Literature DB >> 26495845

Adenomatous Polyposis Coli Mutation Leads to Myopia Development in Mice.

Zhen Liu1, Fangfang Qiu1, Jing Li1, Zhenzhen Zhu1, Wenzhao Yang1, Xiangtian Zhou2, Jianhong An2, Furong Huang2, Qiongsi Wang2, Peter S Reinach2, Wei Li1, Wensheng Chen1, Zuguo Liu1.   

Abstract

Myopia incidence in China is rapidly becoming a very serious sight compromising problem in a large segment of the general population. Therefore, delineating the underlying mechanisms leading to myopia will markedly lessen the likelihood of other sight compromising complications. In this regard, there is some evidence that patients afflicted with familial adenomatous polyposis (FAP), havean adenomatous polyposis coli (APC) mutation and a higher incidence of myopia. To clarify this possible association, we determined whether the changes in pertinent biometric and biochemical parameters underlying postnatal refractive error development in APCMin mice are relevant for gaining insight into the pathogenesis of this disease in humans. The refraction and biometrics in APCMin mice and age-matched wild-type (WT) littermates between postnatal days P28 and P84 were examined with eccentric infrared photorefraction (EIR) and customized optical coherence tomography (OCT). Compared with WT littermates, the APCMin mutated mice developed myopia (average -4.64 D) on P84 which was associated with increased vitreous chamber depth (VCD). Furthermore, retinal and scleral changes appear in these mice along with: 1) axial length shortening; 2) increased retinal cell proliferation; 3) and decreased tyrosine hydroxylase (TH) expression, the rate-limiting enzyme of DA synthesis. Scleral collagen fibril diameters became heterogeneous and irregularly organized in the APCMin mice. Western blot analysis showed that scleral alpha-1 type I collagen (col1α1) expression also decreased whereas MMP2 and MMP9 mRNA expression was invariant. These results indicate that defective APC gene function promotes refractive error development. By characterizing in APCMin mice ocular developmental changes, this approach provides novel insight into underlying pathophysiological mechanisms contributing to human myopia development.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26495845      PMCID: PMC4619832          DOI: 10.1371/journal.pone.0141144

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Myopia is a global public health problem severely impacting on the quality of life [1]. Higher degrees of myopia are a risk factor for ocular complications, such as glaucoma, retinal degeneration, and choroidal neovascularization leading to permanent visual impairment and even blindness [2,3]. Although numerous potential human risk factors have been identified, the underlying mechanisms contributing to ocular growth regulation and refractive error development remain largely unclear. Recent studies on myopia in humans and animal models suggest that excessive axial length elongation [4,5], increased retinal proliferation [6], degenerative scleral changes [7,8] are associated with myopia development. Although the molecular mechanisms underlying these changes require further elucidation, this condition alters expression levels of various neurotransmitter mediators, and hormones including muscarinic receptors [9]. Dopamine (DA) pharmacology [10] and responses induced by retinoic acid [11], glucagon [12] and EGR-1(also named ZENK) [13] which contribute to myopia and visual development are also modified by, DA control modulation affects ocular growth by acting mostly as a ‘stop signal’ of this process [14]. Such a role is indicated for DA since retinal DA levels and TH activity declined in eyes deprived of sharp vision by using either diffusers (form deprivation myopia, FDM) or minus lenses (lens induced myopia, LIM) [15-17]. The adenomatous polyposis coli (APC) gene has 15 exons, localized to the long arm of chromosome 5(5q21- q22) [18]. APC is an ubiquitously expressed tumor suppressor protein, which has essential roles in regulating cell cycle progression, migration, differentiation and apoptosis [19]. During early embryonic eye development, APC mRNA is abundantly expressed in the neural retinal and retinal pigment epithelial (RPE) cells [20]. The majority of sequence aberrations in APC are frameshift or nonsense mutations leading to truncated protein expression [21]. More than 50 adenomatous polyps in the colon and rectum [22] are characteristic of familial adenomatous polyposis (FAP) caused by APC mutations. Congenital retinal pigment epithelial hypertrophy (CHRPE) is the most frequent manifestation of FAP [22]. Several APC-mutant mouse models have been generated resembling the FAP and colon cancer phenotype [23]. Mice with a disrupted APC gene also develop RPE hypertrophy [24]. It has been reported that 10 out of 14 FAP individuals with refraction anomalies had myopia ranging from -0.5 to -10.0 diopters (mean, -3.1 diopters) [22]. These considerations are suggestive of a potential role for an APC mutation contributing to refractive error development. In the present study, we examined in APCMin mice the association between myopia development and time dependent changes in refractive and biometric parameters to elucidate the functional role of an APC mutation (APCMin) in this process. The APCMin mice generated by random ethylnitrosourea (ENU) mutagenesis, carries in the APC gene a nonsense mutation at codon 850 leading to adult onset anemia and multiple intestinal neoplasia (Min) [25]. We observed a greater myopic shift, increased vitreous chamber depth and scleral collagen fibril rearrangement. In addition, retinal proliferation increased whereas TH expression declined.

Materials and Methods

Experimental Animals

Age-matched male APCMin mice (stock number 002020) on the C57BL/6 background and wild-type (WT) male C57BL/6 mice (purchased from Nanjing Biomedical Research Institute of Nanjing University, China) were used for this study. All animals were housed in cages at 25°C, on a 12:12 light-dark hour cycle, with food and water available ad libitum. Luminance in the cages was approximately 200 lux. All procedures were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The protocols in our study were approved by the Committee on the Ethics of Animal Experiments of Xiamen University (Permit Number: XMUMC2012-12-9) APCMin mice were genotyped following a PCR protocol recommended by the Jackson Laboratory. A total of 26 mice were separated into 13 APCMin mice and 13 wild-type mice. Each group underwent a series of ocular measurements at each of the following 6 postnatal time points: 28, 35, 42, 56, 70 and 84 days. All samples and measurements were obtained during the light period, at least two hours after lights-on and two-hours before lights-off. First, their refractive state was measured. Subsequently, mice were anesthetized by intraperitoneal injection of 1.2% ketamine (70 mg/kg body weight) /1.6% xylazine (10 mg/kg body weight) mixture and ocular dimensions were measured.

Biometric Measurements

Postnatal refractive state development of the right eyes was characterized based on measurements of corneal radius of curvature (CRC), pupil diameter (PD), ocular anterior chamber depth (ACD), lens thickness (LT), vitreous chamber depth (VCD) and axial length (AL) on 28, 35, 42, 56, 70 and 84 days. There was no systematic left vs right eye anisometropia. Briefly, refractive state and PD were measured in a darkened room with an eccentric infrared photorefractor (EIR)[26]. The mice were gently positioned in front of the photoretinoscope, and swiftly repositioned until a clear first Purkinje image appeared in the center of the pupil. The measured refractive errors were then recorded by using software designed by Schaeffel et al [27]. Measurements were repeated at least three times for each eye. The CRC was measured with a keratometer (OM-4; Topcon Corporation, Dongguan, Japan), modified by mounting a +20.0 diopter (D) aspherical lens [28]. Each eye was measured three times to obtain a mean value. A custom-made real-time OCT instrument measured the AL and other ocular parameters [29]. After being anesthetized, each mouse was observed using a video viewing system for final orientation and positioning. The ACD was defined as the distance from the posterior surface of the cornea to the anterior surface of the lens. The VCD was defined as the distance from the back of the lens to the nerve fiber layer of the retina. The AL was defined as the distance between the anterior surface of the cornea and the vitreous-retina interface. Finally, after evaluating the refractive indices for each component of the eye, they were used to convert the recorded optical path length into a geometric path length. Each eye was scanned three times.

Transmission Electron Microscopy

APCMin and wild type mice were sacrificed by cervical dislocation at P84. The right eyes of five wildtype and APCMin mice were evaluated. The anterior segment of the eye including the cornea, iris, and crystalline lens was cut away from the anterior scleral rim, and the vitreous body and retina were also dissected and discarded, leaving only the sclera. Posterior scleral tissue was fixed in a mixture composed of 2.5% glutaraldehyde and 4% paraformaldehyde in PBS (pH = 7.4) for 2 h. Then, the scleras were cut into 1×1mm pieces for further fixing, embedding, slicing, staining, and examined with a transmission electron microscope (JEM2100HC; JEOL, Tokyo, Japan).

Immunostaining

Cryostat sections (10 μm in thickness) of each eyeball were fixed in cold acetone, and blocked with 2% normal bovine serum for 1h at room temperature. Sections of central retina were incubated with primary antibodies for TH (Millipore, AB152, 1:1000) and Ki67 (Abcam, ab15580, 1:300) overnight at 4°C and washed thoroughly with PBS. After further incubation in FITC-conjugated IgG (Invitrogen, 1:300), sections were counterstained with DAPI (Vector, H-1200) mounted, and photographed using a confocal laser scanning microscope (Fluoview 1000, Olympus, Tokyo, Japan).

Western Blot

Retinal and scleral homogenates were resolved by SDS-PAGE and then blotted with specific antibodies for Ki67 (Abcam, ab15580, 1:200), TH (Millipore, AB152, 1:1000) and col1α1 (Santa Cruz, sc-28657, 1:1000) overnight at 4°C. Detection was achieved with an anti-rabbit-horseradish peroxidase (RD, HAF008, 1:1000). The signal was detected with a chemiluminescence kit (ECL, Thermo, 32106). Each protein band was normalized to β-actin expression levels in the same gel.

Quantitative Real-time Reverse Transcription (RT)-PCR

Total RNA of sclera was isolated using TRIzol reagent (Invitrogen, USA), and its purity was confirmed by the OD260/280 nm absorption ratio (>1.8). Total RNAs (1μg) was reverse transcribed to cDNA using a cDNA Synthesis Kit (Takara, China). Quantitative real-time RT- PCR (Q-RT-PCR) was performed with a StepOne Real-Time PCR detection system (Applied Biosystems, Carlsbad, CA, USA) using an SYBR Premix Ex Taq Kit (Takara, China) according to the manufacturer’s instructions. Q-RT-PCR was performed in a 20 μL reaction under the following conditions: 95°C for 10 min, followed by 40 cycles of amplification at 95°C for 10 s and 60°C for 30 s. All experiments were performed in triplicate. The specific gene products were amplified using the following primer pairs: β-actin, 5- agccatgtacgtagccatcc -3 and 5-ctctcagctgtggtggtgaa -3; col1α1, 5- gagagcgaggccttcccgga-3 and 5- gggagccagcgggaccttgt-3; MMP2, 5- gttcaacggtcgggaataca-3 and 5- gccatacttgccatccttct-3; MMP9, 5- gactacgataaggacggcaaat-3 and 5- agatgaacgggaacacacag -3. A non-template control was included to evaluate the level of DNA contamination. The mRNA levels were analyzed by the comparative Ct method and normalized using β-actin.

Statistical Analysis

Data analysis was conducted with commercial software (SPSS, ver.13.0; SPSS, Chicago, IL and Prism 5). Differences between WT and APCMin genotypes at indicated postnatal days were analyzed by the independent Student t-tests. The Spearman linear correlation was used to test for significant relationships between the refractive error and the other ocular parameters. The value of each parameter is reported as the mean ± SEM of the right eyes of 13 mice in each age group. Values of western blot and Q-RT-PCR are shown as mean ± SD. A value of P < 0.05 was considered statistically significant. Significance levels are denoted by asterisks (*P <0.05, **P <0.01, ***P <0.001; ns, not significant).

Results

Relative myopia development in APCMin mice from P28 to P84

APCMin mice seldom live longer than 140 days because they develop intestinal bleeding and severe anaemia [23]. This limitation accounts for why ocular dimensions in each of ten APCMin mice and age-matched wildtype (WT) mice were only measured from P28 to P84 (Table 1). Consistent with previous reports [26], the refractive error of the WT mice, measured by EIR, increased rapidly in the hyperopic direction. Although APCMin mice also developed myopic shifts before P56, there was no diopter difference between them and WT mice. Nevertheless, APCMin mice were an average of -4.64D more myopic than the WT littermates on P84 (WT: n = 13, APCMin: n = 13, P<0.05, Fig 1A). To further characterize ocular growth in APCMin mice, we measured AL and VCD with custom-built biometric equipment specifically designed for mice. VCD in both genotypes decreased with time, and there was a significant difference between the two genotypes after P28 (P<0.05) (Fig 1B). The VCD in APCMin mice was longer than in WT littermates after P28 (e.g. 0.59 ± 0.04 mm VS 0.55 ± 0.01 mm at P84), which is consistent with VCD elongation observed in myopic human eyes [30]. AL in both genotypes increased during postnatal development. However, the AL in APCMin mice was significantly shorter at each time point compared with that in WT mice (e.g. 2.86 ± 0.03 mm VS 2.92 ± 0.02 mm at P84; Fig 1C), which is inconsistent with the clinical features of myopia [30].
Table 1

Comparison of biometric parameters in WT and APCMin mice.

Age (d)Refraction (D)PD (mm)CRC (mm)ACD (mm)LT (mm)RCALS (mm)VCD (mm)AL (mm)BW (g)
P28
WT-2.35±0.232.03±0.071.34±0.030.39±0.011.70±0.061.67±0.170.63±0.062.80±0.0110.90±0.66
Mt-3.25±0.282.03±0.071.33±0.020.34±0.01** 1.50±0.04** 1.32±0.120.71±0.02* 2.65±0.01** 14.90±1.07*
P35
WT-1.69±0.632.14±0.081.33±0.020.39±0.021.66±0.061.16±0.050.63±0.062.80±0.0116.70±0.66
Mt-3.78±0.682.23±0.090.31±0.030.34±0.01** 1.50±0.05** 1.15±0.070.71±0.02* 2.65±0.01** 19.28±0.53*
P42
WT-1.11±0.332.16±0.081.33±0.020.41±0.011.72±0.041.15±0.060.59±0.032.84±0.0120.07±0.43
Mt-2.20±0.352.17±0.101.28±0.030.38±0.02** 1.58±0.04** 1.09±0.070.67±0.04** 2.73±0.01** 20.91±0.25
P49
WT-1.28±0.842.17±0.091.34±0.030.43±0.021.75±0.041.11±0.050.59±0.032.87±0.0322.04±0.44
Mt-2.62±0.622.24±0.071.27±0.020.40±0.01* 1.61±0.03** 1.09±0.060.65±0.03** 2.77±0.01** 21.70±0.27
P56
WT-1.63±0.462.27±0.071.39±0.020.43±0.011.76±0.031.20±0.090.59±0.022.90±0.0123.73±0.39
Mt-2.67±0.372.25±0.081.33±0.020.40±0.01* 1.66±0.03** 1.18±0.060.64±0.03* 2.79±0.01** 22.72±0.33
P70
WT-1.06±0.452.28±0.091.33±0.030.43±0.011.81±0.021.11±0.050.56±0.032.92±0.0124.75±0.57
Mt-4.39±0.34** 2.26±0.051.31±0.020.40±0.021.72±0.03** 1.13±0.050.62±0.03* 2.85±0.03** 23.67±0.25
P84
WT-0.22±0.682.30±0.071.36±0.020.43±0.021.82±0.031.19±0.070.55±0.012.92±0.0227.87±0.55
Mt-4.42±0.46** 2.32±0.071.36±0.030.42±0.011.73±0.05** 1.16±0.110.59±0.04* 2.86±0.01** 26.93±0.43

WT, wild type; Mt, APCMin mice; PD, pupil diameter; CRC, corneal radius of curvature; ACD, anterior chamber depth; LT, lens thickness; RCALS, radius of curvature of anterior lens surface; VCD, vitreous chamber depth; AL, axial length; BW, body weight. Data are expressed as mean ± SEM (WT: n = 13, Mt: n = 13). Independent sample Student t-tests were applied between WT and APCMin group.

* P < 0.05

** P < 0.01 compared with the WT group.

Fig 1

APCMin mice have a greater myopic shift and longer vitreous chamber depth (VCD) than the WT littermates during postnatal development.

Comparison of refractive status (A), VCD (B), and AL (C), between APCMin mice and WT littermates at the indicated postnatal time points from P28 to P84. The asterisk denotes a significant difference between APCMin mice and WT mice. *P <0.05, ** P<0.01, independent Student- t-tests, WT: n = 13, APCMin mice: n = 13.

APCMin mice have a greater myopic shift and longer vitreous chamber depth (VCD) than the WT littermates during postnatal development.

Comparison of refractive status (A), VCD (B), and AL (C), between APCMin mice and WT littermates at the indicated postnatal time points from P28 to P84. The asterisk denotes a significant difference between APCMin mice and WT mice. *P <0.05, ** P<0.01, independent Student- t-tests, WT: n = 13, APCMin mice: n = 13. WT, wild type; Mt, APCMin mice; PD, pupil diameter; CRC, corneal radius of curvature; ACD, anterior chamber depth; LT, lens thickness; RCALS, radius of curvature of anterior lens surface; VCD, vitreous chamber depth; AL, axial length; BW, body weight. Data are expressed as mean ± SEM (WT: n = 13, Mt: n = 13). Independent sample Student t-tests were applied between WT and APCMin group. * P < 0.05 ** P < 0.01 compared with the WT group.

Abnormal anterior segment growth in APCMin Mice

Both PD and CRC increased during postnatal development, and there was no significant difference between the two genotypes at any time point (Fig 2A and 2B). Similarly, ACD and LT increased during postnatal development in both genotypes, whereas ACD in APCMin mice was shorter than in the WT from P28 to P56. On the other hand, this difference did not persist after P70 (Fig 2C). Meanwhile, LT in APCMin mice was significantly shorter than that in the WT mice (P<0.05), and the anterior lens surface radius of curvature of (RCALS) after P28 was the same in both groups (P>0.05) (Fig 2D and 2E).
Fig 2

Comparison of changes in biometric parameters of APCMin mice and WT littermates during postnatal development.

APCMin mice and WT littermates were evaluated for pupil diameter (PD) (A), radius of corneal curvature (CRC) (B), anterior chamber depth (ACD) (C), lens thickness (LT) (D), radius of curvature of anterior lens surface (RCALS) (E) and body weight (F) from P28 to P84. There was no difference in PL, CRC, and RCALS during this time period. However, ACD is shorter in APCMin mice than in WT from P28 to P56; LT in APCMin mice is smaller than in WT from P28 and P84; body weight in the APCMin mice were heavier than the WT mice from P28 toP35. The asterisk denotes a significant difference between APCMin mice and WT mice. *P <0.05, ** P<0.01, independent sample Student t-tests, WT: n = 13, APCMin mice: n = 13.

Comparison of changes in biometric parameters of APCMin mice and WT littermates during postnatal development.

APCMin mice and WT littermates were evaluated for pupil diameter (PD) (A), radius of corneal curvature (CRC) (B), anterior chamber depth (ACD) (C), lens thickness (LT) (D), radius of curvature of anterior lens surface (RCALS) (E) and body weight (F) from P28 to P84. There was no difference in PL, CRC, and RCALS during this time period. However, ACD is shorter in APCMin mice than in WT from P28 to P56; LT in APCMin mice is smaller than in WT from P28 and P84; body weight in the APCMin mice were heavier than the WT mice from P28 toP35. The asterisk denotes a significant difference between APCMin mice and WT mice. *P <0.05, ** P<0.01, independent sample Student t-tests, WT: n = 13, APCMin mice: n = 13. To evaluate whether the development of myopia is confounded by a change in APCMin mice body weight, we weighed them during postnatal development. Their weights progressively increased without any difference between the two genotypes after P42, but the APCMin mice were heavier than the WT mice at P28 and P35 (Fig 2F).

Retinal morphological and proliferative changes in APCMin mice

During myopia development, retinal structural and functional changes occur [31,32]. Given the myopic shift in APCMin mice, retinal histologic cross-sections were examined in APCMin mice and age-matched WT mice at P84. Hematoxylin- eosin staining (H&E) staining showed an intact RPEmembrane in WT mice at P84 (Fig 3A). In contrast, RPE cell layer ruptures were evident in the APCMin mice at the same time point (Fig 3B). Clinical studies also showed defects in the RPE membrane in the macular region of the highly axially myopic eyes [33].
Fig 3

Comparison of retinal morphology at P84 in APCmin mice and age-matched WT littermates.

H&E stained cross-sections show that the RPE membrane (arrows) is broken and the retina is thicker, especially in the INL and IPL (B) but not in age-matched WT control (A). Ki67 immunostaining of eye sections of WT (C) and APCMin mice (D), The thickness of the INL and IPL was quantified in the APCMin mice and WT mice (E). Fifty microgram of retinal proteins from P84 APCMin mice and age-matched wild type (WT) mice was used for Western blot analysis of Ki67 (F), semiquantified by densitometry and normalized by β-actin levels (G) (mean ± S.D., n = 5), * P<0.05. RPE, retinal pigment epithelium; ONL, outer nuclear layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, Ganglion cell layer.

Comparison of retinal morphology at P84 in APCmin mice and age-matched WT littermates.

H&E stained cross-sections show that the RPE membrane (arrows) is broken and the retina is thicker, especially in the INL and IPL (B) but not in age-matched WT control (A). Ki67 immunostaining of eye sections of WT (C) and APCMin mice (D), The thickness of the INL and IPL was quantified in the APCMin mice and WT mice (E). Fifty microgram of retinal proteins from P84 APCMin mice and age-matched wild type (WT) mice was used for Western blot analysis of Ki67 (F), semiquantified by densitometry and normalized by β-actin levels (G) (mean ± S.D., n = 5), * P<0.05. RPE, retinal pigment epithelium; ONL, outer nuclear layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, Ganglion cell layer. Compared with age matched WT controls, the retina was significantly thicker in APCMin mice at P84 (Fig 3A and 3B). On the other hand, there was no difference between APCMin and age-matched WT in the outer nuclear layer (ONL) thickness. Nevertheless, inner nuclear layer (INL) and inner plexiform layer (IPL) of the APCMin mice were thicker compared with those in WT mice (27.68±0.37 μm VS 18.27±0.29 μm, 37.36±0.37 μm VS 26.68±0.33 μm, APCMin VS WT, P<0.001, n = 5, Fig 3E). To determine whether an increase in cell proliferation accounts for INL and IPL thickening, Ki67 expression levels were evaluated in western blots (n = 5). Previously, Geller et al. suggested that cellular Ki67 labeling (clone MIB-1) is a more accurate means of evaluating cellular proliferation in the retina and elsewhere in the CNS [34]. We found that Ki67 increased more in the APCMin retinas than in age-matched WT mice (Fig 3C, 3D and 3F). Therefore, the current results provide evidence that the refractive error of the APCMin mice is accompanied by increased retinal cell proliferation, which is consistent with a previous study [6].

Tyrosine hydroxylase (TH) expression in APCMin Mice

DA has been implicated as a stop signal of ocular growth [14]. It is to be noted here that since retinal DA levels in the untreated control eye and FDM eye exhibit large inter-individual variability (more than 200%) [35], we therefore examined on P84 TH expression levels (the rate-limiting enzyme of DA synthesis [36]) to clarify if there is an association between between retinal DA levels and retinal proliferation in the APCMin mice. Western blot and immunofluorescence analyses showed that TH levels, as compared with the WT retina, significantly decreased in the APCMin mice (Fig 4). This decline suggests that in APCMin mice down-regulated DA levels may enhance retinal proliferation, which has been previously reported [37].
Fig 4

Diminished tyrosine hydroxylase (TH) retinal expression in P84 APCMin mice.

(Panels A and B). TH immunostaining of eye sections of WT (A) and APCMin mice (B), showing decreased TH in the sub retinal space of APCMin mice. The nucleus was counterstained with 4, 6-diamidino-2-phenylindole (DAPI) (blue). C, Fifty micrograms of retinal protein was used for western blot analysis of TH. D, Protein levels were semiquantified with densitometry, normalized by β-actin levels, and compared between APCMin mice and WT mice littermates (mean ± SD, n = 5), ** P< 0.01.

Diminished tyrosine hydroxylase (TH) retinal expression in P84 APCMin mice.

(Panels A and B). TH immunostaining of eye sections of WT (A) and APCMin mice (B), showing decreased TH in the sub retinal space of APCMin mice. The nucleus was counterstained with 4, 6-diamidino-2-phenylindole (DAPI) (blue). C, Fifty micrograms of retinal protein was used for western blot analysis of TH. D, Protein levels were semiquantified with densitometry, normalized by β-actin levels, and compared between APCMin mice and WT mice littermates (mean ± SD, n = 5), ** P< 0.01.

Association between myopia and posterior scleral collagen fibril diameter changes

Scleral pathology underlies permanent declines in high myopes [38]. To clarify the possible structural basis for myopia development in APCMin mice, we compared changes in their posterior scleral collagen diameter with those in WT littermates at P84. Ultrastructural analysis by electron microscopy revealed that the morphology of scleral collagen fibrils was dramatically altered in the APCMin mice (Fig 5A and 5B). In the APCMin mice, some areas had a higher density of small-diameter fibrils, whereas others had large-diameter irregular fibrils. This aberrant fibril structure is consistent with abnormal fusion of fibrils. To further determine the biochemical basis for these scleral changes, we compared col1α1 expression levels, since alterations in its expression are associated with myopia development [7]. Western blot analysis in APCMin mice showed that scleral col1α1 expression declined, while its mRNA expression level increased compared to those in age matched WT mice (Fig 5C and 5D). These results suggest that in APCMin mice altered col1α1 fiber metabolism may account for scleral disorganization. To determine whether the change in scleral col1α1 protein expression is accompanied by selective modulation of MMP2 and MMP9 mRNA gene expression, real-time PCR evaluated their scleral levels in APCMin and WT mice. Analysis of MMP2 and MMP9 gene expression, normalized to the expression of the housekeeping gene β-actin, showed that there was no change in their levels in APCMin mice, compared to those in the WT mice (Fig 5E). These results suggest that scleral col1α1 fiber downregulation in APCMin mice is not attributable to any changes in MMP2 and MMP9 expression levels.
Fig 5

Scleral morphological changes in P84 APCmin mice and age-matched normal WT littermates.

TEM compares collagen fibril morphology in cross-section from the posterior sclera of wild type (A) and APCMin mice (B). A, WT fibrils have a regular, cylindrical contour whereas APCMin mice sclera is more irregular and disorganized. The fibril contour diameters are variable having in some places a small diameter whereas in other locations it is larger (arrows). C, Col1α1 protein expression levels detected by western blot progressively decreased with development in APCmin scleras, as compared with WT mice littermates. D, Histogram illustrations of densitometry results of col1α1 protein expression levels. (Mean ± SD, n = 5), ** P< 0.01. E, real-time PCR measurements of col1α1, MMP2 and MMP9 in the retinas of APCMin and WT mice. All mRNA levels are normalized to the control level of WT in P84 (mean ± SD, n = 5, *P < 0.05, **P < 0.01).

Scleral morphological changes in P84 APCmin mice and age-matched normal WT littermates.

TEM compares collagen fibril morphology in cross-section from the posterior sclera of wild type (A) and APCMin mice (B). A, WT fibrils have a regular, cylindrical contour whereas APCMin mice sclera is more irregular and disorganized. The fibril contour diameters are variable having in some places a small diameter whereas in other locations it is larger (arrows). C, Col1α1 protein expression levels detected by western blot progressively decreased with development in APCmin scleras, as compared with WT mice littermates. D, Histogram illustrations of densitometry results of col1α1 protein expression levels. (Mean ± SD, n = 5), ** P< 0.01. E, real-time PCR measurements of col1α1, MMP2 and MMP9 in the retinas of APCMin and WT mice. All mRNA levels are normalized to the control level of WT in P84 (mean ± SD, n = 5, *P < 0.05, **P < 0.01).

Discussion

Myopia is a common cause of vision loss in a number of ocular disorders [39], but the mechanisms underlying its pathogenesis are not fully understood. It was reported that 10 out of 14 FAP patients with refractive error had myopia ranging from -0.5D to -10D [22]. The incomplete penetrance of myopia phenotype in these patients may be due to the differences in APC mutation sites, which has been shown to affect clinical manifestations [19]. In this study, we examined the alterations in the refractive and biometric parameters of APCMin mice to elucidate the functions of APC during myopia progression. To examine this issue, we used a custom-made real-time OCT and an eccentric infrared photo refractor (EIR) to compare refractive development in APCMin mice with their age matched WT littermates. Such instrumentation designed by Xiangtian Zhou et al [29] allowed us to more accurately measure refractive status and other biometric parameters in mice. Our data suggest that APC expression is required for proper eye growth because APCMin mice experience an extraordinary myopic shift and lenticular, retinal and scleral changes compared with age-matched WT littermates. Their development of this large myopic shift is consistent with abnormal eye size development. In contrast to invariant ACD and LT in human axial myopia [40], ACD became shallower and lenses shrunk in size in APCMin mice relative to their age-matched WT littermates (Fig 2C and 2D). In addition, longer eye axis identified in a clinical setting is typically indicative of myopia [5]. Paradoxically, APCMin mice instead usually have shortened- axial lengths and smaller eyes than their age-matched WT littermates (Fig 1C). Myopia is a mismatch between the light-focusing power of the anterior segment and the axial length of the eye. As a result, the visual image comes to a focus in front of the retina [41]. Our results suggest that changes in thickness of lens and retina may not be able to compensate for the longer VC depth in later developmentwhich results in myopia in the APCMin mice. Regardless of the underlying molecular mechanisms, the short-eyed myopia found in our study is different from that described in other gene-knockout myopia models [42-44]. Studies employing APCMin mice may therefore provide novel insight into ocular development that is not readily accessible using instead other traditional models. Developmental studies have revealed that proliferation of neurons in the marginal retina is highly correlated with the axial length of the eye during myopia development [6,45]. Accordingly, the addition of new neurons to the margin of the retina may compensate for retinal stretch that is imposed during myopia development [46]. Our analysis also indicated in P84 APCMin mice that the retina was accompanied by more Ki67 expression than in normal eyes, which is indicative of rises in retinal layer cell proliferation and retinal thickness. The relationship between retinal thickness and myopia has been extensively investigated. In some reports, average macular thickness was invariant despite changes in myopia degree [47]. However, others found that in myopic eyes retinal thickness was greater at both its foveal center and in the rest of the fovea than that in the non-myopic group [48] [49]. On the other hand, the retina was instead significantly thinner in other zones of the macula in myopic eyes, compared with non-myopic eyes. Interestingly, we found that the retina in P84 APCMin mice thickened. The exact mechanism underlying this enlargement needs further investigation. Thus, the APC gene mutation identified in FAP patients may contribute to increases in retinal cell proliferation. There is emerging evidence suggesting that retinal DA level modulation affects eye growth [50]. Intravitreal injection of a dopaminergic neurotoxin, 6-hydroxydopamine, increased goldfish rod neuroblast proliferation [37]. Furthermore, in an APC mouse mutant model, the DA content is abnormally distributed in different brain regions, and these changes are associated with behavioral and phenotypic changes described in some neurological diseases [51]. In the context of the current study, it is conceivable that increases in retinal cell proliferation may be associated with decreased DA expression, which has been implicated as a ‘stop signal’ mediator of ocular growth [14]. To examine such a possibility, we measured changes in retinal TH expression, the rate-limiting enzyme of DA synthesis [52] and assumed they are reflective of variations in DA content. As the retinal TH protein expression level decreased in APCMin mice (Fig 5), changes in APC gene expression may contribute to DA and TH expression regulation and retinal cell proliferation. Paradoxically, we found in APCMin mice that the lenses were instead smaller than in their age-matched WT littermates. Additional studies are needed to clarify the underlying mechanism accounting for this response. Nevertheless, the current finding of a putative decline in retinal TH expression is consistent with previous indications that such an effect is associated with myopia development. Future studies are needed to determine whether DA receptor agonist and antagonist treatment change retinal proliferation and myopia development in the APCMin mice. The molecular mechanism responsible for putatively downregulating DA expression in APCMin mice requires future clarification. Previous studies in humans and in myopia animal models suggest that scleral biology plays a pivotal role in eye size control and progression of this disease [53]. A possible function for the APC gene could include eye growth control by modulating scleral collagen expression. Our scleral ultrastructural analysis revealed regional heterogeneity in the fibril structures within delimited areas where there were either abnormally small- to very large-diameter fibrils. This result is consistent with findings in myopic tree shrews [54] and the Lum-/-Fmod-/- double-null mouse [42]. Our western blot analysis in APCMin mice showed that col1α1 decreased in scleral tissue (Fig 5C and 5D), while real-time PCR analysis showed no changes in MMP2 and MMP9 gene expression (Fig 5E) in APCMin mice, compared to that in the WT mice. One explanation for the discrepancy between increased col1α1 degradation and invariant MMP2 and MMP9 gene expression is that other MMPs may be alternatively involved in cleaving type I collagen. Changes in col1α1 posttranscriptional regulation are another possibility to account for why its expression level declined. Taken together, these findings suggest that the effect of APC on the scleral changes is partially through regulation of col1α1 expression levels, which, in turn, could result in alterations in scleral architecture and severely affect vision. APC suppresses Wnt signal transduction cascade by modulation the cellular expression levels of β-catenin [19]. Wnt signal is involved in the homeostasis of many tissues, such as intestine, skin, bone, eye and hematopoietic system In adults [55]. In addition, recent studies indicate the possible role of Wnt pathway in the development of myopia [56,57]. In this study, we found that APCMin mice, in which Wnt signaling is activated, displayed myopic shift. Therefore, it provides additional evidence for the role of the Wnt signal pathway in the myopia development. Furthermore, previous study reported that stimulation of the Wnt pathway through inhibition of GSK-3β, a key enzyme in Wnt signal pathway that destabilizes β-catenin, increased retinal Ki67 expression. [58]. The thickened retina and increased Ki67 in the APCMin mice in our study suggest that the Wnt signal pathway may be involved in the control of proliferation of retina, which needs further study. Previous study found that the APC gene mutation causes significant histological abnormalities in several proliferative tissues [59]. Similarly, our results in Table 1 found that the ocular biometric parameters in APCMin mice proportionally grow larger than in WT animals, whereas changes in body weight increase less over time than in WT mice. Our finding is consistent with a previous study that the APC gene mutation has apparently different effect in different tissues [59][59]. The mechanism and signaling pathways responsible for the observed changes remain to be elucidated in the future. Our study has the following limitations. 1), it is not clear whether the ocular and refractive changes in the APCMin mice are the same as those occurring in other mutation sites. 2), we did not evaluate whether the ocular biometric parameter changes accompanying myopia development in APCMin mice also appear in human subjects with APC mutations, which could be of interest in further investigations. In summary, this study describes for the first time refractive development in APCMin mice. The results suggest that APC expression in mice is essential for post natal development of error-free refraction based on measurements of time dependent changes in LT, VCD, and AL. Furthermore, our findings prompt additional genetic studies on APC polymorphism and its related signaling pathways as they may be related to myopia development.

ARRIVE Guidelines Checklist.

Animal Research: Reporting In Vivo Experiments. (PDF) Click here for additional data file.
  59 in total

Review 1.  The sclera and myopia.

Authors:  Jody A Summers Rada; Setareh Shelton; Thomas T Norton
Journal:  Exp Eye Res       Date:  2005-10-03       Impact factor: 3.467

2.  Measurement of retinal thickness in macular region of high myopic eyes using spectral domain OCT.

Authors:  Ai-Ping Song; Xin-Yi Wu; Jian-Rong Wang; Wei Liu; Yan Sun; Tao Yu
Journal:  Int J Ophthalmol       Date:  2014-02-18       Impact factor: 1.779

3.  Genetic deletion of the adenosine A2A receptor confers postnatal development of relative myopia in mice.

Authors:  Xiangtian Zhou; Qinzhu Huang; Jianhong An; Runxia Lu; Xiaoyi Qin; Liqin Jiang; Yuan Li; Jianhua Wang; Jiangfan Chen; Jia Qu
Journal:  Invest Ophthalmol Vis Sci       Date:  2010-05-19       Impact factor: 4.799

4.  Induction of proliferating cell nuclear antigen (PCNA)-immunoreactive cells in goldfish retina following intravitreal injection with 6-hydroxydopamine.

Authors:  K Negishi; W K Stell; T Teranishi; A Karkhanis; V Owusu-Yaw; Y Takasaki
Journal:  Cell Mol Neurobiol       Date:  1991-12       Impact factor: 5.046

5.  Refractive error and ocular biometry in Jordanian adults.

Authors:  Edward A H Mallen; Yazan Gammoh; Muawyah Al-Bdour; Fouad N Sayegh
Journal:  Ophthalmic Physiol Opt       Date:  2005-07       Impact factor: 3.117

6.  Retinoic acid increases in the retina of the chick with form deprivation myopia.

Authors:  Y Seko; M Shimizu; T Tokoro
Journal:  Ophthalmic Res       Date:  1998       Impact factor: 2.892

Review 7.  Myopia and associated pathological complications.

Authors:  Seang-Mei Saw; Gus Gazzard; Edwin Chan Shih-Yen; Wei-Han Chua
Journal:  Ophthalmic Physiol Opt       Date:  2005-09       Impact factor: 3.117

8.  Ophthalmic and genetic screening in pedigrees with familial adenomatous polyposis.

Authors:  I Ruhswurm; M Zehetmayer; C Dejaco; B Wolf; J Karner-Hanusch
Journal:  Am J Ophthalmol       Date:  1998-05       Impact factor: 5.258

9.  Biometric measurement of the mouse eye using optical coherence tomography with focal plane advancement.

Authors:  Xiangtian Zhou; Jing Xie; Meixiao Shen; Jianhua Wang; Liqin Jiang; Jia Qu; Fan Lu
Journal:  Vision Res       Date:  2008-03-17       Impact factor: 1.886

10.  Nine loci for ocular axial length identified through genome-wide association studies, including shared loci with refractive error.

Authors:  Ching-Yu Cheng; Maria Schache; M Kamran Ikram; Terri L Young; Jeremy A Guggenheim; Veronique Vitart; Stuart MacGregor; Virginie J M Verhoeven; Veluchamy A Barathi; Jiemin Liao; Pirro G Hysi; Joan E Bailey-Wilson; Beate St Pourcain; John P Kemp; George McMahon; Nicholas J Timpson; David M Evans; Grant W Montgomery; Aniket Mishra; Ya Xing Wang; Jie Jin Wang; Elena Rochtchina; Ozren Polasek; Alan F Wright; Najaf Amin; Elisabeth M van Leeuwen; James F Wilson; Craig E Pennell; Cornelia M van Duijn; Paulus T V M de Jong; Johannes R Vingerling; Xin Zhou; Peng Chen; Ruoying Li; Wan-Ting Tay; Yingfeng Zheng; Merwyn Chew; Kathryn P Burdon; Jamie E Craig; Sudha K Iyengar; Robert P Igo; Jonathan H Lass; Emily Y Chew; Toomas Haller; Evelin Mihailov; Andres Metspalu; Juho Wedenoja; Claire L Simpson; Robert Wojciechowski; René Höhn; Alireza Mirshahi; Tanja Zeller; Norbert Pfeiffer; Karl J Lackner; Thomas Bettecken; Thomas Meitinger; Konrad Oexle; Mario Pirastu; Laura Portas; Abhishek Nag; Katie M Williams; Ekaterina Yonova-Doing; Ronald Klein; Barbara E Klein; S Mohsen Hosseini; Andrew D Paterson; Kari-Matti Makela; Terho Lehtimaki; Mika Kahonen; Olli Raitakari; Nagahisa Yoshimura; Fumihiko Matsuda; Li Jia Chen; Chi Pui Pang; Shea Ping Yip; Maurice K H Yap; Akira Meguro; Nobuhisa Mizuki; Hidetoshi Inoko; Paul J Foster; Jing Hua Zhao; Eranga Vithana; E-Shyong Tai; Qiao Fan; Liang Xu; Harry Campbell; Brian Fleck; Igor Rudan; Tin Aung; Albert Hofman; André G Uitterlinden; Goran Bencic; Chiea-Chuen Khor; Hannah Forward; Olavi Pärssinen; Paul Mitchell; Fernando Rivadeneira; Alex W Hewitt; Cathy Williams; Ben A Oostra; Yik-Ying Teo; Christopher J Hammond; Dwight Stambolian; David A Mackey; Caroline C W Klaver; Tien-Yin Wong; Seang-Mei Saw; Paul N Baird
Journal:  Am J Hum Genet       Date:  2013-08-08       Impact factor: 11.025

View more
  5 in total

1.  Genipin inhibits the scleral expression of miR-29 and MMP2 and promotes COL1A1 expression in myopic eyes of guinea pigs.

Authors:  Min Wang; Zhi-Kuan Yang; Hong Liu; Rui-Qin Li; Yu Liu; Wen-Jun Zhong
Journal:  Graefes Arch Clin Exp Ophthalmol       Date:  2020-03-03       Impact factor: 3.117

2.  Association between MMP/TIMP Levels in the Aqueous Humor and Plasma with Axial Lengths in Myopia Patients.

Authors:  Yu Yue; Yu-Wen Hsiao; Ji-Bo Zhou
Journal:  Biomed Res Int       Date:  2020-06-10       Impact factor: 3.411

3.  Targeted next-generation sequencing approach for molecular genetic diagnosis of hereditary colorectal cancer: Identification of a novel single nucleotide germline insertion in adenomatous polyposis coli gene causes familial adenomatous polyposis.

Authors:  Dan Wang; Shengyun Liang; Xipeng Zhang; Subrata Kumar Dey; Yuwei Li; Chen Xu; Yongjun Yu; Mingsen Li; Guoru Zhao; Zhao Zhang
Journal:  Mol Genet Genomic Med       Date:  2018-12-06       Impact factor: 2.183

4.  Ambient Light Regulates Retinal Dopamine Signaling and Myopia Susceptibility.

Authors:  Erica G Landis; Han Na Park; Micah Chrenek; Li He; Curran Sidhu; Ranjay Chakraborty; Ryan Strickland; P Michael Iuvone; Machelle T Pardue
Journal:  Invest Ophthalmol Vis Sci       Date:  2021-01-04       Impact factor: 4.799

5.  The effect of topical administration of cyclopentolate on ocular biometry: An analysis for mouse and human models.

Authors:  Furong Huang; Shenghai Huang; Ruozhong Xie; Yanan Yang; Jiaofeng Yan; Xiaowen Cao; Chunlan Zhang; Feng Zhou; Meixiao Shen; Jia Qu; Xiangtian Zhou
Journal:  Sci Rep       Date:  2017-08-30       Impact factor: 4.379

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.