Mansonella, including a Potential New Species, as Common Parasites in Children in Gabon.

BACKGROUND: Like other tropical African countries, Gabon is afflicted by many parasitic diseases, including filariases such as loiasis and mansonellosis. This study aimed to assess the prevalence of these two filarial diseases in febrile and afebrile children using quantitative real-time PCR and standard PCR assays coupled with sequencing. METHODOLOGY/PRINCIPAL
FINDINGS: DNA from blood specimens of 1,418 Gabonese children (1,258 febrile and 160 afebrile) were analyzed. Overall, filarial DNA was detected in 95 (6.7%) children, including 67 positive for M. perstans (4.7%), which was the most common. M. perstans was detected in 61/1,258 febrile children (4.8%) and 6/160 afebrile children (3.8%, P = 0.6). Its prevalence increased statistically with age: 3.5%, 7.7% and 10.6% in children aged ≤ 5, 6-10 and 11-15 years, respectively. M. perstans prevalence was significantly higher in Koulamoutou and Lastourville (12% and 10.5%, respectively) than in Franceville and Fougamou (2.6% and 2.4%, respectively). Loa loa was detected in seven febrile children including one co-infection with M. perstans. Finally, 21 filarial DNA positive were negative for M. perstans and Loa loa, but ITS sequencing could be performed for 12 and allowed the identification of a potential new species of Mansonella provisionally called "DEUX". Mansonella sp. "DEUX" was detected only in febrile children.
CONCLUSIONS/SIGNIFICANCE: Further study should be performed to characterize Mansonella sp. "DEUX" and evaluate the clinical significance of mansonellosis in humans.

Introduction

Tropical African countries are afflicted by many febrile diseases including HIV, tuberculosis, malaria, and bacteremia; it has been suggested that their emergence can be influenced by infectious factors such as filarial parasites, including Mansonella perstans [1,2]. In 2012, Dolo et al., during assessment of the effects of filariasis on anemia and pro-inflammatory responses associated with clinical malaria in Mali, reported that the geometric mean of hemoglobin levels was significantly lower in 31 malaria patients without filariasis than in 31 with filariasis [3]. They added that these filariases, including M. perstans, significantly decrease plasma levels of Interleukin-1ra, Inducible Protein-10 and Interleukin-8 at the time of presentation with clinical malaria [3]. Brown et al. reported in 2004 that M. perstans did not have an adverse effect on HIV infection, as a higher load of CD4 was detected in HIV patients co-infected with M. perstans compared to those without this parasite [4]. In 2006, Brown et al. also added that the progression to active tuberculosis among HIV-1 infected Ugandans was not associated with M. perstans [5].

Until now, no distinct and specific clinical features have been unequivocal associated with M. perstans infections, unlike some other human filariasis [1]. For this reason, the potential ability of M. perstans to induce pathology has been largely neglected. However, a significant spectrum of clinical features related to this parasite has been described [6,7,8,9]. Some of these manifestations have been reported from endemic areas in Uganda but without statistical links to M. perstans infection [10]. Four reasons were proposed to explain the lack of linkage: (a) it is possible that some of the earlier reported manifestations are rare and therefore were not present with high enough frequency to show a significant association, (b) the high prevalence of microfilaremia reduced the ability to detect a significant difference in frequency of manifestations between the microfilaremia positive and microfilaremia negative groups, (c) previously reported manifestations may be more common in expatriates exposed to infection later in life than in individuals who have grown up in the endemic environment and (d) manifestations may be related more to adult worm infections or to exposure to infectious larvae than to microfilaremia [10].

M. perstans, whose vectors are tiny blood-sucking flies called midges belonging to Culicoides genus, infects approximately 114 million people in Africa, mostly located in 33 Sub-Saharan African countries [1,2,11]. Moreover, M. perstans currently remains unaffected by the most common anti-filarial drugs [1,2]. In Gabon, a central African country, most information on M. perstans has been retrieved when studying other filariases. Its prevalence was recently reported to be 10.2%, including a 3.2% co-infection with Loa loa in 270 villages of Gabon [12]. M. perstans is widespread in Sub-Saharan Africa but no study has reported its prevalence among febrile children in Gabon. This study aimed mainly to assess the prevalence of mansonellosis and Loa loa in febrile and afebrile children from Gabon using molecular methods.

Materials and Methods

Ethics statement

After approval from the Central Ethics Committee of Gabon (N°00370/MSP/CABMD and N°0023/2013/SG/CNE), 1,258 febrile and 160 afebrile children were recruited from 2011 to 2014. Samples from the Republics of Côte d’Ivoire and Senegal were obtained under Ethics numbers N°86/MSLS/CNERN-dkn and N°00.87 MSP/DS/CNERS, respectively. Written Informed Consent from parents or legal guardians of each child was systematically received before inclusion in the study.

Study areas and included population

This study took place in four areas of Gabon located in three provinces of the country: Franceville (Haut-Ogooue province), Koulamoutou and Lastourville (Ogooue Lolo province), and Fougamou (Ngounie province). Among children, 997 (873 febrile and 124 afebrile) were included in Franceville, 171 in Lastourville (155 febrile and 16 afebrile), 83 in Fougamou (63 febrile and 20 afebrile), and 167 febrile children in Koulamoutou. All the children were recruited from pediatric outpatient wards of Reginal hospital centers (Franceville and Koulamoutou), Medical Center (Lastourville), and Medical Research Unit (Fougamou).

Finally, seven blood samples from two other areas of West Africa that had previously been found positive for M. perstans were included in the analysis in order to compare sequences and construct phylogenetic trees. Two samples were from the Republic of Côte d’Ivoire and five samples were from Senegal.

For each child, 100μl of DNA were extracted from 200μl of blood samples (collected in EDTA tubes) using a DNA Blood Kit E.Z.N.A (Omega Bio-Tek, Norcross, U.S.A) according the manufacturer’s guide. The DNA was extracted in Franceville, stored at -20°C and sent in ice packs to URMITE, Marseille, France for molecular analysis.

Molecular analyses

Quality controls

Assessment of the quality of DNA extracts (internal control) was performed for each sample using a quantitative real-time PCR (qPCR) targeting the human ß-actin gene [13]. All primers and probes used in this study are summarized (Table 1). For all PCR assays performed, a mix of PCR alone was used as negative control for every ten samples. Positive controls (DNA of the targeted parasite), two per assay, were also included to validate each reaction.

Table 1

Summary of all the PCR systems used in this study.

Filaria	Targeted sequences	Type of PCR	Primers	Size of amplicons (pb)	Taqman probes	References
Mansonella species and Loa loa	ITS	qPCR	F: 5’- CAATTACTAGGAAGGCGTCC-3’	237	6-FAM-CGGTGATATTCGTTGGTGTCT-TAMRA	[11]
			R: 5’- AATAGCGGATTTGGCAGCTA -3’
Mansonella perstans	ITS	qPCR	F: 5- CCTTCGAGCAATTACTAGGA-3’	187	6-FAM-TTCACTTTTATTTAGCAACATGCA- TAMRA	[11]
			R: 5’- TGACTTAATTGCCACTATAAGC-3’
Mansonella sp « DEUX »	ITS1	qPCR	F: 5’-CGAATATCACCGTTAATTCAGTTGT-3’	179	6- FAM-TTCACTTTTATTAGCAACATGTATGAA- TAMRA	This study
			R: 5’-AACGAGCTTCAAAACAAACACA-3’
Loa loa	15r3, 5–6	qPCR	F: 5’-CGAAAAATTATAGGGGGAAAC-3’	148	6- FAM- TCAAGAGCCGATATACTGAAAGCTATC-TAMRA	[32,33]
			R: 5’-TCGTAGACCAAACTGCGAAC-3’
M. perstans, Loa loa and W. branchrofti	ITS1	Standard	F: 5′-GGTGAACCTGCGGAAGGATC-3′	485	NA	[14,15]
		PCR	R: 5′-CTCAATGCGTCTGCAATTCGC-3′
Filarioidea	5S	Standard PCR	S2: 5’-GTTAAGCAACGTTGGGCCTGG-3’	421	NA	[14,15]
			S16: 5’-TTGACAGATCGGACGAGATG-3’

NA = Not applicable

Primers and probes

All samples were first screened with qPCR using the set of primers and probe targeting the Inter Transgenic Spacer (ITS) that was able to amplify all species of Mansonella genus as well as Loa loa [11]. All samples positive for ITS qPCR were systematically tested with a qPCR targeting M. perstans [11] as well as a qPCR targeting Loa loa. In addition, they were also all amplified with standard PCR assays targeting ribosomal DNA ITS1 and 5S rRNA regions coupled with sequencing [14,15]. Finally, a new set of primers and probe were specifically designed to amplify a portion of the ITS1 sequence of a potential new species of Mansonella identified in this study.

PCR assays

The CFX96 Touch detection system test (Bio-Rad, Marnes-la-Coquette, France) was used to perform qPCR. FAST qPCR MasterMix (Eurogentec, Liege, Belgium) was prepared according the manufacturer’s protocol and used during this step as previously reported [13].

Standard PCRs were performed using GeneAmp PCR System 2720 thermal cyclers (Applied Biosystems, Bedford, MA, USA) while sequencing was performed with an ABI Prism 3130xl Genetic Analyzer capillary sequencer (Applied Biosystems). For sequencing, obtained amplicons were directly purified using the PCR filter plate Millipore NucleoFast 96 PCR kit following the manufacturer recommendations (Macherey–Nagel, Düren, Germany). Sequencing reactions were carried out using the Big-Dye Terminator, version 1.1, cycle sequencing kit DNA according to the manufacturer’s instructions (Applied Biosystems, Foster City, USA) [16]. All PCR products were sequenced using the primers summarized in Table 1 with an initial denaturation step at 96°C (1 minute), followed by 25 cycles of denaturation at 96°C (10 seconds), annealing at 50°C (5 seconds), and extension at 60°C (3 minutes). Sequencing products were purified using the Millipore MultiScreen 96-well plates (Merck, Molsheim, France), containing 5% Sephadex G-50 (Sigma-Aldrich, L’Isle d’Abeau Chesnes, France). Finally, ChromasPro 1.34 software (Technelysium Pty. Ltd., Tewantin, Australia) was used to correct sequences and BLASTn searches were performed in the NCBI (http://blast.ncbi.nlm.nih.gov.gate1.inist.fr/Blast.cgi).

Phylogenetic trees

Consensus phylogenetic trees showing the relationships between the species of filarial parasites under study were made based on comparisons of the ITS1 and 5S sequences. The sequences compared were from the gene database GenBank (www.ncbi.nlm.nih.gov) and from previous studies (those which were unavailable in the Genbank database) [14,15]. The sequences were aligned using ClustalW, and phylogenetic inferences were obtained using Bayesian phylogenetic analysis with TOPALi 2.5 software (Biomathematics and Statistics Scotland, Edinburgh, UK) within the integrated MrBayes application and using the HKY85 substitution model. Numbers at the nodes are percentages of bootstrap values obtained by repeating the analysis 100 times to generate a majority consensus tree [17].

Statistical analysis

Epi Info software (Centers for Disease Control and Prevention, Atlanta, GA, USA) was used to perform data analysis: Mantel-Haenszel χ2 and Fisher exact tests. Statistical significance was considered for a two tailed P value lower than 0.05.

Results

DNA extracts from blood specimens of 1,418 children (1,258 febrile and 160 afebrile) were included in the analysis since all of them were positive for human ß-actin qPCR. In summary, 703 males and 673 females were included; no data on sex was available for 42 children. Overall, 864 out of 1,418 children (61%) were included during the rainy season and 554 during the dry season (39%). Data on age were available for 1,374 children and are summarized (Fig 1).

Fig 1

Age distribution of all children included in this study.

(y = year-old).

Detected filaria

Overall, 95 out of 1,418 samples (6.7%) were positive based on ITS qPCR. Among them, 67 (4.7%) were positive for M. perstans and 7 for Loa loa (including 1 co-infection with M. perstans), whereas 21 were negative using these two qPCR tests. Identification of M. perstans and Loa loa was confirmed with sequencing and the BLAST search tool. All children with Loa loa were febrile; two were from Franceville, two from Koulamoutou, one from Lastourville, and two from Fougamou.

Mansonella perstans

M. perstans is the most prevalent filarial parasite detected in 67 children, including 61 febrile (4.8%, 61/1,258) and 6 afebrile children (3.8%, 6/160; P = 0.6). Overall, M. perstans was detected in 3.5% of children ≤ 5 years of age (36/1,036), 7.7% of six to ten year-olds (21/272), and 10.6% of 11 to 15 year-olds (7/66), (Fig 2). The prevalence was statistically significantly lower in children ≤ 5 years of age than in those between six and ten year-olds (P = 0.004) and in those between 11 and 15 year-olds (P = 0.01). No statistical difference of prevalence was observed in children between ages six and ten and those between 11 and 15 year-olds (P = 0.4). Furthermore, no difference in M. perstans prevalence was observed between males (4.3%, 30/703) and females (4.9%, 33/673 P = 0.6). The prevalence of M. perstans was lower in the dry season (3.9%, 34/864) than in the rainy season (6%, 33/554), but without statistical significance (P = 0.09).

Fig 2

Prevalence of M. perstans according to age for all positive children.

(y = year-old).

The lowest prevalence of M. perstans was observed in Haut-Ogooue and Ngounie areas, Franceville (2.6%, 26/997), and Fougamou (2.4%, 2/83), respectively. The prevalence was higher in the 2 sites of Ogooue Lolo province: Koulamoutou (12%, 20/107) and Lastourville (10.5%, 18/171), (Fig 3). Besides, these differences of prevalence of M. perstans were statistically significant.

Fig 3

Prevalence of M. perstans according to the studied areas.

The ITS1 and 5S sequences that were obtained were of high quality. Sequences from all Gabonese samples were identical for both of the two sequences. However, while the ITS1 sequences of M. perstans from Republic of Côte d’Ivoire and Senegal were completely identical to each other, they differed from all sequences from Gabon by only one base pair (position 383 from the beginning of the amplicon). Comparison of the 5S sequences from the different analyzed areas permitted identification of five genetic variants of M. perstans: three from Senegal, one from Côte d’Ivoire and one from Gabon (Fig 4A).

Fig 4

Consensus phylogenetic tree showing the relationships between species of Onchocercidae in the study.

A. Consensus phylogenetic tree showing the relationships between species of Onchocercidae in the study based on 5S sequence comparisons. The scale bar represents a 1% nucleotide sequence divergence. GenBank accession numbers are indicated when the sequences originated from Genbank, and the geographic origin of the filariae is indicated at the end when possible. B. Consensus phylogenetic tree showing the relationships between species of Onchocercidae in the study based on ITS1 sequence comparisons. The scale bar represents a 5% nucleotide sequence divergence. GenBank accession numbers are indicated when the sequences originated from Genbank, and the geographic origin of the filariae is indicated at the end when possible.

Mansonella sp. “DEUX”

Among the 21 positive samples with ITS qPCR, but negative with M. perstans and Loa loa qPCR assays, sequencing of ITS1 was carried out for 12 samples; not enough DNA was available for 9 samples from Franceville. The sequences were almost identical to each other (two samples had the same single nucleotide polymorphism) and differed significantly from sequences of M. perstans: nine nucleotide polymorphisms and five deletions/insertions for the sequenced portion (94% of identity). The BLAST search did not yield any identification. Unfortunately, DNA sequences of Mansonella streptocerca, another possible human pathogen [15], were unavailable in the Genbank. The only available gene sequence (5S ribosomal RNA) of M. streptocerca was printed in the manuscript of Fischer et al. [15]. So, in order to identify if the Mansonella from 12 samples was M. streptocerca, we sequenced the 5S rRNA of these samples. The comparison of both sequences (the one printed in the manuscript and the one obtained from our samples) showed a difference (Fig 4B). This Mansonella sp. (provisionally called “DEUX”) was detected only in febrile patients. The 12 patients were from Koulamoutou (four patients), Lastourville (four patients), and Fougamou (four patients).

Nucleotide sequences

All nucleotide sequences obtained during this study were stored in the Genbank under the following numbers: KR080185-KR080190 for the ITS1 sequences from the two genetic variants of Mansonella sp. “DEUX” from Gabon, from M. perstans from Gabon, Senegal, and Republic of Côte d’Ivoire and for Loa loa from Gabon, respectively; KR080177-KR080184 for the 5S sequences from the two genetic variants of Mansonella sp. “DEUX” from Gabon, for Loa loa from Gabon, and for M. perstans from Côte d’Ivoire, Gabon and three genetic variants from Senegal, respectively.

Discussion

Febrile illnesses are common in Sub-Saharan Africa while filarial parasites, including M. perstans, are known to influence their emergence. However, no study evaluated the prevalence of filarial parasites, especially M. perstans, among febrile children in Gabon. The data reported here were validated following rigorous criteria. Each PCR assay included a positive control (DNA of targeted filarial parasite) and a negative control (PCR mix alone). All positive samples were sequenced to confirm our results and the sequences obtained were carefully verified.

This study confirmed that M. perstans and Loa loa are widespread in Gabon [12,18]. However, no significant difference was observed between the prevalence of M. perstans in febrile (4.8%) and afebrile (3.8%) children. Similar lack of difference has also been recently reported in Senegal where the prevalence of M. perstans was 14.4% (29/201) among febrile and 15% (14/96) in afebrile children [11]. The lack of difference in the prevalence of M. perstans between febrile and afebrile subjects seems to support the previously reported observation that in general M. perstans is not a major cause of febrile illness [12].

Mansonelloses are most often considered to present few symptoms or even asymptomatic. Only eosinophilia, pruritus, and ocular involvement are typically reported as caused by M. perstans. However, severe complications have been observed in M. perstans infections, such as in the case of a missionary family returning from an African area endemic to M. perstans in which multiorgan failure was reported [9]. Ndibazza et al. in 2013 reported that parasites including, M. perstans infections were associated with an increase of the rate of clinical malaria unlike to other types of infection such as Schistosoma mansoni, which had no consistent association with childhood malaria [19]. Several other clinical features have been also reported and linked to M. perstans in studies, including hormonal disturbances, subcutaneous swellings, skin rashes, acute swelling in the forearms, itching, pain or ache organs, extreme exhaustion, fever, neurological, and psychological symptoms [6,7,8,9,20]. The diversified reports about the pathogenicity of M. perstans suggest that some factors such as the degree of microfilaremia, coinfection, sex, age, and the geographical origin of the person should greatly influence its pathogenicity [9,21,22]. In addition, the pathogenicity of M. perstans could be related to the age of first exposure. That could explain the severity of this infection among expatriates whereas few symptoms have been reported in native populations where asymptomatic carriers have also been observed for other parasites, including Plasmodium falciparum [13]. Overall, very few studies have screened rural endemic populations for symptoms [1]. M. perstans remains unresponsive to most antifilarial drugs [1]. Antibiotics for Wolbachia, its endosymbiont, had been reported as a strategy to combat this parasite [23].

The prevalence of M. perstans increased significantly with age. This finding supports those previously reported in Africa [2,11,10]. In fact, the higher prevalence in older children and adults should be related to their common exposure to the Culicoides bites during their activities [24]. For example, fishermen, farmers, and cattle breeders were the most affected occupational categories in a study on filariasis in Bauchi State, Nigeria [25]. Besides, a significant frequency of M. perstans was observed according to the studied areas. Indeed, the prevalence was higher in the Ogooue Lolo province (Koulamoutou and Lastourville) than in Ngounie (Fougamou) and Haut Ogooue (Franceville). At Franceville, the vegetation consists mainly of savanna, while Koulamoutou and Lastourville are covered of tropical rainforest, and Fougamou is a grassland forest area. These finding correlate with those recently published by Akue et al. in 2011 [12]. Among the three major Gabonese ecosystems, the forest had a higher prevalence of parasites than the savannah and wetlands [12]. Studies summarized by Simonsen et al. supports this observation [1]. They reported that the high prevalence of M. pertans occurred in many areas where tropical forests alternate with large swamps and open ground [1]. They added that M. perstans was common in the rain forest, less common in the forest peripheries, higher in or near densely forested areas and low in the mountain grassland zones of the British Cameroons, and related to the species and biting density of the vectors [1]. Variation among other filarial parasites such as loasis, according to contrasting bioecological zones, was observed in central Africa [26]. Some vector species prefer to breed in decomposing plant material; extensive cultivation of bananas has been identified as a risk factor for transmission [1], this should explain why farmers are one of the most infected occupational categories[25]. Studies in other areas have shown that low-pH soil, low organic soil content, salty soil, and wet soil contributed to Culicoides fly breeding [27,28], while temperature may affect vector competence [29].

A novel potential species of Mansonella was detected on the basis of molecular analyses. Interestingly, a Mansonella species that was morphologically different from M. ozzardi was recently identified in blood samples from Peru [30], but no genetic difference was found. In this case, unfortunately, we failed to obtain blood smears, thus, no morphological analyses and comparisons of Mansonella sp. “DEUX” were possible. It is important to emphasize that Mansonella sp. “DEUX” was only detected in febrile children. We strongly suspect that Mansonella sp. “DEUX” may be a new species, because based on ITS1 comparison, M. perstans is very homogenous throughout Africa (from Senegal to Gabon) and Mansonella sp. “DEUX” differs significantly from M. perstans with this spacer (94%). Based on comparison by 5S rRNA sequences, Mansonella sp. “DEUX” is different from M. streptocerca [14,15]. Other possible variants may include Mansonella rodhainii, Mansonella gorillae, Mansonella vanhoofi, Mansonella leopoldi, and Mansonella lopeensis, reported from humans and great apes in Africa [31]. Unfortunately, genes from these species are unavailable in the Genbank. The slides containing microfilariae should enable us to describe morphological features of Mansonella sp. “DEUX” and to compare them with the aforementioned Mansonella spp. Until now, no other valid species belonging to the genus Mansonella were reported in Africa [31]. Thus, Mansonella sp. “DEUX” may represent a potential new species of Mansonella with a possible pathogenic role in humans. An additional morphologic study is necessary in order to identify whether Mansonella sp. “DEUX” represents one of the Mansonella species not yet molecularly characterized, a genetic variant of M. perstans or really a new species.

Gabon remains a significant target of filariasis including Loa loa, M. perstans, and a potential new species of Mansonella, Mansonella sp. “DEUX”. M. perstans was commonly observed in both febrile and afebrile children whereas Loa loa and Mansonella sp. “DEUX” were observed only in febrile children. Even if M. perstans does not appear to be directly linked to febrile episodes among the local population, its real clinical impact has not yet been determined. Moreover, further study should be performed to characterize Mansonella sp. “DEUX” morphologically and evaluate its clinical significance in humans.

STROBE checklist.

(DOC)

Click here for additional data file.