 M urea gel, RNAs of 16–30 nt and RNAs of more than 100 nt were recovered, using the RNA gel extraction kit (Takara, Japan) for sequencing.

Western blot

Protein samples were analysed on a 10% SDS-PAGE gel and transferred onto a nitrocellulose membrane (Bio-Rad, USA). The membrane was immersed in blocking buffer (3% bovine serum albumin (BSA)) at 4°C overnight, followed by incubation with anti-GST or anti-GSTAgo1 antibody. Then the membrane was incubated in AP-conjugated goat anti-mouse IgG (Sigma, USA) for 1 h and binding was visualized with NBT and BCIP solutions (BBI, Canada).

Sequencing and sequence analysis of Ago1-associated RNAs

Small RNAs and longer RNAs were sequenced with a GA-I genome analyser (Illumina, San Diego, CA, USA) according to the manufacturer's protocols. Small RNAs were also analysed by searching the ACGT V3.1 program developed by LC Sciences (Houston, TX, USA). After the removal of adaptor sequences, mRNA, rRNA, tRNA, snRNA, snoRNA and other non-coding RNA sequences available in Rfam (http://www.sanger.ac.uk/software/Rfam), the high-quality sequences were compared with known animal miRNAs in miRBase 19.0 and the known WSSV miRNAs, as previously described [18,19,26]. The miRNAs with no homologue were further analysed using BLASTN against the shrimp EST database (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov) and the WSSV genome sequence (GenBank accession no. AF332093.1), allowing one or two mismatches between each pair of sequences. Hairpin structure of novel miRNA candidates was predicted using mFold online software (http://frontend.bioinfo.rpi.edu/ applications/mfold/) with default parameters. The longer RNAs were analysed using Trinity software and the Illumina paired end method developed by LC Sciences (Houston, USA). After the removal of repetitive and low-quality reads, the remaining high-quality reads were aligned to the shrimp assembled ESTs in the National Center for Biotechnology Information (as the M. japonicus genome was not listed) or to the WSSV genome (GenBank accession no. AF332093.1).

Northern blot

Total RNAs were extracted from the Ago1 complex of shrimp haemocytes using a mirVanaPTMP miRNA isolation kit according to the manufacturer's instructions (Ambion, USA). The NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) was used to determine the concentration of the extracted RNAs. Total RNAs (5 µg) were separated on a denaturing 15% polyacrylamide gel containing 8 M urea. Then the separated RNA was transferred to a Hybond-N+ membrane (Amersham Biosciences, Buckinghamshire, UK). The membrane was washed with DIG Easy Hyb granules buffer (Roche, Basel, Switzerland) for 0.5 h at 42°C after cross-linking by UV irradiation and subsequently hybridized with a DIG-labelled DNA probe of a miRNA for 20 h at 42°C. To identify the unedited and edited WSSV-miR-N12, locked nucleic acid (LNA)-modified oligonucleotide probes were used in northern blot [38]. The LNA-modified oligonucleotide probes (unedited WSSV-miR-N12, 5′-DIG-TATTCTTATTCTCTCGATAA-3′; edited WSSV-miR-N12, 5′-DIG-TATTCTCATTCTCTC GATAA-3′) were modified with LNA at the fifth and seventh bases. RNAs were detected according to the DIG High Prime DNA Labeling and Detection Starter Kit II manual (Roche). To evaluate the frequency of viral miRNA editing, the quantities of unedited and edited viral miRNA were obtained using Image ProPlus 6.0 software. The percentage of the frequency of viral miRNA editing was examined.

Quantitative real-time PCR

To quantify WSSV virions in shrimp, the WSSV genome was extracted from virus-infected shrimp haemocytes using a TIANmp Genomic DNA kit (Tiangen Biotech Co. Ltd, Beijing, China) according to the manufacturer's protocols, and then 150 ng of genomic DNA was subjected to quantitative real-time PCR. The primers were 5′-CCACCAATTCTACT CATGTACCAAA-3′ and 5′-TCCTTGCAATGGGCAAAATC-3′. The TaqMan probe was 5′-FAM-CTGGGTTACGAGTCT AA-TAMRA-3′. A linearized plasmid containing a 1400-bp DNA fragment from the WSSV genome was quantified and serially diluted 10-fold as an internal standard for real-time PCR. The PCR mixture contained 5 µl of Premix Ex Taq (Takara, Japan), 0.5 µl of extracted DNA template or the internal standard plasmid, 0.2 µl of 10 mM primers and 0.15 µl of 10 mM TaqMan fluorogenic probes. PCR was carried out at 95°C for 1 min followed by 45 cycles at 95°C for 15 s, 52°C for 30 s and 72°C for 30 s. The coding sequences of Ago1 complex transcripts were predicted using Glimmer3 software, developed by LC Sciences (Houston, USA). To assess the expressions of mRNAs, three genes encoding phosphoglucosamine mutase, stress-associated Ramp4 and nucleotide excision repair protein were selected at random and 150 ng of extracted RNA from the Ago1 complex was subjected to quantitative real-time PCR. Shrimp β-actin was used as a standard control to calculate the expression level of a gene. The primers and TaqMan probes were synthesized (phosphoglucosamine mutase gene, primers 5′-GGTCTTCTTCGATGAACAA-3′ and 5′-GGGAATATTGTGACGAGTG-3′, TaqMan probe 5′-FAM-TCATTCTTAGCGCCTGCGA CA-3′-Eclipse; stress-associated Ramp4 gene, primers 5′-ACCAGGAAATGAAACTCA-3′ and 5′-CCGGCAATATTGAACATC-3′, TaqMan probe 5′-FAM AGCCGACTACGACGAACAAGAA-3′-Eclipse; nucleotide excision repair protein gene, primers 5′-GACCAGCACTAACTATTATG-3′ and 5′-CCTCTTAATAGTAA CATATTGAATC-3′, TaqMan probe 5′-FAM-AACACCTATGCTG CCACTCCT-3′- Eclipse; β-actin gene, primers 5′-CGAGCACGGCATCGTTACTA-3′ and 5′-TTGTAGAAAGTGTGATG CCAGATCT-3′, TaqMan probe 5′-FAM-CTGGGACGACATGGA-3′-Eclipse). Reactions were prepared in a total volume of 10 µl containing 5 µl Premix Ex Taq (Takara, Japan), 0.5 µl cDNA template, 0.2 µl 10 mM primers and 0.15 µl 10 mM TaqMan fluorogenic probes. PCR was carried out at 95°C for 1 min followed by 40 cycles at 95°C for 15 s, 52°C for 45 s, and 72°C for 45 s. The expression level of wsv399 mRNA or ADAR mRNA was examined using quantitative real-time PCR with wsv399-specific primers (5′-TGAGCACTGACGACCATACGAGA-3′ and 5′-T GGAGGTGAACAGGGAAGGAGAA-3′) or ADAR-specific primers (5′-GACAGCCCTGTACAT ATG-3′ and 5′-CTGACAACATCCAAACTTG-3′). Shrimp β-actin was used as a control.

Prediction of genes targeted by microRNAs

miRNA target genes were predicted by employing the transcriptome sequence of the shrimp Ago1 complex using two independent computational algorithms, including TargetScan 5.1 (http://www.targetscan.org) and miRanda (http://www.microrna.org/). Based on the sequence analysis of the transcriptome sequencing data of the shrimp Ago1 complex, the shrimp genes and WSSV genes in the Ago1 complex were obtained and used for the prediction of genes targeted by miRNAs. TargetScan was used to search for miRNA seed matches (nucleotides 2–8 from the 5′-end of miRNA), while miRanda was used to match the entire miRNA sequence with the parameters free energy less than −20 kcal mol−1 and score greater than 50. Finally, the data predicted by both algorithms were combined and overlaps were calculated.

Gene Ontology and Kyoto Encyclopedia of Genes and Genomes Analysis

GO analysis was performed as previously described [26]. Briefly, the coding sequences of transcripts retrieved from the Ago1 complex were extracted and used as queries to search the protein sequences collected in the GO database with the blast E-value of less than 1 × 10−5 [39]. The best hit GO identities were assigned to the transcripts. Then the hypergeometric test statistic was used to calculate the over-representation of particular functions or categories in the miRNA targets predicted by TargetScan 5.1. The p-values were corrected for false discovery rate. Deduced genes with homologues in other organisms were used to map to conserved biological pathways using the 239 KEGG.

Analysis of white spot syndrome virus-miR-N12 RNA editing site

The sequence of mature WSSV-miR-N12 was aligned with the WSSV genomic DNA sequence using DNAMAN. The hairpin structure of WSSV-miRNA-N12 was predicted using mFold (http://frontend.bioinfo.rpi.edu/applications/mfold/) with the default parameters.

Cloning and sequence analysis of shrimp adenosine deaminase acting on RNA gene

Total RNAs were extracted from shrimp haemocytes using a mirVanaPTMP miRNA isolation kit according to the manufacturer's instructions (Ambion, USA). The first-strand cDNA template was synthesized using Prime Script 1st Strand cDNA Synthesis Kit (Takara, Japan). Rapid amplification of cDNA ends (RACEs) was performed for the full-length ADAR gene sequence using a 5′/3′ RACE kit (Roche, USA). The full-length sequence of shrimp ADAR gene was obtained and deposited in GenBank (accession no. AHK23065.1). The ADAR domains were analysed using the SMART program (http://smartembl-heidelberg.de/). Neighbour-joining phylogenetic tree analysis of ADAR proteins was performed with the MEGA5.1 program. The GenBank accession numbers of the ADAR proteins were indicated as follows: Xenopus (Silurana) tropicalis, XP_002943575.2; Gallus gallus, XP_001232162.2; Danio rerio, NP_571671.1; Drosophila melanogaster, NP_001245476.1; Apis mellifera, NP_001091684.1; Homo sapiens, NP_056656.2; Mus musculus, CAJ18531.1; Caenorhabditis elegans, AAC25097.1; Zootermopsis nevadensis, KDR24469.1. Bootstrap analysis was conducted for 1000 replicates to define the confidence of tree branch positions.

Identification of white spot syndrome virus-miR-N12 RNA editing site in insect cells

The shrimp ADAR gene was cloned into a pIZ/V5-His vector (Invitrogen, USA) using primers 5′-ATCGAATTCGCCACCATGGATTCCGAGTCTAT-3′ and 5′-AGGCCGCGGGATATAAAAACTGTCTTC-3′ to express the V5-ADAR fusion protein. The WSSV-miR-N12 precursor was cloned from the WSSV genome using the in vitro Transcription T7 Kit (Takara, Japan) with specific primers (5′-GATCACACTAAGGATATAA-3′ and 5′-CGCCACTAATACGACTCACTATAGGGGATGCGTGGGTTTGCACA-3′). The purified RNAs were folded in the folding buffer as previously described [40]. Subsequently different quantities (0, 5 and 12 µg) of plasmid expressing V5-ADAR and the synthesized WSSV-miR-N12 precursor were cotransfected into insect High Five cells (3 × 105 ml−1) (Invitrogen) and cultured at 27°C in Express Five serum-free medium (SFM) (Invitrogen) containing l-glutamine (Invitrogen). Two days later, the cells were collected and subjected to western blot analysis and RNA sequencing.

The silencing and overexpression of white spot syndrome virus-miR-N12 in shrimp

To evaluate the effects of WSSV-miR-N12 on virus infection, the expression of WSSV-miR-N12 was knocked down in shrimp by injection of AMO. AMO-WSSV-miR-N12 (5′-ATTCTCTCGATAAAA-3′) targeting WSSV-miR-N12 was synthesized (Sangon Biotech, Shanghai, China) with a phosphorothioate backbone and a 2′-O-methyl modification at the 6th and 12th nucleotides. The sequence of AMO-WSSV-miR-N12 was randomly scrambled generating AMO-WSSV-miR-N12-scrambled (5′-TATTCTGTCTAATAG-3′) as a control. Subsequently, 10 nM of AMOs was co-injected with WSSV (105 copies ml−1) into virus-free shrimp (100 µl per shrimp). In order to explore the role of WSSV-miR-N12 editing in virus infection, the unedited WSSV-miR-N12 (5′-UUUUAUCGAGAGAAUAAGAAUAUU-3′ and 5′-UAUUCUUAUUCUCUCGAUAAAAUU-3′) and the edited WSSV-miR-N12 (5′-UUUAUCGAGAGAAUGAGAAUAUU-3′ and 5′-UAUUCUCAUUCUCUCGAUAAAAUU-3′) were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China), generating WSSV-miR-N12 mimics. Virus-free shrimp were injected with 30 nM of the unedited or edited WSSV-miR-N12 mimic in addition to WSSV (105 copies ml−1). The sequence of WSSV-miR-N12 mimic was randomly scrambled to yield WSSV-miR-N12-mimic-scrambled (5′-UUCUCCGAACGUGUCACGUTT-3′ and 5′-ACGUGACACGUUCGGAGAATT-3′) as a control. WSSV (105 virus copies ml–1) was used as a positive control. At different time points (0, 6, 12, 24, 36, 48 h) after the injection of AMOs or mimics, the shrimp haemolymph was collected and subjected to northern blotting.

Shrimp mortality assay

To analyse the shrimp mortality, 20 shrimp were collected from each experimental condition in three independent experiments. Shrimp were injected with AMOs (10 nM) or mimics (30 nM). WSSV (105 virus copies ml−1) was used as a positive control. Shrimp mortality was monitored daily over a 5-day period.

The direct interaction between white spot syndrome virus-miR-N12 and its target gene wsv399

To explore the direct interaction between WSSV-miR-N12 and its target gene wsv399, the enhanced green fluorescent protein (EGFP) gene was cloned into a pIZ/V5-His vector (Invitrogen) with EGFP-specific primers (5′-AAGAGCTCGGATCCCCGGGTAC-3′ and 5′-AATCTAGAGTCGCGGCCGCTTTA-3′). To generate the EGFP-wsv399-3′UTR (3′ untranslated region) construct, the 3′UTR of wsv399 gene was cloned into the pIZ/V5-His vector downstream of EGFP gene using sequence-specific primers (5′-GCATCTAGAAATGCCTGGATAAT C-3′ and 5′-ATACCGCGGGTTTCCATGATGTGT-3′). The sequence of wsv399 3′UTR was randomly mutated by PCR with sequence-specific primers (5′-AGGTTCACTAGTTTGCGAUCGGCGAACTCC and 5′-TTAGGACCGTGGGAGTTCGCCGUTCGCAAA-3′), generating the EGFP-wsv399-3′UTR-mutation construct. Recombinant plasmids were confirmed by sequencing. Insect High Five cells (Invitrogen) were cultured at 27°C in Express Five SFM medium (Invitrogen) supplemented with l-glutamine (Invitrogen). After culture at about 70% confluence (3 × 104/well) in a 96-well plate, 200 ng of EGFP, EGFP-wsv399-3′UTR or EGFP-wsv399-3′UTR-mutation construct was transfected into High Five cells. At the same time, the cells were transfected with 50 nM of either a synthesized WSSV-miR-N12 mimic, the edited WSSV-miR-N12 mimic or a synthesized WSSV-miR-N12-mimic-scrambled. The mimics were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). At 36 h after transfection, fluorescence was determined by a Flex Station II microplate reader (Molecular Devices, USA; excitation/emission at 480/520 nm, respectively), and normalized to cells not transfected with EGFP, in three independent experiments.

Electrophoretic mobility shift assay

The recombinant glutathione S-transferases (GST)-Ago1 was purified. To investigate the ability of WSSV-miRNA-N12 to load onto shrimp Ago1 protein, 40 µM of the unedited or edited WSSV-miRNA-N12 was incubated with 12.5, 25, 50 or 100 µM Ago1 protein. Unedited or edited WSSV-miRNA-N12 was synthesized by Shanghai GenePharma Co. Ltd. (Shanghai, China). After incubation in the reaction buffer (0.1 M KCl, 1 mM DTT, 1 mM MgCl2, 10 mM HEPES, pH 7.6) for 30 min at 37°C, the mixture was separated on a 5% native polyacrylamide gel at 120 V for 1 h. Then the RNA bands were stained by ethidium bromide and subsequently the proteins were stained with Coomassie blue. To illustrate the interaction between the viral miRNA and its target gene in the miRISC, 40 µM of the unedited or edited WSSV-miRNA-N12 and the 3′UTR of wsv399 gene were incubated with shrimp Ago1 protein. The 3′UTR of wsv399 was cloned with primers 5′-TAATACGACTCACTATAGGGAATGCCTGGATAATC-3′ and 5′-GTAAACTGTTTCCATGATGTG-3′. Then the 3′UTR of wsv399 was synthesized using an in vitro T7 transcription kit (TaKaRa, Japan) according to the manufacturer's instructions. After incubation in the reaction buffer, the mixture was electrophoresed on a 1% agarose gel at 120 V for 30 min. Then the gel was stained as described above.

Synthesis of siRNAs and RNAi assay in shrimp

Small interfering RNAs (siRNAs) specifically targeting the wsv399 gene were synthesized using an in vitro T7 transcription kit for siRNA synthesis (TaKaRa, Japan) according to the manufacturer's instructions. The wsv399-siRNA sequence was 5′-CCGACCTAGATATCTGGATACGACA-3′. As a control, the sequence of wsv399-siRNA was scrambled, generating wsv399-siRNA-scrambled (5′-ATTCATGCTCCGGACATCCGATGAC-3′). The synthesized siRNAs were dissolved in siRNA buffer (50 mM Tris–HCl, 100 mM NaCl, pH 7.5). Then the synthesized dsRNAs were assessed by agarose gel electrophoresis and quantified by spectrophotometry. The RNA interference (RNAi) assay was conducted by co-injection of siRNA (15 µg) and WSSV (105 copies ml−1) into virus-free shrimp. Twenty virus-free shrimp were used for each treatment. At 12 h after the co-injection, these shrimp were injected with the siRNA (15 µg). The injection of WSSV alone served as a positive control. At different times post-infection (0, 12, 24, 36 and 48 h), the shrimp haemocytes were collected and subjected to northern blot analysis and levels of WSSV copies were measured. Mortality of WSSV-infected shrimp was also monitored daily. All the experiments were biologically repeated three times.

Statistical analysis

Numerical data were processed using one-way analysis of variation (ANOVA), and Student's t-test was employed to assess the significant difference.
  40 in total

1.  MicroRNA targeting specificity in mammals: determinants beyond seed pairing.

Authors:  Andrew Grimson; Kyle Kai-How Farh; Wendy K Johnston; Philip Garrett-Engele; Lee P Lim; David P Bartel
Journal:  Mol Cell       Date:  2007-07-06       Impact factor: 17.970

Review 2.  New tricks for animal microRNAS: targeting of amino acid coding regions at conserved and nonconserved sites.

Authors:  Isidore Rigoutsos
Journal:  Cancer Res       Date:  2009-04-07       Impact factor: 12.701

Review 3.  Molecular diversity through RNA editing: a balancing act.

Authors:  Sanaz Farajollahi; Stefan Maas
Journal:  Trends Genet       Date:  2010-04-13       Impact factor: 11.639

Review 4.  Functions and regulation of RNA editing by ADAR deaminases.

Authors:  Kazuko Nishikura
Journal:  Annu Rev Biochem       Date:  2010       Impact factor: 23.643

5.  Replicating hepatitis delta virus RNA is edited in the nucleus by the small form of ADAR1.

Authors:  Swee Kee Wong; David W Lazinski
Journal:  Proc Natl Acad Sci U S A       Date:  2002-10-24       Impact factor: 11.205

6.  Characterization of host microRNAs that respond to DNA virus infection in a crustacean.

Authors:  Tianzhi Huang; Dandan Xu; Xiaobo Zhang
Journal:  BMC Genomics       Date:  2012-04-30       Impact factor: 3.969

7.  The essential role of AMPA receptor GluR2 subunit RNA editing in the normal and diseased brain.

Authors:  Amanda Wright; Bryce Vissel
Journal:  Front Mol Neurosci       Date:  2012-04-11       Impact factor: 5.639

8.  RNA editing of human microRNAs.

Authors:  Matthew J Blow; Russell J Grocock; Stijn van Dongen; Anton J Enright; Ed Dicks; P Andrew Futreal; Richard Wooster; Michael R Stratton
Journal:  Genome Biol       Date:  2006-04-04       Impact factor: 13.583

9.  Principles of microRNA-target recognition.

Authors:  Julius Brennecke; Alexander Stark; Robert B Russell; Stephen M Cohen
Journal:  PLoS Biol       Date:  2005-03       Impact factor: 8.029

10.  A disrupted RNA editing balance mediated by ADARs (Adenosine DeAminases that act on RNA) in human hepatocellular carcinoma.

Authors:  Tim Hon Man Chan; Chi Ho Lin; Lihua Qi; Jing Fei; Yan Li; Kol Jia Yong; Ming Liu; Yangyang Song; Raymond Kwok Kei Chow; Vanessa Hui En Ng; Yun-Fei Yuan; Daniel G Tenen; Xin-Yuan Guan; Leilei Chen
Journal:  Gut       Date:  2013-06-13       Impact factor: 23.059

View more
  19 in total

Review 1.  How do ADARs bind RNA? New protein-RNA structures illuminate substrate recognition by the RNA editing ADARs.

Authors:  Justin M Thomas; Peter A Beal
Journal:  Bioessays       Date:  2017-02-20       Impact factor: 4.345

Review 2.  The Role of MicroRNAs and Their Targets in Osteoarthritis.

Authors:  Gregory R Sondag; Tariq M Haqqi
Journal:  Curr Rheumatol Rep       Date:  2016-08       Impact factor: 4.592

3.  Two White Spot Syndrome Virus MicroRNAs Target the Dorsal Gene To Promote Virus Infection in Marsupenaeus japonicus Shrimp.

Authors:  Qian Ren; Xin Huang; Yalei Cui; Jiejie Sun; Wen Wang; Xiaobo Zhang
Journal:  J Virol       Date:  2017-03-29       Impact factor: 5.103

Review 4.  Tudor staphylococcal nuclease: biochemistry and functions.

Authors:  Emilio Gutierrez-Beltran; Tatiana V Denisenko; Boris Zhivotovsky; Peter V Bozhkov
Journal:  Cell Death Differ       Date:  2016-09-09       Impact factor: 15.828

Review 5.  MicroRNAs in orthopaedic research: Disease associations, potential therapeutic applications, and perspectives.

Authors:  Audrey McAlinden; Gun-Il Im
Journal:  J Orthop Res       Date:  2017-12-19       Impact factor: 3.494

Review 6.  MicroRNA-Regulated Proinflammatory Cytokines in Sarcopenia.

Authors:  Jingjing Fan; Xianjuan Kou; Yi Yang; Ning Chen
Journal:  Mediators Inflamm       Date:  2016-06-13       Impact factor: 4.711

7.  A-to-I RNA editing in the rat brain is age-dependent, region-specific and sensitive to environmental stress across generations.

Authors:  Hiba Zaidan; Gokul Ramaswami; Yaela N Golumbic; Noa Sher; Assaf Malik; Michal Barak; Dalia Galiani; Nava Dekel; Jin B Li; Inna Gaisler-Salomon
Journal:  BMC Genomics       Date:  2018-01-08       Impact factor: 3.969

8.  unitas: the universal tool for annotation of small RNAs.

Authors:  Daniel Gebert; Charlotte Hewel; David Rosenkranz
Journal:  BMC Genomics       Date:  2017-08-22       Impact factor: 3.969

Review 9.  RNA binding to APOBEC deaminases; Not simply a substrate for C to U editing.

Authors:  Harold C Smith
Journal:  RNA Biol       Date:  2016-11-21       Impact factor: 4.652

10.  Shrimp miR-34 from Shrimp Stress Response to Virus Infection Suppresses Tumorigenesis of Breast Cancer.

Authors:  Yalei Cui; Xiaoyuan Yang; Xiaobo Zhang
Journal:  Mol Ther Nucleic Acids       Date:  2017-10-26
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.