Novel strain of Shigella dysenteriae serotype 7 from India.

We describe a strain of Shigella dysenteriae serotype 7 which had novel biochemical and genetic characters. Unlike other S. dysenteriae, it produced gas, fermented mannitol, was a late-lactose fermenter and harboured the set 1A and set 1B genes. The significance of such atypical strains is that they are difficult to identify. If such strains are missed, they could prove to be a serious public health problem because the infectious dose is very low and they may harbour integrons contributing to drug resistance.

The differentiation of Shigella into its four species is based on their different reactions in simple biochemical tests and the serologic activity of the O polysaccharide of their lipopolysaccharide. Currently there are 15 serotypes in S. dysenteriae, six serotypes with 14 subserotypes in S. flexneri, 19 serotypes in S. boydii and a single serotype of S. sonnei[1,2]. They harbour many genetic elements on their invasion plasmid as well as on their chromosomes [1]. Isolation of atypical serotypes of S. flexneri have been reported from Korea, Russia, Bangladesh and China [3-6], and a new serovar of S. dysenteriae has been reported from Bangladesh [7]. Here we report a strain of S. dysenteriae serotype 7 which had novel biochemical and virulence characters.

The strain on primary isolation from a diarrhoeic stool specimen on MacConkey agar showed colonies 2 to 3 mm in size which were flat topped with irregular margins and remained pale up to 16 to 18 hours after incubation. These colonies turned pink after 24 to 48 hours, indicating late-lactose fermenting behavior. On deoxycholate citrate agar, initially pale non-lactose-fermenting colonies were observed, which also turned pink after 24 to 48 hours. On xylose lysine deoxycholate agar, red colonies with a low convex surface were noted. Gram stain revealed the presence of short Gram-negative bacilli which were found to be nonmotile. The organism produced catalase, was oxidase negative, produced indole, did not utilize citrate and did not hydrolyze urea. Kligler iron agar showed a K+/A− reaction indicative of gas production; lysine and ornithine were not decarboxylated; arginine was not hydrolyzed; mannitol was fermented; and ortho-nitrophenyl β-d-galactopyranoside (ONPG) test was positive. The strain fermented lactose after an incubation of more than 24 hours, which explained the late-lactose fermenting behaviour. All these biochemical tests were performed using conventional media and chemicals (Himedia, Mumbai, India). The strain agglutinated with S. dysenteriae polyvalent A antisera (which covers serotypes 1 to 7; Denka-Seiken, Tokyo, Japan). Using the monovalent specific antisera, the strain agglutinated with type 7 monovalent antiserum (Denka-Seiken). Disc diffusion testing performed using the Kirby-Bauer method as per the Clinical Laboratory Standards Institute guidelines [8] against ampicillin 10 μg, ceftriaxone 30 μg, ciprofloxacin 5 μg and cotrimoxazole 25 μg showed that the strain was sensitive to all the antibiotics tested. PCR was performed to detect the virulence genes, namely Shigella enterotoxin 1 (SheT1) comprising the two subtypes set 1A (SheT1A) and set 1B (SheT1B); stx, ipaH, ial and Shigella enterotoxin 2 or sen (SheT2) gene; and InvE (signature gene of enteroinvasive Escherichia coli) [9-12] (Table 1). The strain harboured the ipaH, sen, set 1A, set 1B and ial genes. No other pathogen was isolated from the stool specimen.

Table 1

Primers used in PCR for identification of virulence genes

Virulence gene	Primer	Oligonucleotide sequence (5′–3′)	Size of amplified product (bp)	Reference
set 1A	SheT1A-F	TCACGCTACCATCAAAGA	309	[10]
	SheT1A-R	TATCCCCCTTTGGTGGTA
set 1B	SheT1B-F	GTGAACCTGCTGCCGATATC	147	[10]
	SheT1B-R	ATTAGTGGATAAAAATGACG
ipaH	Shig-F	TGGAAAAACTCAGTGCCTCT	423	[9]
	Shig-R	CCAGTCCGTAAATTCATTCT
stx1	stx1-F	ACCCTGTAACGAAGTTTGCG	140	[11]
	stx1-R	ATCTCATGCGACTACTTGAC
sen	SheT2-F	ATGTGCCTGCTATTATTTAT	799	[9]
	SheT2-R	CATAATAATAAGCGGTCAGC
ial	ial-F	CTGGATGGTATGGTGAGG	320	[9]
	ial-R	GGAGGCCAACAATTATTTCC
InvE	InvE-F	CGATAGATGGCGAGAAATTATATCCCG	766	[12]
	InvE-R	CGATCAAGAATCCCTAACAGAAGAATCAC

Multiple novel biochemical and virulence characters were identified in the present strain. It produced gas and fermented mannitol, characters which have not been reported in the species dysenteriae (Shigella serogroup A). It also fermented lactose after 24 hours of aerobic incubation with a positive ONPG test (late-lactose fermenter), characters reported only in S. sonnei and rarely in serotype 1 of S. dysenteriae[1]. Because the strain had biochemical characters similar to those of enteroinvasive Escherichia coli (EIEC), the InvE gene (a signature gene of EIEC) was targeted by PCR. However, the absence of the InvE gene negated the possibility that this could be an EIEC strain. The presence of ial, ipaH and sen (SheT2) further confirmed that this belonged to the genus Shigella. There is no record of set 1 (SheT1) being reported from S. dysenteriae in the literature. It has previously been reported only from S. flexneri (commonly serotype 2a) [7,9,10]. Sequence BLAST analysis of the target genes set 1A, set 1B and ipaH matched with that of GenBank accession number CP004057, and the ial gene matched with that of GenBank accession number NC016833. We used the BLASTN program (http://www.ncbi.nlm.nih.gov/BLAST) for database searching. The GenBank accession numbers for the submitted sequences of the current isolates are as follows: for the set 1A gene KR822808, for the ipaH gene KR269602 and for the ial gene KT013267. The strain did not harbour the stx gene.

Out of all the Shigella species isolated by our centre, S. flexneri comprised 90.54%, S. sonnei 5.40%, S. dysenteriae 2.70% and S. boydii 1.35%. Antimicrobial resistance is frequently encountered in these isolates. As demonstrated in previous studies from this laboratory, the majority (79%) of the isolates of Shigella were resistant to ampicillin and cotrimoxazole, while 50% were resistant to ciprofloxacin. (The minimum inhibitory concentration of ciprofloxacin was found to be 16 μg/mL.) It was found that 3% of the isolates of S. flexneri were resistant to ceftriaxone (minimum inhibitory concentration of >256 μg/mL) and were confirmed to be extended-spectrum β-lactamase producers that harboured the CTX-M-15 gene [13,14]. Unlike many of the earlier isolates from our region, the present strain of S. dysenteriae was sensitive to all the antibiotics tested.

In general, there are a number of factors which contribute to the emergence of new strains. Of these, human migration associated with trade and industrialization has been well studied [6]. Genetic recombination can arise as a result of selective pressure on the bacterium from environmental factors or can be phage mediated, resulting in aberrant strains. For example, in S. flexneri, the O polysaccharides of the different serotypes and subserotypes are actually polymers of the same basic tetrasaccharide unit. As a result of the phage-mediated insertion of α-glycosyl or O-acetyl residues at specific positions in this basic tetrasaccharide unit, different group and type-specific variants arise [15].

The significance of atypical strains are that the identification of such strains is difficult. Missing such variant strains could result in a serious public health problem [6,16]. Redefining the classification of Shigella by developing a comprehensive classification scheme using a combination of biochemical, serologic and molecular characters must be undertaken because more new variants are being discovered across the globe [7].

Conflict of interest

None declared.