Literature DB >> 26491872

Efficient Mating-Type Switching in Candida glabrata Induces Cell Death.

Stéphanie Boisnard1, Youfang Zhou Li1, Sylvie Arnaise2, Gregory Sequeira2, Xavier Raffoux3, Adela Enache-Angoulvant4, Monique Bolotin-Fukuhara1, Cécile Fairhead1.   

Abstract

Candida glabrata is an apparently asexual haploid yeast that is phylogenetically closer to Saccharomyces cerevisiae than to Candida albicans. Its genome contains three MAT-like cassettes, MAT, which encodes either MATa or MATalpha information in different strains, and the additional loci, HML and HMR. The genome also contains an HO gene homolog, but this yeast has never been shown to switch mating-types spontaneously, as S. cerevisiae does. We have recently sequenced the genomes of the five species that, together with C. glabrata, make up the Nakaseomyces clade. All contain MAT-like cassettes and an HO gene homolog. In this work, we express the HO gene of all Nakaseomyces and of S. cerevisiae in C. glabrata. All can induce mating-type switching, but, despite the larger phylogenetic distance, the most efficient endonuclease is the one from S. cerevisiae. Efficient mating-type switching in C. glabrata is accompanied by a high cell mortality, and sometimes results in conversion of the additional cassette HML. Mortality probably results from the cutting of the HO recognition sites that are present, in HML and possibly HMR, contrary to what happens naturally in S. cerevisiae. This has implications in the life-cycle of C. glabrata, as we show that efficient MAT switching is lethal for most cells, induces chromosomal rearrangements in survivors, and that the endogenous HO is probably rarely active indeed.

Entities:  

Mesh:

Year:  2015        PMID: 26491872      PMCID: PMC4619647          DOI: 10.1371/journal.pone.0140990

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Sexual reproduction in fungi takes diverse forms [1], some species preferring out-breeding and others inbreeding, either because spores resulting from meiosis conjugate inside the ascus, before germination, or because they mate with daughter cells, through homothallism [2]. Homothallism is formally defined by the fact that a single spore isolated after meiosis is able to undergo a full sexual cycle, without needing to meet a spore from the opposite mating-type. This is in opposition to heterothallism, where conjugation of cells from strains of opposite mating-types is required. Different underlying mechanisms for homothallism exist [1,3,4], especially in higher fungi, but the best studied such mechanism in yeasts, is the mating-type interconversion mechanism from the model yeast Saccharomyces cerevisiae [5]. It is interesting to note that the haploid Schizosaccharomyces pombe, the other model yeast favored by scientists, also switches mating-types very efficiently. The two species use different initiation events, but undergo equivalent gene conversion events, in an example of convergent evolution [6,7]. Both mechanisms involve potentially dangerous chromosomal breaks, in pathways which are, by necessity, finely regulated. It is notable that the HO gene, which encodes the endonuclease central to the process in S. cerevisiae, has, indeed, a large regulatory region upstream [8]. Several levels of regulation control the expression of HO: it is only expressed in haploid cells, only in late G1 and only in mother cells [8,9]. In S. cerevisiae, cellular mating-type is determined by the MAT locus, which encodes transcription factors responsible for sexual identity [10-13]. Three types of sexual identity exist; mating-competent haploid MATa and MATalpha cells, according to the sequence present at the MAT locus, and meiosis-competent diploid cells which contain active copies of both types. Cells also contain transcriptionally silent copies of both mating-types [14,15] which are bordered by identical sequence segments that drive homologous recombination [16-18]. Mating-type interconversion in wild-type homothallic haploid cells relies on two components: the MAT-like loci and the Ho endonuclease (for review [5]). After the daughter cell has budded, the mother cell's active MAT locus is cut by the Ho endonuclease at its recognition site, at the junction between the Y and Z1 segments of the locus [19-21]. This double strand break is repaired by homologous recombination using the HMLalpha or the cassette as a template for repair (for review [5,22]), resulting in a switch of mating-types. Switching is highly efficient, with 90% cells switching to the opposite sexual type [3,23,24], through the control by the sexual identity of the cell, MATalpha cells repressing the Recombination Enhancer present between the MAT and the HML loci, leading to repair with HMR [5,25,26]. In this process, the MAT locus is the only one to be cut, HMLalpha and being protected from the Ho cleavage by silencing processes involving the Sir proteins [27-29]. Asexual species abound in the fungal kingdom, and it has been noted that fungal pathogens of humans usually display an apparent lack of sexuality. The reasons for this include the absence of cells of one mating-type in an infectious population of a heterothallic species, such as in the case of Aspergillus fumigatus [30], or modification of mating pathways to yield atypical, rare, conjugation events between diploids in addition to conjugation events between even rarer haploids, such as in the case of C. albicans [31-33]. C. glabrata, the 2nd cause of invasive candidiasis after C. albicans [34], has never been shown to mate, but haploid cells of both mating-types are regularly isolated [35], and the genome contains both the triplicated MAT-like loci and an HO gene homolog [36,37]. We have previously shown that C. glabrata MATalpha cells express the MATa specific gene, MATa1, through transcriptional “leakage” of , and that both C. glabrata MATa and MATalpha cells are insensitive to their specific mating pheromones, while S. cerevisiae's cells are sensitive to the same pheromones [38]. C. glabrata belongs to the Nakaseomyces genus, which includes five other species, two described recently as pathogens, Candida (Nakaseomyces) nivariensis [39] and Candida (Nakaseomyces) bracarensis [40]; and three species isolated in the environment: Kluyveromyces (Nakaseomyces) delphensis, Kluyveromyces (Nakaseomyces) bacillisporus, and Candida (Nakaseomyces) castellii [41]. This group of yeasts is closer to Saccharomyces cerevisiae than to Candida albicans, and therefore follows the universal nuclear genetic code. All Nakaseomyces species are haploid, except for N. bacillisporus, which is diploid [41,42]. We have recently sequenced the genomes of these five species, and compared them to C. glabrata [42]. Contrary to S. cerevisiae, where the three loci are on chromosome III, in C. glabrata, HMLalpha and MAT are on chromosome II, and is on chromosome V [43]. This configuration is common to four species in the Nakaseomyces, while one, N. delphensis, has the three loci on the same chromosome like S. cerevisiae. As for the final species, N. bacillisporus, the sequence in its present state does not contain the HMR locus. C. glabrata has an HO gene homolog, where known domains for nuclear localization, site recognition and endonuclease activity are conserved [44]. This is also true in all Nakaseomyces [42]. Mating-type switching has been suggested by PCR experiments in C. glabrata [45], but no living cell where spontaneous switching has occurred and been followed experimentally has been isolated, such as is possible in S. cerevisiae, where HO haploid cells switch every generation, and pedigrees of cells can be performed to follow this. Recently, induction of HO expression inducing mating-type switching in C. glabrata has been reported, using a constitutive promoter and the endogenous gene, resulting in switching of a MATalpha cell to a cell [46]. Populations of C. glabrata contain strains of both mating-types with some collections exhibiting bias [35,47], and it has been reported that some strains exhibit “abnormal” cassette configurations, i.e, differing from the canonical HMLalpha and configuration [36]. This is also known in S. cerevisiae [48,49]. It has been proposed that triplicated MAT-like cassettes originated before the HO gene, and that these were used to allow rare mating-type switching events, and that the HO gene, a “selfish” self-transposing gene, was then “domesticated” [50-52]. Indeed, K. lactis switches mating-types inefficiently through mechanisms independent of Ho but dependent on triplicated cassettes [53,54]. The HO gene is part of the family of Homing Endonuclease Genes (HEGs), selfish genetic elements that can propagate through populations. HO is closely related to VDEI, the intein in S. cerevisiae's genome [55]. Many HEGs propagate as self-splicing introns in organelle genomes; the intron encodes an endonuclease that can cut its site in a genome without the intron, upon mating of an intron-containing and an intron-less strain. The cut is then repaired by homologous recombination (HR), using the intron-containing gene as template, resulting in intron propagation [56]. Ho is an intein whose sole known activity in the cell is to cut its recognition site at MAT and that is encoded by a free-standing gene, dissociated from its own recognition site on chromosome III. Endonucleases of the Ho family have rather low activity, recognize large sites but tolerate degenerate bases within the site, as shown by mutagenesis of the Ho and I-Sce I recognition sites [20,21,57]. We have previously published the composition of MAT-like cassettes and comparison of the HO genes in the Nakaseomyces [42]. We now report on heterologous expression of HO from different Nakaseomyces species and from S. cerevisiae in C. glabrata, and the resulting switching events in both directions, with abnormal structures resulting from gene conversion events. We observe that a high frequency of switching is associated with cell mortality.

Materials and Methods

Strains, cultures and transformation

Strains used for in vivo experiments and for amplification of HO genes are listed in Table 1. Yeast strains are grown in broth or on plates at 28°C, in YDP (non-selective, 1% Yeast Extract, 1% Peptone, 2% glucose), Synthetic Complete medium lacking uracil (SC-Ura, 0.67% Yeast Nitrogen Base without amino acids, 2% glucose, supplemented with all amino acids and adenine) for HO induction experiments. For selection of transformants and maintenance in repressive conditions, strains are grown in SC-Ura added with 2mM each of methionine and cysteine. Stability of plasmids in C. glabrata and S. cerevisiae was confirmed by comparing the number of colonies on SC-Ura and SC+Ura. Transformation of S. cerevisiae and C. glabrata was done according to the lithium acetate transformation protocol from Gietz et al [58].
Table 1

Strains of Nakaseomyces and S. cerevisiae for amplification of HO genes and yeast transformation.

SpeciesStrainGenotypeReference
S. cerevisiae J5 HMLalpha, MATalpha, HMRalpha, HO,leu2, his4, thr4, lys2 Kindly donated to us by Amar Klar
S. cerevisiae W303-1B ho, MATa ATCC 200060
S. cerevisiae FY69 ho, MATa, leu2Δ1 [59]
S. cerevisiae FYC2-7B ho, MATalpha, leu2Δ1 [60]
S. cerevisiae FY1679-18D ho, ura3-52, his3Δ200 [60]
S. cerevisiae FY73 ho, ura3-52, his3Δ200 [59]
N. delphensis CBS2170Type strain, 1n, actively switching * [42]
N. bacillisporus CBS7720Type strain, 2n[42]
C. castellii CBS4332Type strain, 1n, probably switching * [42]
C. bracarensis CBS10154Type strain, 1n, MATalpha[42]
C. nivariensis CBS9983Type strain, 1n, MATalpha[42]
C. glabrata CBS138Type strain, 1n, MATalpha[42]
C. glabrata BG21n, MATa [61]
C. glabrata BG87 MATa, NeoR::ura3, his3Δ[62]
C. glabrata HM100 MATalpha, URA3Δ::KANMX [38]

* our unpublished results

It must be noted that the S. cerevisiae strain used for HO induction has a mutant endogenous HO gene; while the C. glabrata strains still possess their endogenous HO gene.

* our unpublished results It must be noted that the S. cerevisiae strain used for HO induction has a mutant endogenous HO gene; while the C. glabrata strains still possess their endogenous HO gene.

Cloning of HO genes into expression plasmids for C. glabrata

The different HO genes were amplified by PCR from genomic DNA on type strains for the Nakaseomyces and on an HO strain in the case of S. cerevisiae (Tables 1 and 2). SpeI/ SalI sites were added to primers used for HO gene amplification. Appropriate PCR fragments were cloned at the SpeI/SalI sites into the pYR32 plasmid. The pYR32 plasmid, kindly provided by B. Cormack [63], is a replicative plasmid for C. glabrata, and was also used for transformation of S. cerevisiae. Absence of mutation in all the HO genes (amplified and cloned) was verified by sequencing.
Table 2

Primers used for PCR amplification of HO gene and PCR probe amplification.

PrimersSpecies namePrimer sequence (5'-3')
RX1-KLDE-F N. delphensis GCATACTAGTATGTTTGACATTAACACAAC
RX2-KLDE-R N. delphensis CGATGTCGACCTAATTTATCATAGCACGCC
RX3-CANI-F C. nivariensis GCATACTAGTATGTTTGAGATAAATACAAC
RX4-CANI-R C. nivariensis CGATGTCGACCTAGTTCAGCATAACAC
RX5-CACA-F C. castellii GCATACTAGTATGTTAGAAGAGAAAACTCA
RX6-CACA-R C. castellii CGATGTCGACTTAACATGCTTCTAATGCAA
RX7-CABR-F C. bracarensis GCATACTAGTATGTTTGAAAAAAATACTAC
RX8-CABR-R C. bracarensis CGATGTCGACTTAATTAAGCATAGCGTG
RX9-KLBA-F N. bacillisporus GCATACTAGTATGTTAGAAGAAAATACCCA
RX10-KLBA-R N. bacillisporus CGATGTCGACCTATATATAGACAGATGAAT
RX11-CAGL-F C. glabrata GCATACTAGTATGTTCGAAAAGGGAACTTT
RX12-CAGL-R C. glabrata CGATGTCGACAATAGCGGATGTACTCTATT
RX13-SACE-F S. cerevisiae GCATACTAGTATGCTTTCTGAAAACACGAC
RX14-SACE-R S. cerevisiae CGATGTCGACTACACATTTTAGCAGATGCG
A1 probe F C. glabrata CCAATACAAGATCTACGCA
A1 probe R C. glabrata GATCTCTTGCGCCTATTTG
ALPHA1 probe F C. glabrata ACTGAAACACTGACTATGAAG
ALPHA1 probe R C. glabrata CTGAGAGAATGACGGAGAG

PCR, Southern Blot and Sequencing

To test mating-type switching, we performed PCR on colonies before and after induction, using specific primers, which can discriminate the mating-type at the MAT locus, by amplifying the upstream part of the locus (Tables 3 and 4). In some cases, we also typed HML and HMR (Tables 3 and 4, and see results). Cells from a fresh colony were incubated in 5 μL of NaOH 20 mM 5 min at 95°C in the PCR tubes before placing at 4°C, adding the buffer, primers, dNTPs and Taq polymerase and proceeding with the PCR amplification.
Table 3

Location and sequence of primers used for determining mating-type information at MAT, HML, and HMR.

NamePrimersLocalisation
GS01TACCAAGAAGCAAGAGCCCAUpstream of MAT
GS02TCTTGCGTAGTCGAGACCTCDownstream of MAT
GS06GACAGGAACATCTAAGCGATUpstream of HMR
GS07GTGATGATTACTGGGTGGADownstream of HMR
GS08GCTGTAGTGGCGAAAATAAGUpstream of HML
GS09GATCACTTCGTAGTAGAAAACDownstream of HML
RX15GCTGATCGAGGTGAATCCATUpstream of MAT
RX16CTCTACCAGCAAAGGCCAAGInside Ya (MAT, HML, HMR)
RX17TTCAACCGCCTAAAAATTGCInside Yalpha (MAT, HML, HMR)
Table 4

Combination of primers used and size of expected products.

Primer pairsSpecific locusAmplification length expected
RX15/RX16Upstream MATa fragment778bp
RX15/RX17Upstream MATalpha fragment1161bp
GS08/RX16Upstream HMLa fragment1042bp
GS08/RX17Upstream HMLalpha fragment 1425bp
GS06/RX16Upstream HMRa fragment1060bp
GS06/RX17Upstream HMRalpha fragment1443bp
GS01/GS02Whole MAT locus MATa 2315bp, MATalpha 2500bp
GS08/GS09Whole HML locus HMLa 2297bp, HMLalpha 2482bp
GS06/GS07Whole HMR locus HMRa 2297bp, HMRalpha 2482bp
For Southern blots, genomic DNAs were prepared using the Qiagen genomic DNA kit, according to manufacturer's instructions. 5 μg DNA was subjected to enzymatic digestions by EcoRV or HindIII/PstI. Gels (0.8% agarose in 0.5x TBE) were transferred on positively charged Nylon membranes from Roche, using an Appligene vacuum blotter. Membranes underwent pre-hybridization for 4 hrs and overnight hybridization at 65°C in Church's buffer [64], with a DIG-labeled PCR probe, and were submitted to high stringency washes at 65°C in 0.1% SDS, 1X and then 0.1X SSC buffer. DIG labeling and detection was done using a Roche kit, according to manufacturer's instructions. Primers used for probe PCR amplifications are given in Table 2. For the three cassettes MAT, HML and HMR, the whole locus was amplified using primers indicated on Tables 3 and 4, and purified PCR fragments were sequenced by Beckman Coulter Inc.

Induction of HO expression and quantification of the efficiency of mating-type switching

Experimental procedure is shown on Fig 1. Transformants with the different HO plasmids were streaked onto repressive medium and directly tested by PCR (see above) to check that they had not switched before induction. Cells from a starter overnight culture in repressive conditions (SC-URA +2mM Met/Cys) were then counted, and around 200 cells were usually plated on inductive (SC-URA) and on repressive medium as control, and incubated at 28°C, until colonies appeared (one to two days). Determination of mating-type was done on individual colonies (a minimum of 14 colonies were tested per transformant plated, and at least 2 transformants were tested per experiment), by PCR amplification of both and MATalpha.
Fig 1

Experimental procedure for induction of the HO gene and isolation of switched cells.

At this step, we obtain "negative" colonies (those that had not switched and yielded a PCR product only with primers amplifying the original mating-type), and "mixed" colonies (colonies yielding a PCR product with both pairs of primers, in which some cells have switched, and others have maintained their original mating-type). At least two "mixed" colonies were then restreaked on repressive medium, cells allowed to grown into individual colonies, and the PCR experiment performed again on at least 20 colonies per mixed colony. Colonies become "pure" as to their mating-type at this stage (i.e, no switching back and forth between mating-types occurs and all cells respond identically to the PCR determination, yielding a single positive response, either or MATalpha). The percentage of "pure" switched colonies out of the number of colonies sub-cloned was then used as an estimate of the efficiency of mating-type switching (see results). In the case of the expression of the HO gene from S. cerevisiae, we observed a high cellular mortality, so we decided to analyze this phenomenon more precisely: we plated dilutions from 106 to 102 cells on inductive medium and on repressive medium and compared the number of colonies growing. This was done on three and five independent transformants for strains BG87 and HM100 respectively. For the induction of HO expression in BG87s, (BG87 switched from to MATalpha) a colony which had lost the original plasmid was isolated by growing the strain on SC+URA, and transformed anew with the plasmid expressing the HO gene from S. cerevisiae (see Results).

Results

Mating-type switching in a C. glabrata MATa strain

HO is particularly well-conserved in the Nakaseomyces [42], and we cloned all HO genes from the Nakaseomyces and from S. cerevisiae into a URA3 selectable plasmid that allows controlled expression of the cloned gene under the MET3 promoter [63]. Expression is repressed in conditions of high methionine and cysteine concentrations, and induced in the absence of these two amino acids in the medium (see Materials and Methods). We first tested the expression of all HO genes in C. glabrata, using the strain BG87, isogenic to the BG2 strain, commonly used in laboratories [38,62] (Table 1). Colonies were tested by specific PCR in order to discriminate the mating-type (specific primers and corresponding size expected are given in Tables 3 and 4). Results obtained after induction are shown in Table 5 (experiment A and 1 to 7). All HO genes, from the Nakaseomyces and from S. cerevisiae, are able to induce mating-type switching, i.e, induction of HO expression yields “mixed colonies”, as evidenced by the obtainment of both - and MATalpha-specific amplifications (see Materials and Methods). Fig 2 shows such PCR amplification in colonies after expression of the HO gene from S. cerevisiae; i.e, most of the colonies tested present both - and MATalpha-specific amplifications.
Table 5

MAT switching in C. glabrata and in S. cerevisiae.

ExperimentStrainMAT HO geneObservation of switchPure switched cellsMolecular analysis of switch
C. glabrata ABG87aWithout HO gene-AbsentND
1BG87a S. cerevisiae +FrequentNormal
2BG87a C. glabrata +RareNormal
3BG87a C. bracarensis +RareNormal
4BG87a C. nivariensis +RareND
5BG87a C. castellii +AbsentND
6BG87a N. bacillisporus +RareNormal
7BG87a N. delphensis +RareNormal
8HM100alpha S. cerevisiae +FrequentNormal and Triple « a » strains
1-bBG87salpha S. cerevisiae +FrequentNormal and Triple « a » strains
S. cerevisiae 21FY1679-18Da S. cerevisiae +FrequentND
22FY1679-18Da C. glabrata -AbsentND

HO genes from different species (column 5) were expressed in strains of C. glabrata and S. cerevisiae (column 3). BG87s (experiment 1-b) corresponds to the BG87 strain switched to MATalpha. Switching events are detected by specific PCR (column 6); (+) indicates the presence of the opposite mating-type. After having isolated cells with pure genotypes (see materials and methods), estimation of the number of pure switched cells is referred in this table as absent, rare or frequent (column 7). Molecular analysis was performed by sequencing the MAT, HML, HMR loci (column 8). ND means Not Determined.

Fig 2

Expression of the S. cerevisiae HO gene in the MATa C. glabrata strain BG87.

Top: amplifications obtained with specific primers (RX15/RX16); Bottom: amplifications obtained with MATalpha specific primers (RX15/RX17). 13/14 colonies show both and MATalpha specific amplification (except colony number 9). The BG87 and HM100 MATalpha strains are used as controls.

Expression of the S. cerevisiae HO gene in the MATa C. glabrata strain BG87.

Top: amplifications obtained with specific primers (RX15/RX16); Bottom: amplifications obtained with MATalpha specific primers (RX15/RX17). 13/14 colonies show both and MATalpha specific amplification (except colony number 9). The BG87 and HM100 MATalpha strains are used as controls. HO genes from different species (column 5) were expressed in strains of C. glabrata and S. cerevisiae (column 3). BG87s (experiment 1-b) corresponds to the BG87 strain switched to MATalpha. Switching events are detected by specific PCR (column 6); (+) indicates the presence of the opposite mating-type. After having isolated cells with pure genotypes (see materials and methods), estimation of the number of pure switched cells is referred in this table as absent, rare or frequent (column 7). Molecular analysis was performed by sequencing the MAT, HML, HMR loci (column 8). ND means Not Determined. From these mixed /MATalpha colonies, we isolated pure switched cells (see Materials and Methods, and Fig 1). When S. cerevisiae’s HO gene is expressed, more than 80% of the isolated cells present the opposite sexual type (“frequent” in experiment 1, Table 5) whereas less than 10% of the isolated cells had switched when the different Nakaseomyces HO gene were expressed (“rare” in experiments 2, 3, 4, 6, and 7, Table 5). In the case of N. castelli’s HO, we could not isolate pure switched cells from a mixed colony exhibiting both /MATalpha amplification (“absent” in experiment 5, Table 5). As a control (experiment A, Table 5), we performed the same experiment with the pYR32 plasmid which does not contain an HO gene and we never observed mixed /MATalpha colonies, but only non-switched parental colonies. Southern blot analysis (Fig 3) of pure switched strains shows that the structure of the cassettes is as expected after mating-type switching i.e, HMLalpha, MATalpha, . The MAT locus from several pure switched clones (originating from expression of both S. cerevisiae HO and some Nakaseomyces HOs) was sequenced. This confirmed that the C. glabrata MAT locus undergoes switching from to MATalpha. Sequence analyses show that the molecular structure of MAT locus is normal, suggesting a correct double strand break at the specific HO cutting site and normal repair by homologous recombination with HMLalpha. Sequencing also confirmed that the switched clones obtained, truly originated from the BG87 strain, since several polymorphic sites at the MAT locus (discriminating the two C. glabrata background strains HM100 and BG87) were detected (Fig 4). HMLalpha and sequencing have shown that these loci were normal.
Fig 3

Southern autoradiogram analysis for strains BG87, switched BG87 (BG87s clones 1, 2, 3) and HM100 at the MAT, HML, and HMR loci.

A) Southern autoradiogram analysis for strains BG87, switched BG87 (BG87s clones 1, 2, 3) and HM100 at the MAT, HML, and HMR loci. Genomic DNA was digested by HindIII/PstI. BG87 (HMLalpha, MATa, ) and HM100 (HMLalpha, MATalpha, ) were used as controls. B) Diagram of the 3 cassettes for BG87 and HM100 and the switching event leading to strain BG87switched (BG87s).

Fig 4

Structure of the MAT loci in C. glabrata.

A. Structure of the HML, MAT, HMR loci in C. glabrata.B. Polymorphic sites at the MAT locus between BG87/HM100s and BG87s/HM100 strains. (+ 1) indicates the start of the HO recognition site. Polymorphic positions are indicated by asterisks.

Southern autoradiogram analysis for strains BG87, switched BG87 (BG87s clones 1, 2, 3) and HM100 at the MAT, HML, and HMR loci.

A) Southern autoradiogram analysis for strains BG87, switched BG87 (BG87s clones 1, 2, 3) and HM100 at the MAT, HML, and HMR loci. Genomic DNA was digested by HindIII/PstI. BG87 (HMLalpha, MATa, ) and HM100 (HMLalpha, MATalpha, ) were used as controls. B) Diagram of the 3 cassettes for BG87 and HM100 and the switching event leading to strain BG87switched (BG87s).

Structure of the MAT loci in C. glabrata.

A. Structure of the HML, MAT, HMR loci in C. glabrata.B. Polymorphic sites at the MAT locus between BG87/HM100s and BG87s/HM100 strains. (+ 1) indicates the start of the HO recognition site. Polymorphic positions are indicated by asterisks. Since switching is observed at a high frequency only with S. cerevisiae's HO, and that all other give switching rates similar to C. glabrata's HO, we focused on S. cerevisiae HO gene expression for further analyses.

Mating-type switching in C. glabrata MATalpha strains

Contrary to S. cerevisiae where the three cassettes HML, HMR and MAT are on the same chromosome (ChIII), in C. glabrata, the HMR locus is located on a different chromosome from the HML and MAT loci. In S. cerevisiae, it is known that the relocation of HMR or HML lowers the efficiency of repair of the Ho cut [65,66]. We wanted to know whether switching occurred in the same way in both directions in C. glabrata. Our first experiments described above involved repair of the MAT locus with the HML locus on the same chromosome. In a MATalpha strain, such as HM100, switching involves repair with on a distinct chromosome. Switching from MATalpha to has been performed previously, using the HO gene from C. glabrata expressed from a constitutive promoter [46], but was not examined in detail. Therefore, expression of the HO gene from S. cerevisiae was induced in the MATalpha strain, HM100, isogenic to the sequenced strain, CBS138 (experiment 8, Table 5). Like previously, colonies grown on inductive medium were tested by specific PCR at the MAT locus (Fig 5). The expression of S. cerevisiae’s HO allows the obtainment of several pure switched subclones. Sequence analyses of these clones show that the C. glabrata MAT locus can switch from MATalpha to , and suggest again a correct double strand break at the MATalpha Ho cutting site and normal repair with as donor.
Fig 5

Expression of S. cerevisiae HO in the HM100 MATalpha strain of C. glabrata.

Right panel: amplifications obtained with specific primers (RX15/RX16), left panel: amplifications with MATalpha specific primers (RX15/RX17). Note: primers amplify additional non-specific loci in both switched clones and in the HM100 control strain.

Expression of S. cerevisiae HO in the HM100 MATalpha strain of C. glabrata.

Right panel: amplifications obtained with specific primers (RX15/RX16), left panel: amplifications with MATalpha specific primers (RX15/RX17). Note: primers amplify additional non-specific loci in both switched clones and in the HM100 control strain.

Switching from MATalpha to MATa reveals unexpected cutting at HML in C. glabrata

Sequencing of HML and HMR loci showed that half of the clones display a normal structure of these loci (Fig 6A); but others present switching at HML, i.e, HMLalpha has been switched to HMLa, leading to a “triple a” genotype: HMLa, , (Fig 6B). Normal and “triple a” genotypes were confirmed by sequencing and by Southern blot experiments (data not shown). The finding of these “triple a” strains is evidence of cutting at the HML locus by S. cerevisiae's Ho endonuclease.
Fig 6

HML as donor and recipient.

Example of a “triple a” strain in which the order of repair can be followed thanks to polymorphic sites. (See text).

HML as donor and recipient.

Example of a “triple a” strain in which the order of repair can be followed thanks to polymorphic sites. (See text). Since the original and MATalpha strains at our disposal were non isogenic, we decided to use a switched BG87s MATalpha strain to test whether “triple a” strains could be obtained in a different strain background (experiment 1-b, Table 5). We isolated two BG87s clones, upon S. cerevisiae’s HO expression, confirming that the MATalpha switched locus can switch back to . Sequencing shows that the first clone displays a normal structure at the , HMLalpha, and loci, but that the second one exhibits a “triple a” structure: , HMLa, , similar to the one obtained in the HM100 strain (data not shown).

The HML locus can act first as a recipient and then as a donor during mating-type switching

Sequence comparison showed the presence of a polymorphic site inside the X region between the three loci, (MAT, HML and HMR) in the HM100 strain (Fig 6). The MAT and HMR loci possess a “C” whereas the HML locus presents an “A” at the same position (+1269 from the Ho cut site). In S. cerevisiae, we know that copying of MAT information during switching, includes not only the Y region but extends in the X region with variable lengths [67]. We took advantage of this polymorphic site to understand the chronological steps of the establishment of the “triple a” strains. Sequencing of one “triple a” strain shows that the MAT locus contains an “A” at the polymorphic site. This result proves that the MAT locus has been cut and necessarily repaired using HML as a template after it has switched itself, using as template. This is unexpected because it suggests that HML is preferentially cut over MAT.

Switching-induced cell death in C. glabrata

Comparison of colony numbers between inductive and repressive conditions shows that S. cerevisiae HO gene expression induces a very strong lethality in C. glabrata cells (Table 6). This lethality is not observed during the Nakaseomyces HO gene expression. We observed the same rate of lethality between the two strains BG87 and BG87s MATalpha (experiments 1 and 1-b respectively, Table 6) suggesting that the switching direction ( versus MATalpha) does not influence cell death. We noticed that, in the HM100 strain background, lethality is ten times higher (Table 6, experiment 8).
Table 6

Estimate of cell death according to the HO gene expressed.

ExperimentStrain MAT HO geneSurvival
C. glabrata ABG87aWithout HO gene100 %
1BG87a S. cerevisiae 0.1 % *
2BG87a C. glabrata 100 %
3BG87a C. bracarensis 100 %
4BG87a C. nivariensis 100 %
5BG87a C. castellii 100 %
6BG87a N. bacillisporus 100 %
7BG87a N. delphensis 100 %
8HM100alpha S. cerevisiae 0.01 %*
1-bBG87salpha S. cerevisiae 0.1 %*
S. cerevisiae 21FY1679-18Da S. cerevisiae 100 %
22FY1679-18Da C. glabrata 100 %

In the case of lethality (*), dilutions from 106 to 102 cells were plated on inductive medium and on repressive medium, and numbers of colonies compared. For experiments 1 and 1-b, number of cells counted, is between approximately 4 and 300 clones for dilutions ranging from 103 to 105 cells per plate. For experiment 8, we counted between 1 and 50 colonies for dilution ranging from 104 up to 106 cells per plate. This was done on three and five independent transformants for strains BG87 and HM100 respectively.

In the case of lethality (*), dilutions from 106 to 102 cells were plated on inductive medium and on repressive medium, and numbers of colonies compared. For experiments 1 and 1-b, number of cells counted, is between approximately 4 and 300 clones for dilutions ranging from 103 to 105 cells per plate. For experiment 8, we counted between 1 and 50 colonies for dilution ranging from 104 up to 106 cells per plate. This was done on three and five independent transformants for strains BG87 and HM100 respectively. The high lethality observed could be due to cutting of an Ho site outside of the triplicated cassettes, which could not be repaired by homologous recombination. We unsuccessfully searched the entire genome in silico, for additional Ho sites, even though we cannot exclude the presence of degenerate sites. Since we observe unexpected switching of HML (triple “a” genotype, see above), we hypothesize that the high lethality is linked to high efficiency of cutting at the Ho sites, including the HML site which can be cut in C. glabrata (see discussion).

S. cerevisiae and C. glabrata HO gene expression in S. cerevisiae

We were intrigued by the strong lethality observed in C. glabrata cells, when the HO gene from S. cerevisiae was expressed. Such lethality has not been reported, to our knowledge, when HO is expressed from a galactose-inducible promoter in a wild-type strain of S. cerevisiae. We therefore wanted to test whether our construction, with the HO gene under the control of the MET3 promoter from C. glabrata could induce lethality in S. cerevisiae, taking advantage of the fact that ARS sequences can function as origins in both species [68]. A ho S. cerevisiae strain (FY1679-18D) was transformed with the two constructs used previously, carrying either the C. glabrata or S. cerevisiae HO gene (experiments 21 and 22, Tables 5 and 6). Several independent transformants underwent the same treatment as C. glabrata cells, i.e they were grown in broth in repressive conditions, and plated on either inductive or repressive medium at various concentrations. We confirmed the stability of the plasmid in S. cerevisiae by comparing the number of colonies on medium with or without uracil. In S. cerevisiae, switching events were searched for, by a mating assay with a complementing strain possessing the same MAT type, so that mating is possible only if switching has occurred. We observed that expression of S. cerevisiae's HO leads to switching of the locus of S. cerevisiae, whereas no switch is observed when the C. glabrata HO gene is expressed (experiments 21 and 22, Table 5). No lethality is observed upon expression of either HO genes in S. cerevisiae (experiments 21 and 22, Table 6). Thus, the strong lethality observed in C. glabrata is not due to a toxic effect of our S. cerevisiae HO construct, but seems to be specific to C. glabrata cells.

Discussion

In S. cerevisiae, mating-type switching is a complex system relying on the existence of: 1) three cassettes (donors and recipient), 2) the presence of the Ho endonuclease 3) repair mechanisms, 4) silencing mechanisms at HMLalpha and . These silencing mechanisms allow the switching system to work with the MAT locus as the sole recipient and HMLalpha and as donors. C. glabrata has never been shown to mate nor to switch mating-types naturally. Its genome has retained the three cassettes and the HO gene, but misses the SIR1 gene, involved in silencing of HML and HMR in S. cerevisiae. In this work, we address the functionality of different Ho proteins and of the switching system in C. glabrata by expressing all HO genes from the Nakaseomyces and S. cerevisiae. Our induction experiments are done on solid medium, so that the HO genes are expressed continuously. Studies in S. cerevisiae were performed in the same way (for review, [5]) and allowed the dissection of the MAT-switching mechanisms. This is very different from the natural situation in which HO gene expression is tightly regulated, and could lead to continuous cleavage during cell growth on plates. Nonetheless, in our experiments, we obtained a very reproducible proportion of switched colonies. This seems to show that the Ho proteins do not cut repeatedly and do not induce switching back and forth between and MATalpha in our conditions. HO genes from the Nakaseomyces and S. cerevisiae allow MAT switching in a C. glabrata strain (BG87). We observe that the Nakaseomyces’ Hos are poorly efficient, even those of the two mating-competent species of the clade, N. delphensis and N. bacillisporus. Unexpectedly, S. cerevisiae’s Ho is the most efficient to induce MAT switching in C. glabrata and we thus focused the rest of our work on this endonuclease. S. cerevisiae’s Ho is efficient in both directions and in both genetic backgrounds (strains BG87 and HM100). Thus, the localization of HMR on another chromosome from MAT does not prevent its role as donor during double-strand break repair in C. glabrata. In addition, inducing the switch in the two backgrounds (BG87 and HM100) allows us to obtain and MATalpha isogenic strains, which could be useful for mating assays. In addition to its high efficiency of switch, S. cerevisiae’s Ho induces a very high cell lethality in C. glabrata, which is not the case for the Nakaseomyces HO genes. Moreover, this strong lethality seems to be specific to C. glabrata since 100% of S. cerevisiae’s cells survive during S. cerevisiae’s HO gene expression in the same conditions. Thus the lethality is not due to any construct toxicity or HO gene expression conditions. The same survival rate is observed in both sexual types BG87 () and BG87s (MATalpha), so that using the HMR locus as template does not seem to be involved in the observed lethality. Switching in a MATalpha strain results in numerous clones which have also switched at HML, proof that Ho also cuts at this locus. On the contrary, we do not observe switching at HMR in our conditions. We cannot exclude that HMR is atypically cleaved by Ho, like HML, and that this leads to repair without switch, so that we cannot detect it. The fact that we observe cutting at HML and not at HMR is unexpected since HMR is transcriptionally leaky, contrary to HML [38]. Therefore, accessibility to transcription factors and accessibility to cleavage by Ho do not necessarily go hand in hand. In S. cerevisiae, extensive studies have revealed that HML and HMR are silenced by several proteins (mainly Sir proteins) and usually protected from Ho cleavage (for review, [5]). In sir- mutants, the two HML and HMR loci are unsilenced and can act as recipients and thus, switch [27-29]. Furthermore, cleavage at HML has been previously reported at a very low rate during constitutive HO expression in wild-type cells while none was observed at HMR [69], in accordance to what we observed in C. glabrata. Natural variants carrying opposite configuration at the HML locus have been described previously in C. glabrata [36]. We screened 100 different strains of our C. glabrata collection [35] by typing the Ya or Yalpha information at the three loci MAT, HMR and HML by specific PCR amplifications (data not shown). We found 10% of the strains revealing rearrangements, with at least one strain harboring the HMLa genotype. These data confirm that cuts outside of MAT can occur in natural conditions. Our results show, that in a wild-type strain of C. glabrata, both MAT and HML are cut at high levels by Ho during switching. We believe that this “illegal” cleavage is the result of a silencing system which is less efficient than S. cerevisiae’s, possibly due to the absence of SIR1 and that this may be the cause of the mortality. C. glabrata does not follow the rule of “one recipient for two opposite donors”, essential for the proper functioning of the switching system in S. cerevisiae. The high mortality associated to efficient switching, explains perhaps, why C. glabrata is not observed to switch regularly. Our work, relying on deregulation of the genes, shows that the low efficiency of the endogenous system is probably not due to a weak endogenous promoter, but may be linked to the properties of the protein itself, such as stability, nuclear localization and/or cleavage activity. Nonetheless, the fact that the genome of C. glabrata has retained the elements necessary for switching as well as the genes involved in mating, point to the possibility that undiscovered conditions may induce switching and/or mating. Further experiments are under way to understand the correlation between switching and cell death in C. glabrata. Especially, mutations in the Ho recognition sites should allow us to understand better the switching system and the rules for cleavage of recipients and for donor preference in this pathogen.
  68 in total

1.  Induction of mating in Candida albicans by construction of MTLa and MTLalpha strains.

Authors:  B B Magee; P T Magee
Journal:  Science       Date:  2000-07-14       Impact factor: 47.728

2.  Phenotypic and molecular characterization of Candida nivariensis sp. nov., a possible new opportunistic fungus.

Authors:  Julia Alcoba-Flórez; Sebastián Méndez-Alvarez; Josep Cano; Josep Guarro; Eduardo Pérez-Roth; María del Pilar Arévalo
Journal:  J Clin Microbiol       Date:  2005-08       Impact factor: 5.948

Review 3.  Sex in fungi.

Authors:  Min Ni; Marianna Feretzaki; Sheng Sun; Xuying Wang; Joseph Heitman
Journal:  Annu Rev Genet       Date:  2011-09-13       Impact factor: 16.830

4.  Genomic sequencing.

Authors:  G M Church; W Gilbert
Journal:  Proc Natl Acad Sci U S A       Date:  1984-04       Impact factor: 11.205

5.  A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast.

Authors:  J A Nickoloff; E Y Chen; F Heffron
Journal:  Proc Natl Acad Sci U S A       Date:  1986-10       Impact factor: 11.205

6.  Directionality of yeast mating-type interconversion.

Authors:  A J Klar; J B Hicks; J N Strathern
Journal:  Cell       Date:  1982-03       Impact factor: 41.582

7.  Occurrence, horizontal transfer and degeneration of VDE intein family in Saccharomycete yeasts.

Authors:  Yoshihiro Okuda; Daisuke Sasaki; Satoru Nogami; Yoshinobu Kaneko; Yoshikazu Ohya; Yasuhiro Anraku
Journal:  Yeast       Date:  2003-05       Impact factor: 3.239

8.  Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C.

Authors:  F Winston; C Dollard; S L Ricupero-Hovasse
Journal:  Yeast       Date:  1995-01       Impact factor: 3.239

9.  The 'obligate diploid' Candida albicans forms mating-competent haploids.

Authors:  Meleah A Hickman; Guisheng Zeng; Anja Forche; Matthew P Hirakawa; Darren Abbey; Benjamin D Harrison; Yan-Ming Wang; Ching-hua Su; Richard J Bennett; Yue Wang; Judith Berman
Journal:  Nature       Date:  2013-01-30       Impact factor: 49.962

10.  Comparative genomics of emerging pathogens in the Candida glabrata clade.

Authors:  Toni Gabaldón; Tiphaine Martin; Marina Marcet-Houben; Pascal Durrens; Monique Bolotin-Fukuhara; Olivier Lespinet; Sylvie Arnaise; Stéphanie Boisnard; Gabriela Aguileta; Ralitsa Atanasova; Christiane Bouchier; Arnaud Couloux; Sophie Creno; Jose Almeida Cruz; Hugo Devillers; Adela Enache-Angoulvant; Juliette Guitard; Laure Jaouen; Laurence Ma; Christian Marck; Cécile Neuvéglise; Eric Pelletier; Amélie Pinard; Julie Poulain; Julien Recoquillay; Eric Westhof; Patrick Wincker; Bernard Dujon; Christophe Hennequin; Cécile Fairhead
Journal:  BMC Genomics       Date:  2013-09-14       Impact factor: 3.969

View more
  8 in total

Review 1.  Lessons from the Nakaseomyces: mating-type switching, DSB repair and evolution of Ho.

Authors:  Laetitia Maroc; Cécile Fairhead
Journal:  Curr Genet       Date:  2021-04-08       Impact factor: 3.886

2.  Fluorescent toys 'n' tools lighting the way in fungal research.

Authors:  Wouter Van Genechten; Patrick Van Dijck; Liesbeth Demuyser
Journal:  FEMS Microbiol Rev       Date:  2021-09-08       Impact factor: 16.408

Review 3.  What 'Omics can tell us about antifungal adaptation.

Authors:  Gabriela Fior Ribeiro; Eszter Denes; Helen Heaney; Delma S Childers
Journal:  FEMS Yeast Res       Date:  2022-01-11       Impact factor: 2.923

Review 4.  An Evolutionary Perspective on Yeast Mating-Type Switching.

Authors:  Sara J Hanson; Kenneth H Wolfe
Journal:  Genetics       Date:  2017-05       Impact factor: 4.562

5.  Patterns of Genomic Variation in the Opportunistic Pathogen Candida glabrata Suggest the Existence of Mating and a Secondary Association with Humans.

Authors:  Laia Carreté; Ewa Ksiezopolska; Cinta Pegueroles; Emilia Gómez-Molero; Ester Saus; Susana Iraola-Guzmán; Damian Loska; Oliver Bader; Cecile Fairhead; Toni Gabaldón
Journal:  Curr Biol       Date:  2017-12-14       Impact factor: 10.900

6.  Repeated evolution of self-compatibility for reproductive assurance.

Authors:  Bart P S Nieuwenhuis; Sergio Tusso; Pernilla Bjerling; Josefine Stångberg; Jochen B W Wolf; Simone Immler
Journal:  Nat Commun       Date:  2018-04-24       Impact factor: 14.919

Review 7.  Candida glabrata: A Lot More Than Meets the Eye.

Authors:  Kundan Kumar; Fizza Askari; Mahima Sagar Sahu; Rupinder Kaur
Journal:  Microorganisms       Date:  2019-01-30

8.  A single Ho-induced double-strand break at the MAT locus is lethal in Candida glabrata.

Authors:  Laetitia Maroc; Youfang Zhou-Li; Stéphanie Boisnard; Cécile Fairhead
Journal:  PLoS Genet       Date:  2020-10-15       Impact factor: 5.917

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.