Literature DB >> 26593718

The Fanconi Anemia Pathway Maintains Genome Stability by Coordinating Replication and Transcription.

Rebekka A Schwab1, Jadwiga Nieminuszczy1, Fenil Shah2, Jamie Langton1, David Lopez Martinez3, Chih-Chao Liang3, Martin A Cohn3, Richard J Gibbons4, Andrew J Deans2, Wojciech Niedzwiedz5.   

Abstract

DNA replication stress can cause chromosomal instability and tumor progression. One key pathway that counteracts replication stress and promotes faithful DNA replication consists of the Fanconi anemia (FA) proteins. However, how these proteins limit replication stress remains largely elusive. Here we show that conflicts between replication and transcription activate the FA pathway. Inhibition of transcription or enzymatic degradation of transcription-associated R-loops (DNA:RNA hybrids) suppresses replication fork arrest and DNA damage occurring in the absence of a functional FA pathway. Furthermore, we show that simple aldehydes, known to cause leukemia in FA-deficient mice, induce DNA:RNA hybrids in FA-depleted cells. Finally, we demonstrate that the molecular mechanism by which the FA pathway limits R-loop accumulation requires FANCM translocase activity. Failure to activate a response to physiologically occurring DNA:RNA hybrids may critically contribute to the heightened cancer predisposition and bone marrow failure of individuals with mutated FA proteins.
Copyright © 2015 Elsevier Inc. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26593718      PMCID: PMC4644232          DOI: 10.1016/j.molcel.2015.09.012

Source DB:  PubMed          Journal:  Mol Cell        ISSN: 1097-2765            Impact factor:   17.970


Introduction

Replication of the human genome is a complex process requiring orchestrated activation and maintenance of replication forks emanating from thousands of origins of replication during S-phase. Replication forks stall when they encounter obstacles on the DNA, upon which they require swift processing to prevent their disassembly, resulting in DNA damage. Such collapsed replication forks can contribute to spontaneous recombination events and genomic instability, a hallmark of cancer (Aguilera and Gómez-González, 2008). Faithful DNA replication requires several factors, including proteins of the Fanconi anemia (FA) pathway. To date, 18 FA genes (FANCA-T) have been identified, and homozygous inactivation of any FA gene product leads to the pediatric syndrome Fanconi anemia, characterized by progressive bone marrow failure, spontaneous chromosomal instability, and high cancer predisposition. Functionally, the FA pathway can be divided into at least three different sub-complexes, the largest of which is the core complex consisting of the FANCA, FANCB, FANCC, FANCE, FANCF, FANCG, FANCL, and FANCM gene products. The core complex, together with the E2 ubiquitin-conjugating enzyme FANCT/UBE2T, have a critical role in activating the FA pathway through monoubiquitination of the FANCD2 and FANCI proteins. This, in turn, promotes DNA repair through the specialized downstream Fanconi proteins FANCD1/BRCA2, FANCN/PALB2, FANCJ/BRIP1, FANCO/RAD51C, FANCP/SLX4, FANCQ/XPF/ERCC4, and FANCS/BRCA1 (Hira et al., 2015, Kee and D’Andrea, 2012, Kottemann and Smogorzewska, 2013, Rickman et al., 2015, Walden and Deans, 2014, Wang, 2007). Cells from FA patients are hypersensitive to DNA interstrand crosslinking (ICL) agents, potent inhibitors of both DNA replication and transcription. Accordingly, it has been proposed that the FA pathway has a major role in responding to replication stress by facilitating the resolution of DNA lesions arising during DNA replication (Constantinou, 2012, Knipscheer et al., 2009, Kottemann and Smogorzewska, 2013). Recently, work from the Patel group (Langevin et al., 2011) has identified simple aldehydes that can arise endogenously from processes of cellular metabolism as a potent source of DNA damage that requires action of the FA proteins. Mice with combined deficiency for FANCD2 or FANCA and the aldehyde-catabolizing enzyme Aldh2 show developmental defects and early onset of acute leukemia (Langevin et al., 2011, Oberbeck et al., 2014). However, it is unclear how aldehydes confer their toxicity because mice mutually deficient for Aldh2 and the DNA translesion synthesis polymerase Rev1, which cooperates with FA proteins in the same pathway for ICL repair (Niedzwiedz et al., 2004), do not develop any of the phenotypes observed in FANCA/Aldh2-deficient mice (Oberbeck et al., 2014). Therefore, identifying the endogenous substrate that activates the FA pathway under normal growth conditions remains one of the key questions critical for the understanding of this devastating disease. During transcription, nascent RNA can form hydrogen bonds with one strand of the DNA double helix, leading to the formation of DNA:RNA hybrids (R-loops). R-loop formation has been described in vivo, and its physiological functions include class switch recombination, bacterial and mitochondrial replication, and protection against DNA methylation at CpG island promoters (Aguilera and García-Muse, 2012, Skourti-Stathaki and Proudfoot, 2014). Persistent R-loops could stall replication forks driving genome instability, which is fundamental to cancer and other diseases (Bhatia et al., 2014, Lecona and Fernández-Capetillo, 2014). Here we show that conflicts between replication and transcription and also transcription-associated DNA:RNA hybrids are crucial endogenous DNA lesions that require action of the FA proteins. In particular, we provide evidence that a functional FA pathway protects cells from unscheduled accumulation of such hybrids and that its loss results in an increased level of DNA damage and spontaneous chromosomal instability, both hallmarks of FA patients. Accordingly, inhibition of transcription or removal of excess DNA:RNA hybrids by expression of RNase H1 suppresses increased replication fork stalling and DNA damage occurring in FA-depleted cells. At the mechanistic level, we show that FANCM, the most highly conserved protein in the FA pathway, resolves DNA:RNA hybrids via its intrinsic translocase activity. Unexpectedly, we also found that aldehydes induce DNA:RNA hybrid formation in FANCD2-depleted cells, suggesting a mechanism by which by-products of cellular metabolism, such as simple aldehydes, could exert their toxic effect on our genome. Therefore, we propose that DNA:RNA hybrids are endogenous and physiological substrates of the FA pathway and that, by suppressing excessive DNA:RNA hybrid formation, the FA pathway ensures faithful genome duplication.

Results

The FA Pathway Facilitates Accurate Replication under Normal Growth Conditions

Hypersensitivity to agents that impede the progression of replisomes is a hallmark of FA, and, consequently, we and others have found that the FA pathway plays a role in the response to replicative stress (Knipscheer et al., 2009, Lossaint et al., 2013, Schlacher et al., 2012, Schwab et al., 2010). Accordingly, upon treatment with replication inhibitors, a central component of the FA pathway, FANCD2, is activated by monoubiquitination in an ATR-dependent manner (Andreassen et al., 2004). Subsequently, FANCD2 is targeted to damaged replication forks (Lossaint et al., 2013) and forms foci colocalizing with the DNA repair proteins γH2AX, BRCA1, and RAD51 (Montes de Oca et al., 2005, Taniguchi et al., 2002). Interestingly, FANCD2 is also monoubiquitinated and forms foci that colocalize with γH2AX in unchallenged cells (Taniguchi et al., 2002; Figure S1A). This suggests that FANCD2 is also required for dealing with replicative stress that arises in cells undergoing normal cell cycle progression. To test this, we analyzed DNA replication in control and FANCD2-depleted cells under normal growth conditions using the DNA fiber technique (Blackford et al., 2012, Schwab and Niedzwiedz, 2011). To determine the impact of FANCD2 depletion on global replication fork dynamics, we measured the lengths of sister fork tracts. Sister forks emanating from the same origin of replication and traveling in opposite directions typically display similar replication rates (Conti et al., 2007). Consequently, differences in tract lengths indicate that individual forks are more prone to stalling. We noticed a significant increase in asymmetric sister forks in FANCD2-downregulated cells compared with control cells (Figure 1A), suggesting a widespread perturbation of the normal replication program. In support of this notion, we also found increased phosphorylation of MCM2 on Ser-108 and RPA on Ser-33 (Figure 1B) in FANCD2 knockdown cells, both markers of replicative stress (Cortez et al., 2004, Sirbu et al., 2011). Failure to restart stalled forks is a strong signal for DNA damage (Schlacher et al., 2012), and, accordingly, western blot analysis showed increased γH2AX and phosphorylation of RPA2 at Ser-4/Ser-8 in FANCD2 knockdown cells (Figure 1C). These modifications are associated with DNA double-strand breaks (Sartori et al., 2007), and, therefore, we examined DNA integrity by single-cell gel electrophoresis. Cells with FANCD2 knockdown showed a significant increase in DNA breaks compared with control cells (Figure 1D). DNA damage is a precursor of genomic instability, and, in line with this, we found a greater number of cells with micronuclei in FANCD2-depleted cells (Figure 1E), a phenotype also observed in FA patient cells (Heddle et al., 1978). Moreover, FANCC−/− mouse embryonic fibroblasts (MEFs) as well as FANCA−/− mouse hematopoietic stem cells also display signs of replisome instability and activation of the DNA damage response (DDR) in unchallenged cells (Luebben et al., 2014, Walter et al., 2015). Taken together, these findings underscore the FA pathway’s general role in facilitating replication under normal growth conditions.
Figure 1

FANCD2 Protects Cells from Replication Stress and Preserves Genomic Integrity

(A) DNA fiber analysis comparing sister fork symmetry. Shown are typical sister forks of U2OS cells treated with control (sictrl) or FANCD2 siRNA (siFANCD2). The ratios of the lengths of two corresponding sister replication forks are plotted. The middle line represents the median and the boxes the 25th and 75th percentiles. The whiskers mark the smallest and largest values. Mann-Whitney test was used to determine statistical significance (n = 3). ∗∗∗p ≤ 0.001.

(B) Western blots of whole-cell lysates of control and FANCD2 siRNA-treated U2OS cells probed for phosphorylation of MCM2 on Ser-108 (MCM2-pS108) and RPA2 on Ser-33 (RPA2-pS33). Histone H3, PCNA, and RPA2 served as loading controls.

(C) Western blot showing activation of the DDR upon depletion of FANCD2, including phosphorylation of histone H2AX on Ser-139 (γH2AX) and of RPA2 on Ser-4 and Ser-8 (RPA2-pS4/S8). RPA2 and histone H3 were used as loading controls.

(D) Comet assays of RNAi-treated U2OS cells. Individual data points of olive tail moment are plotted, showing mean ±SEM in red (n = 3, two-tailed Mann-Whitney test). ∗∗∗∗p ≤ 0.0001.

(E) DAPI-stained nuclei and micronuclei (arrowheads) of RNAi-treated U2OS cells. Mean ±SEM of micronucleus-positive cells are plotted (n = 3; unpaired, two-tailed Student’s t test). ∗p ≤ 0.05.

The Fanconi Anemia Pathway Protects Replication Forks against Transcription-Induced Fork Collapse

Replication of actively transcribed genes induces local replication stress, and, hence, compromises genome stability (Helmrich et al., 2011, Tuduri et al., 2009). We wondered whether the defects we observed in FANCD2-deficient cells could stem from transcription impeding replisome progression. Using proximity ligation assays (PLAs), we observed that FANCD2 colocalizes with total as well as elongating RNA polymerase II (Figure 2A). This colocalization is decreased upon transcription inhibition, with the majority of the PLA-positive cells being confined to the S-phase of the cell cycle (Figures S1B and S1C). Next, we addressed whether transcription contributes to the FA pathway activation and genome instability seen in FANCD2-depleted cells by inhibiting transcription with cordycepin, a potent inhibitor of RNA chain elongation (Rose et al., 1977). Cordycepin treatment significantly decreased FA pathway activation, as measured by the frequency of FANCD2 focus-positive cells as well as FANCD2 monoubiquitination (Figure 2B; Figure S1D). The dose of cordycepin used extensively inhibited transcription without appreciably altering the cell cycle profile (Figures S3E–S3G). Importantly, treatment with two additional transcription inhibitors, 5,6-dichloro-1-β-D-ribofuranosyl-benzimidazole (DRB) and flavopiridol, also greatly decreased the number of FANCD2 focus-positive cells (Figure 2C). Strikingly, inhibition of transcription restored sister fork symmetry in FANCD2-depleted cells to the level observed in the control (Figures 2D and 2E), and this correlated with a reduction in the DNA damage response (Figures 2F and 2G).
Figure 2

FANCD2 Colocalizes with Sites of Transcription and Prevents Transcription-Induced Replication Stress

(A) Proximity ligation assay showing that FANCD2 colocalizes with total and transcriptionally elongating (phospho-S2) RNA polymerase II. neg. ctrl., negative control.

(B) Treatment with 50 μM of the transcription inhibitor cordycepin for 3 hr decreases the number of FANCD2 focus-positive cells. Means ±SEM are displayed (n = 4; unpaired, two-tailed Student’s t test). ∗p ≤ 0.05.

(C) Treatment with either 100 μM DRB or 0.8 μM flavopiridol for 2 hr decreases the number of FANCD2 focus-positive cells. Means ±SEM are shown (n = 3; unpaired, two-tailed Student’s t test). ∗p ≤ 0.05, ∗∗p ≤ 0.01.

(D) DNA fiber analysis comparing sister fork symmetry in control or FANCD2-depleted U2OS cells treated with DMSO or cordycepin. The ratios of the lengths of two corresponding sister replication forks are plotted. The middle line represents the median and the boxes the 25th and 75th percentiles. The whiskers mark the smallest and largest values. Mann-Whitney test was used to determine statistical significance (n = 3). ∗∗∗p ≤ 0.001, ∗∗∗∗p ≤ 0.0001.

(E) Flavopiridol treatment reduces replication fork asymmetry. The experiments were plotted and statistical analysis was performed as in(D). ∗p ≤ 0.05, ∗∗∗∗p ≤ 0.0001.

(F) Western blot of whole-cell lysates from cordycepin- and siRNA-treated U2OS cells. Cordycepin abolishes the activation of γH2AX occurring in the absence of FANCD2. MCM2 was the loading control.

(G) Western blot of whole-cell lysates from control and FANCD2-depleted cells treated with the transcription inhibitor DRB or flavopiridol. H3 served as the loading control.

Depletion of RNA biogenesis factors such as ASF/SF2 compromises transcription and results in genome instability (Li and Manley, 2005, Luna et al., 2005). Therefore, we hypothesized that ASF/SF2 knockdown should increase the likelihood of replication forks colliding with stalled transcription complexes and, as such, further compromise genome stability in FANCD2-depleted cells. Accordingly, we found that ASF/FANCD2 double-depleted cells grew significantly slower (Figure 3A; Figure S2A) and showed increased genome instability, as indicated by an elevated frequency of micronuclei and chromosomal aberrations compared with any of the single depletions (Figures 3B and 3C). These results provide further support to the notion that the defective DNA replication and genome instability observed in FANCD2 knockdown cells are associated with transcription complexes acting as promiscuous replication fork barriers.
Figure 3

Transcription-Associated Stress Exacerbates the Phenotype of FANCD2-Depleted Cells

(A) Representative alamar blue assay showing that mutual downregulation of ASF and FANCD2 decreases cell proliferation compared with control or single knockdown cells. Error bars show SD from triplicates. a.u., arbitrary unit.

(B) Quantification of micronuclei in U2OS cells showing mean ±SEM of three independent assays. Student’s t test was used for statistical analysis. ∗p ≤ 0.05; ∗∗p ≤ 0.01; ns, not significant.

(C) Typical example of a metaphase spread of cells treated with siRNA against ASF and FANCD2. Arrows point to aberrations. The graph displays the frequency of chromosomal aberrations in U2OS cells after treatment with the indicated siRNAs (SEM of three independent experiments; Student’s t test was used for statistical analysis). ∗p ≤ 0.05, ∗∗∗p ≤ 0.001.

The FA Pathway Suppresses Genomic Instability Associated with Unscheduled Accumulation of DNA:RNA Hybrids

Perturbation of transcription is associated with excessive R-loop formation and has recently been linked to genome instability (Aguilera and García-Muse, 2012, Gan et al., 2011, Skourti-Stathaki and Proudfoot, 2014, Tuduri et al., 2009). To determine whether the FA pathway is required to limit such structures, we blotted genomic DNA from control and FANCD2-depleted cells onto a membrane and probed it with the S9.6 antibody, which specifically recognizes DNA:RNA hybrids (Boguslawski et al., 1986). The intensity of the DNA:RNA hybrid signal was increased in FANCD2-depleted cells (Figure 4A). We confirmed this finding by performing immunostaining experiments with the S9.6 antibody and also noticed a marked increase in the nuclear fluorescence intensity in cells depleted of FANCD2 (Figure 4B). We also found increased nuclear DNA:RNA levels when excluding nucleolar signals from the analysis (Figure S2B), indicating that RNA:DNA hybrids are elevated both in the nucleoli and the nucleus.
Figure 4

The FA Pathway Prevents the Accumulation of DNA:RNA Hybrids

(A) Experimental overview. Quantitative infrared (IR) fluorescence of genomic DNA of control and FANCD2-depleted cells using S9.6 antibody. Denatured DNA was probed with an antibody against single-stranded DNA (ssDNA) to determine DNA loading. The graph shows the ratio of DNA:RNA hybrid IR fluorescence intensity divided by single-stranded DNA IR fluorescence intensity from four independent experiments.

(B) Assembled z stacks of immunofluorescence staining with S9.6 antibody of FANCD2-depleted or control U2OS cells. Shown is the distribution of mean fluorescence intensity of individual nuclei in arbitrary units, with mean ±SEM in shown red (two-tailed Mann-Whitney test, n = 3). ∗∗p ≤ 0.01.

(C) The same as in (B) but with cells incubated with sictrl or siFANCA. ∗∗∗∗p ≤ 0.0001.

(D) Quantified immunofluorescence intensity with the DNA:RNA hybrid-specific antibody S9.6 of wild-type (WT) DT40, FANCD2−/−, FANCD2 K563R mutant, and FANCL−/− cells. The dot plot represents the mean fluorescence intensity of individual nuclei from three independent experiments, with the middle line representing the mean and whiskers the SEM (two-tailed Mann-Whitney test). ∗∗∗∗p ≤ 0.0001.

To understand whether suppression of DNA:RNA hybrids is a general function of the FA pathway, we analyzed additional FA mutants. To this end, we depleted FANCA, which is required for FANCD2 monoubiquitination, and we found significantly increased DNA:RNA hybrid formation in these cells (Figure 4C; Figures S2C and S2D). To verify and extend this observation, we also analyzed the level of DNA:RNA hybrids in avian FANCD2−/− and FANCL−/− DT40 mutants. The levels of DNA:RNA hybrids were increased in these mutants compared with wild-type cells (Figure 4D), suggesting that accumulation of DNA:RNA hybrids is a general phenomenon associated with FA deficiency. The presence of increased levels of DNA:RNA hybrids in FANCL−/− knockout cells suggests that monoubiquitination of FANCD2 is required to suppress their formation because FANCL is the E3 ligase that carries out FANCD2 activation by monoubiquitination (Alpi et al., 2008, Meetei et al., 2003). Therefore, it was not surprising that avian FANCD2 knockin cells expressing endogenous levels of the monoubiquitination-defective FANCD2 K563R mutant protein (Seki et al., 2007) showed higher levels of DNA:RNA hybrids compared with the level observed in wild-type cells (Figure 4D). Taken together, our findings indicate that FA pathway activation and FANCD2 monoubiquitination are required to limit DNA:RNA hybrid formation. Next, we tested whether DNA:RNA hybrids contribute to the genome instability associated with FA deficiency. To this end, we made use of RNase H1, a nuclease that specifically removes such hybrids. First, we verified that overexpression of RNase H1 reduces the elevated DNA:RNA hybrid load observed in FANCD2 knockdown cells (Figure 5A). We confirmed this observation by incubating genomic DNA purified from control and FANCD2 knockdown cells with RNase H1. As expected, this treatment abolished the DNA:RNA hybrid signal in both samples (Figure S3A). Importantly, RNase H1 overexpression attenuated activation of the FA pathway in cells undergoing normal cell cycle progression, as judged by the significantly diminished formation of FANCD2 focus-positive cells as well as FANCD2 monoubiquitination (Figure 5B; Figure S3B), while not considerably altering the cell cycle profile (Figure S3C). Furthermore, it also rescued impaired the replication fork progression seen in FANCD2 knockdown cells (Figure 5C). This was accompanied by a significant reduction in DNA breaks as well as diminished activation of the DDR response (Figures 5D and 5E). Replicative stress has recently been linked to progressive elimination of hematopoietic stem and progenitor cells in FA patients because of constitutive activation of the p53/p21 response (Ceccaldi et al., 2012). We found that FANCD2-depleted U2OS cells also show a similar response, which was decreased upon overexpression of RNase H1 (Figure 5E). This indicates that physiologically occurring DNA:RNA hybrids induce FA pathway activation and, in its absence, contribute to the constitutive activation of the p53/p21 axis as well as genome instability associated with this disease.
Figure 5

Removal of DNA:RNA Hybrids Prevents Transcription-Induced Replication Stress in FANCD2-Depleted Cells

(A) Mean nuclear DNA:RNA hybrid fluorescence intensity of RNaseH1-overexpressing sictrl or siFANCD2-treated cells (n = 3, mean ±SEM, two-tailed Mann-Whitney test). ∗∗∗p ≤ 0.001, ∗∗∗∗p ≤ 0.0001.

(B) Frequency of cells with more than ten FANCD2 foci in control or GFP-RNaseH1-transfected U2OS cells. Mean ±SEM are plotted (two-tailed Student’s t test, n = 5). ∗p ≤ 0.05.

(C) Sister fork ratio with or without RNaseH1 overexpression. Box and whiskers are as in Figure 1A (n = 3, two-tailed Mann-Whitney test). ∗∗p ≤ 0.01, ∗∗∗p ≤ 0.001.

(D) Comet assay with sictrl and siFANCD2-treated cells overexpressing RNaseH1. Mean ±SEM is shown in red (two-tailed Mann-Whitney test, n = 3). ∗∗∗p ≤ 0.001.

(E) Western blot showing decreased activation of γH2AX, p53 (S-15) and p21 in FANCD2-depleted cells overexpressing RNaseH1. RPA2 served as a loading control.

(F) Distribution of mean fluorescence intensity of individual nuclei from control and FANCD2-depleted cells in the presence or absence of formaldehyde, with mean ±SEM shown in red (two-tailed Mann-Whitney test, n = 3). ∗∗∗∗p ≤ 0.0001.

Recently, it has been shown that DNA:RNA hybrid-associated DSB formation is dependent on XPF (Sollier et al., 2014). Therefore, we knocked down XPF in FANCD2-deficient cells to test the contribution of this structure-specific nuclease to the DNA damage load observed in these cells. As shown previously, knockdown of XPF decreased the overall level of DNA breaks, as measured by comet assay (Sollier et al., 2014; Figures S3D and S3E). Concomitant depletion of both XPF and FANCD2 resulted in a slightly decreased level of DNA breaks compared with the siFANCD2 sample. However, the level of damage seen in the double knockdown was still significantly higher than in XPF-depleted cells (Figure S3D). Therefore, we conclude that FANCD2 is required to suppress DNA breaks associated with the presence of DNA:RNA hybrids in a manner that is partially independent of the role of XPF in this process, perhaps specifically during the S-phase of the cell cycle. Finally, to verify our small interfering RNA (siRNA) data, we used clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nickase-based gene editing (Hsu et al., 2014) in U2OS cells to generate FANCD2−/− clones (Figures S4A and S4B). The use of Cas9 nickase has been shown recently to minimize any off-target effects (Shen et al., 2014). As expected, deletion of FANCD2 in the analyzed clones rendered the cells hypersensitive to the crosslinking agent cisplatin (Figure S4C). Similar to what we observed in siRNA-treated U2OS cells, both FANCD2−/− clones displayed increased DNA breaks, genome instability, and DNA:RNA hybrid formation under normal growth conditions (Figures S4D–S4F). Given that DNA-damaging agents, such as camptothecin (CPT) and UV light, induce DNA:RNA hybrid formation (Sollier et al., 2014, Tresini et al., 2015), we analyzed whether aldehydes, which have recently been implicated in the pathology of FA (Langevin et al., 2011), could also promote the formation of such structures. First, we assessed the effect of low, non-toxic doses of formaldehyde on transcription and cell cycle progression. Treatment with 5 μM formaldehyde for 2 hr did not markedly reduce overall transcription efficiency and cell cycle progression (Figures S5A and S5B). However, we found that formaldehyde treatment resulted in a further increase in DNA:RNA hybrids in FANCD2-deficient cells (Figure 5F). In line with the putative role for formaldehyde in DNA:RNA induction in FANCD2-deficient cells, inhibition of transcription with flavopiridol decreased the level of DNA:RNA hybrids in these cells (Figure S5C). Therefore, formaldehyde toxicity in FA-deficient cells could be, at least partially, related to its ability to induce DNA:RNA hybrids, thereby impacting replisome stability in the absence of FA. Taken together, these data suggest that the FA pathway prevents the deleterious effects associated with DNA:RNA hybrid accumulation and that such structures could be the cause of genome instability in FA-defective cells.

The Fanconi Anemia Pathway Promotes Genome Stability through FANCM-Coupled Resolution of DNA:RNA Hybrids

Next, we asked whether the FA pathway could provide enzymatic activity to resolve DNA:RNA hybrids directly. A likely member of the FA pathway with such a putative function is FANCM. It possesses double-stranded DNA translocase activity implicated in the processing of Holliday junction intermediates and replication fork reversal in vitro (Gari et al., 2008). In vivo, the protein has been shown to rescue stalled forks (Blackford et al., 2012, Schwab et al., 2010). Studies using recombinant FANCM have tested its activity only with DNA:DNA substrates (Gari et al., 2008). However, the protein is, in fact, classified to belong to the DEAD/DEAH family of DNA:RNA helicases. Therefore, we considered the possibility that FANCM could directly remove DNA:RNA hybrids through its translocase activity. In line with this notion, we observed a significant increase in DNA:RNA hybrid formation in FANCM-depleted cells (Figure 6A; Figure S6A). Importantly, purified FANCM was not only able to unwind replication fork structures, as shown previously (Gari et al., 2008; Figure S6B), but it efficiently unwound DNA:RNA hybrids in vitro (Figures 6B and 6C) despite such substrates being more stable than DNA:DNA hybrids found at a replication fork (Chien and Davidson, 1978). The branch-migratable structures were designed to mimic both the 5′ and 3′ ends of a DNA:RNA hybrid, and our biochemical analyses have shown that FANCM can translocate along either the Watson or Crick strand in a 3′-5′ direction and disrupt DNA:RNA base pairing (Figures 6B and 6C). As expected, the resolution of DNA:RNA hybrids requires FANCM’s translocase activity because the translocase-dead mutant protein was unable to unwind these substrates. Similarly, addition of non-hydrolysable ATP (ATP-γ-S) blocked the reaction (Figures 6B and 6C; Figure S6B). Finally, knockin DT40 cells expressing the translocase-dead variant of FANCM (Rosado et al., 2009) also displayed elevated levels of DNA:RNA hybrids (Figure 6D). This suggests a mechanism by which FANCM directly promotes DNA:RNA hybrid resolution, replication fork restart, and, consequently, faithful genome duplication. Because we observed no unwinding activity when the RNA sequence and flap sequence were heterologous (Figure S6C), we conclude that DNA:RNA hybrid resolution is carried out via its branch migration activity.
Figure 6

The FA Pathway Prevents DNA:RNA Hybrid Accumulation via the DNA:RNA Branch Migration Activity of FANCM

(A) Quantified immunofluorescence intensity with the DNA:RNA hybrid-specific antibody S9.6 of sictrl or siFANCM-treated cells. The dot plot represents the mean fluorescence intensity of individual nuclei from three experiments, with the middle line representing the mean and whiskers the SEM (two-tailed Mann-Whitney test). ∗∗∗∗p ≤ 0.0001.

(B) Model of branch migration activity of FANCM, leading to the resolution of DNA:RNA hybrids, and in vitro unwinding assays with purified FANCM or FANCM K117R mutant and FAAP24 on migratable 3′ and 5′ DNA:RNA flap structures.

(C) Quantification of DNA:RNA hybrid resolution using a migratable replication (Rep) fork substrate as a positive control.

(D) Quantified immunofluorescence intensity with the DNA:RNA hybrid-specific antibody S9.6 of WT DT40, FANCM−/− cells, and DT40 cells expressing FANCM D203A translocase-dead mutant protein. The dot plot represents mean fluorescence intensity of individual nuclei from three independent experiments, with the middle line representing the mean and whiskers the SEM (two-tailed Mann-Whitney test). ∗∗∗∗p ≤ 0.0001.

(E) Model explaining how the FA pathway prevents conflicts between replication and transcription. In the absence of the FA pathway, conflicts between replication and transcription result in activation of the DDR, DNA:RNA hybrid accumulation, defects in replication fork progression, DNA lesions, and genomic instability. In the presence of a functional FA pathway, transcription-induced replication fork stalling leads to monoubiquitination of FANCD2 by the FA core complex proteins and, therefore, activation of the FA pathway, resulting in stabilization of stalled replication forks. Subsequently, FANCM resolves replication blocks consisting of DNA:RNA hybrids via its translocase activity, and replication can resume normally.

Discussion

Although DNA:RNA hybrids form naturally and have an important role in various biological processes, such as class-switch recombination or transcription termination (Skourti-Stathaki et al., 2011, Yu et al., 2003), it has recently become apparent that their persistent presence can drive genomic instability (Aguilera and García-Muse, 2012, Skourti-Stathaki and Proudfoot, 2014). Consequently, their formation and removal must be controlled and balanced carefully to prevent a detrimental effect on genome stability, cell survival, and organismal development. Our data suggest that the FA pathway is an important player in controlling DNA:RNA hybrid-associated defects. Accordingly, we show that, under normal growth conditions and in the absence of a functional FA pathway, cells display signs of replicative stress because of replication forks being stalled by transcription complexes, which subsequently leads to replisome collapse, DNA breaks and genome instability. These phenotypes are suppressed by inhibition of transcription or removal of DNA:RNA hybrids through overexpression of RNase H1. Mechanistically, the FA pathway not only suppresses the formation of R-loops but also actively resolves such structures utilizing FANCM’s translocase activity. Based on these observations, we propose that the FA pathway plays a dual role in suppressing genome instability associated with conflicts between replication and transcription machineries. On one hand, it contributes to the stabilization of stalled replication forks until DNA:RNA hybrids are removed, and, on the other hand, it provides enzymatic activity to directly dismantle them. Consequently, this allows arrested replisomes to restart and faithfully complete genome duplication (Figure 6E). Mutations in proteins controlling DNA:RNA hybrid levels have been identified in various tumors and are also highly prevalent in leukemias (Groh and Gromak, 2014), occurring at a high rate in FA patients (Kee and D’Andrea, 2012). Therefore, it is conceivable that the FA pathway suppresses tumorigenesis by promoting the resolution of transcription-dependent replication blockades that could otherwise initiate the collapse of replication forks. This hypothesis could also explain the characteristic stem cell defects and heightened risk of tumorigenesis of FA patients because increased fork collapse might affect specific cellular compartments harboring cells that are particularly sensitive to DNA damage, such as hematopoietic precursors. In support of this, constitutive activation of the p53/p21 axis because of physiologically occurring replicative stress has recently been proposed as a central mechanism for progressive elimination of hematopoietic stem cells in FA patients (Ceccaldi et al., 2012). Accordingly, FANCA-deficient mouse hematopoietic stem cells show high levels of DNA damage during progression through S-phase (Walter et al., 2015). Recently, seminal work from the Patel laboratory has suggested naturally derived aldehydes as drivers of bone marrow failure in FA-deficient mice (Langevin et al., 2011). Because aldehydes generate a plethora of DNA adducts, it is still impossible to precisely pinpoint the nature of the endogenous DNA lesion induced by aldehydes upon which the FA proteins act. Interestingly, our data show that treatment with formaldehyde results in increased DNA:RNA hybrid formation, suggesting a mechanism by which these compounds could contribute to genome instability, in particular in the absence of FA. Notably, treatment with other DNA-damaging agents, such as CPT or UV light, has recently been shown to also induce R-loop formation (Sollier et al., 2014, Tresini et al., 2015). Therefore, toxicity associated with aldehydes could, at least partially, arise from altered transcription and/or transcript splicing, which can induce DNA:RNA hybrid formation (Huertas and Aguilera, 2003, González-Aguilera et al., 2008, Tresini et al., 2015). Alternatively, DNA nicks generated during the repair of aldehyde adducts could drive the formation of such hybrids. Indeed, it has been reported recently that nicks in the DNA template serve as strong DNA:RNA hybrid-initiating sites (Roy et al., 2010). Furthermore, it is possible that multiple compounds that arise endogenously from cellular metabolism could directly or indirectly induce DNA:RNA hybrid formation. Accordingly, DNA damage arises spontaneously in FA-deficient cells, including hematopoietic stem cells (Walter et al., 2015), which are still proficient for aldehyde-detoxifying enzymes. Therefore, we propose that the FA pathway counteracts physiologically arising replicative stress associated with transcription complexes and/or unresolved DNA:RNA hybrids acting as potent replication barriers.

Experimental Procedures

Cell Culture and Transfection with siRNA and DNA

U2OS and HeLa cells were maintained in DMEM and 10% fetal bovine serum (FBS). Chicken DT40 cells were cultured as described before (Schwab et al., 2010). siRNAs from Invitrogen were used for all knockdowns, with the following sequences: FANCA, AAGGGUCAAGAGGGAAAAAUA (Sato et al., 2012); FANCD2, GGUCAGAGCUGUAUUAUUC (Wagner and Karnitz, 2009); FANCM, AGACAUCGCUGAAUUUAAA (Xue et al., 2008); siASF, GUAUUGACCUUAUACUAAA (Tuduri et al., 2009); sictrl, CGUACGCGGAAUACUUCGA (Tuschl, 2006); and siXPF, UUAACGUGGUGCAUCAAGG. Cells were transfected twice with 24 nM siRNA oligonucleotides using HiPerFect (QIAGEN). Cells were harvested 48 hr after the second siRNA administration. For experiments with RNase H1, transfections were performed 24 hr after the second siRNA pulse, and cells were harvested 36 hr later. 0.8 ng/μl GFP-RNase H1 plasmid DNA was used for experiments analyzing FANCD2 ubiquitylation status, and 0.3 ng/μl was transfected for all other experiments. Transfections were performed with Lipofectamine 2000 (Invitrogen). The GFP-RNase H1 plasmid was a gift from N. Proudfoot.

Chromosomal Aberrations

Cells were prepared for analysis of chromosomal aberrations as described previously (Blackford et al., 2015).

Generation of FANCD2 by CRISPR/Cas9

The following guide RNA (gRNA) sequences targeting the fourth exon of FANCD2 were selected using the optimized CRISPR Design tool (http://crispr.mit.edu; Hsu et al., 2013; gRNA1, TTTGTCTTGTGAGCGTCTGC; gRNA2, GGAGTCTTACATTGAGGATG). DNA oligonucleotides were purchased from Integrated DNA Technologies and cloned into the pX335-GFP vector (Cong et al., 2013) to generate targeting constructs that were subsequently co-transfected in an equimolar ratio into U2OS cells using Lipofectamine 2000. 24 hr after transfection, cells were sorted using a MoFlo cell sorter (Beckman Coulter) for cells expressing Cas9 nickase (GFP-positive cells) and left to recover for 6 days before sorting for single cells and allowing colonies to form. FANCD2 expression was analyzed by western blotting. Two clones showing loss of all detectable FANCD2 were selected for subsequent analysis.

Immunofluorescence Microscopy

U2OS cells were grown overnight on coverslips. DT40 cells were allowed to set on Polysine slides (Thermo Scientific) for 10 min before fixation. Blocking was performed with 10% FBS in PBS for 1 hr. All antibodies were diluted in 0.1% FBS in PBS, and washes were performed with PBS unless stated otherwise. Alexa Fluor 488 or Alexa Fluor 555 secondary antibodies (Molecular Probes) were diluted 1:500. For quantification of micronuclei, cells were fixed and permeabilized in 100% methanol at −20°C for 20 min, blocked, and then incubated with anti-α-tubulin (1:1,000). The coverslips were mounted onto a microscope slide with Vectashield containing DAPI (Vector Laboratories). To visualize GFP-RNase H1 and FANCD2 foci, cells were fixed with 4% paraformaldehyde for 10 min and permeabilized with 0.5% Triton X-100 for 5 min. After blocking, cells were incubated with anti-FANCD2 (1:750) or anti-γH2AX (1:750), followed by incubation with the secondary antibody. Finally, coverslips were incubated with GFP booster (1:200, Atto488, Chromotek) and then mounted. For quantification of the S9.6 mean fluorescence intensity, cells were fixed with 4% paraformaldehyde for 10 min, extracted with 100% methanol at −20°C for 5 min, and then blocked with 5% BSA and 0.2% milk in PBS for 1 hr. S9.6 (1:60) was incubated in blocking buffer for 3 hr, and washes were performed with PBS containing 0.1% Tween 20. Images were acquired with a Zeiss 510 Meta laser-scanning confocal microscope at ×63 magnification. ImageJ was used for picture processing, assembly of z stacks, and quantification of S9.6 mean intensity.

DNA Slot Blot Analysis

3–5 × 106 cells were washed in PBS and lysed overnight in DNA lysis buffer (100 mM Tris-HCl [pH 8.5], 5 mM EDTA, 0.2% SDS, and 100 mM NaCl) containing 0.5 mg/ml proteinase K at 55°C. Genomic DNA was precipitated with isopropanol, spooled onto a rod, washed with 70% ethanol, air-dried, and resuspended in Tris-EDTA (TE) buffer. Equal amounts of DNA were blotted onto a nitrocellulose membrane (Amersham Biosciences) using a slot blot apparatus (Bio-Rad) and subsequently baked at 80°C for 2 hr. The membrane was blocked with 5% skimmed milk in PBS and incubated with S9.6 antibody, followed by incubation with an infrared dye secondary antibody (LI-COR Biosciences). The membrane was scanned using a quantitative fluorescence imaging system (Odyssey, LI-COR Biosciences). Subsequently, the membrane was incubated in denaturing buffer (0.4 M NaOH and 0.6 M NaCl), followed by neutralizing buffer (1.5 M NaCl and 0.5 M Tris [pH 7.4]) and an anti-single-strand DNA antibody to detect total DNA.

DNA Fiber Assay

The assay was performed as described elsewhere in detail (Schwab and Niedzwiedz, 2011).

Antibodies, Western Blotting, Cell Cycle Analysis, Transcription Inhibition, and PLA

See Supplemental Experimental Procedures for details.

Biochemical Analysis

Purification of FANCM:FAAP24 was performed as described previously (Coulthard et al., 2013). DNA:RNA hybrids that mimic the 5′ or 3′ region of the transcription bubble were generated using 30-base pair (bp) and 60-bp DNA and RNA oligonucleotides (Table S1). 5 pmol 5′-[γ32P]-labeled XOmig1 and 15 pmol cold oligos were annealed in 50 μl annealing buffer (5 mM Tris-HCl [pH 7.5], 10 mM NaCl, 1 mM MgCl2, and 0.1 mM DTT) using a two-step assembly method according to Table S2 and purified as described previously (Rass and West, 2006). For branch migration assays, 15-μl reactions contained 0.5 nM protein and 0.25 nM DNA substrate in reaction buffer (6 mM Tris [pH 7.5], 5% glycerol, 0.1 mM EDTA, 1 mM DTT, and 0.5 mM MgCl2) and 1 mM ATP or ATP-γ-S. Reactions were carried out at 30°C for the indicated periods, deproteinized, and separated by 12% PAGE in Tris-borate-EDTA (TBE). Quantification was performed using ImageJ after subtracting the background level of double-stranded DNA (dsDNA) in the input. See Tables S1 and S2 for oligo sequences.

Statistics

Statistical analysis was performed using GraphPad Prism 6.0e software and the tests described in the figure legends.

Author Contributions

R.A.S. carried out the majority of experimental work with contributions from J.N., W.N., J.L., D.L.M., C.C.L., and M.A.C. F.S. and A.J.D. performed the biochemical analysis. R.J.G. contributed to the DNA:RNA hybrid experiments. W.N. and R.A.S. conceived the project and wrote and edited the manuscript.
  64 in total

1.  Cotranscriptionally formed DNA:RNA hybrids mediate transcription elongation impairment and transcription-associated recombination.

Authors:  Pablo Huertas; Andrés Aguilera
Journal:  Mol Cell       Date:  2003-09       Impact factor: 17.970

2.  Replication fork velocities at adjacent replication origins are coordinately modified during DNA replication in human cells.

Authors:  Chiara Conti; Barbara Saccà; John Herrick; Claude Lalou; Yves Pommier; Aaron Bensimon
Journal:  Mol Biol Cell       Date:  2007-05-23       Impact factor: 4.138

3.  Characterization of monoclonal antibody to DNA.RNA and its application to immunodetection of hybrids.

Authors:  S J Boguslawski; D E Smith; M A Michalak; K E Mickelson; C O Yehle; W L Patterson; R J Carrico
Journal:  J Immunol Methods       Date:  1986-05-01       Impact factor: 2.303

4.  RNA:DNA hybrids are more stable than DNA:DNA duplexes in concentrated perchlorate and trichloroacetate solutions.

Authors:  Y H Chien; N Davidson
Journal:  Nucleic Acids Res       Date:  1978-05       Impact factor: 16.971

5.  Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects.

Authors:  Bin Shen; Wensheng Zhang; Jun Zhang; Jiankui Zhou; Jianying Wang; Li Chen; Lu Wang; Alex Hodgkins; Vivek Iyer; Xingxu Huang; William C Skarnes
Journal:  Nat Methods       Date:  2014-03-02       Impact factor: 28.547

6.  Sensitivity to five mutagens in Fanconi's anemia as measured by the micronucleus method.

Authors:  J A Heddle; C B Lue; E F Saunders; R D Benz
Journal:  Cancer Res       Date:  1978-09       Impact factor: 12.701

7.  Deficiency of UBE2T, the E2 Ubiquitin Ligase Necessary for FANCD2 and FANCI Ubiquitination, Causes FA-T Subtype of Fanconi Anemia.

Authors:  Kimberly A Rickman; Francis P Lach; Avinash Abhyankar; Frank X Donovan; Erica M Sanborn; Jennifer A Kennedy; Carrie Sougnez; Stacey B Gabriel; Olivier Elemento; Settara C Chandrasekharappa; Detlev Schindler; Arleen D Auerbach; Agata Smogorzewska
Journal:  Cell Rep       Date:  2015-06-25       Impact factor: 9.423

Review 8.  Replication stress and cancer: it takes two to tango.

Authors:  Emilio Lecona; Oscar Fernández-Capetillo
Journal:  Exp Cell Res       Date:  2014-09-26       Impact factor: 3.905

9.  The Fanconi anemia pathway promotes replication-dependent DNA interstrand cross-link repair.

Authors:  Puck Knipscheer; Markus Räschle; Agata Smogorzewska; Milica Enoiu; The Vinh Ho; Orlando D Schärer; Stephen J Elledge; Johannes C Walter
Journal:  Science       Date:  2009-11-12       Impact factor: 47.728

10.  A concomitant loss of dormant origins and FANCC exacerbates genome instability by impairing DNA replication fork progression.

Authors:  Spencer W Luebben; Tsuyoshi Kawabata; Charles S Johnson; M Gerard O'Sullivan; Naoko Shima
Journal:  Nucleic Acids Res       Date:  2014-03-03       Impact factor: 16.971

View more
  148 in total

1.  Genome instability: Stress management by the FA pathway.

Authors:  Sarah Seton-Rogers
Journal:  Nat Rev Cancer       Date:  2015-11-13       Impact factor: 60.716

Review 2.  Fanconi anemia and the underlying causes of genomic instability.

Authors:  Julie Rageul; Hyungjin Kim
Journal:  Environ Mol Mutagen       Date:  2020-02-06       Impact factor: 3.216

Review 3.  Mechanisms of Oncogene-Induced Replication Stress: Jigsaw Falling into Place.

Authors:  Panagiotis Kotsantis; Eva Petermann; Simon J Boulton
Journal:  Cancer Discov       Date:  2018-04-13       Impact factor: 39.397

4.  The DNA damage response acts as a safeguard against harmful DNA-RNA hybrids of different origins.

Authors:  Sonia Barroso; Emilia Herrera-Moyano; Sergio Muñoz; María García-Rubio; Belén Gómez-González; Andrés Aguilera
Journal:  EMBO Rep       Date:  2019-07-24       Impact factor: 8.807

Review 5.  Proteolytic control of genome integrity at the replication fork.

Authors:  Julie Rageul; Alexandra S Weinheimer; Jennifer J Park; Hyungjin Kim
Journal:  DNA Repair (Amst)       Date:  2019-07-10

6.  Transcription-Replication Conflict Orientation Modulates R-Loop Levels and Activates Distinct DNA Damage Responses.

Authors:  Stephan Hamperl; Michael J Bocek; Joshua C Saldivar; Tomek Swigut; Karlene A Cimprich
Journal:  Cell       Date:  2017-08-10       Impact factor: 41.582

7.  The chromatin remodelling factor ATRX suppresses R-loops in transcribed telomeric repeats.

Authors:  Diu Tt Nguyen; Hsiao Phin J Voon; Barbara Xella; Caroline Scott; David Clynes; Christian Babbs; Helena Ayyub; Jon Kerry; Jacqueline A Sharpe; Jackie A Sloane-Stanley; Sue Butler; Chris A Fisher; Nicki E Gray; Thomas Jenuwein; Douglas R Higgs; Richard J Gibbons
Journal:  EMBO Rep       Date:  2017-05-09       Impact factor: 8.807

8.  An ATR-dependent function for the Ddx19 RNA helicase in nuclear R-loop metabolism.

Authors:  Dana Hodroj; Bénédicte Recolin; Kamar Serhal; Susan Martinez; Nikolay Tsanov; Raghida Abou Merhi; Domenico Maiorano
Journal:  EMBO J       Date:  2017-03-17       Impact factor: 11.598

Review 9.  Transcription-replication conflicts at chromosomal fragile sites-consequences in M phase and beyond.

Authors:  Vibe H Oestergaard; Michael Lisby
Journal:  Chromosoma       Date:  2016-10-28       Impact factor: 4.316

10.  SLFN11 promotes stalled fork degradation that underlies the phenotype in Fanconi anemia cells.

Authors:  Yusuke Okamoto; Masako Abe; Anfeng Mu; Yasuko Tempaku; Colette B Rogers; Ayako L Mochizuki; Yoko Katsuki; Masato T Kanemaki; Akifumi Takaori-Kondo; Alexandra Sobeck; Anja-Katrin Bielinsky; Minoru Takata
Journal:  Blood       Date:  2021-01-21       Impact factor: 22.113

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.