| Literature DB >> 26393576 |
Siv Grethe Aarnes1, Ida Fløystad2, Julia Schregel3, Ole Petter Laksforsmo Vindstad4, Jane Uhd Jepsen5, Hans Geir Eiken6, Rolf A Ims7, Snorre B Hagen8.
Abstract
The autumnal moth (Epirrita autumnata) is a cyclically outbreaking forest Lepidoptera with circumpolar distribution and substantial impact on Northern ecosystems. We have isolated 21 microsatellites from the species to facilitate population genetic studies of population cycles, outbreaks, and crashes. First, PCR primers and PCR conditions were developed to amplify 19 trinucleotide loci and two tetranucleotide loci in six multiplex PCR approaches and then analyzed for species specificity, sensitivity and precision. Twelve of the loci showed simple tandem repeat array structures while nine loci showed imperfect repeat structures, and repeat numbers varied in our material between six and 15. The application in population genetics for all the 21 microsatellites were further validated in 48 autumnal moths sampled from Northern Norway, and allelic variation was detected in 19 loci. The detected numbers of alleles per locus ranged from two to 13, and the observed and expected heterozygosities varied from 0.04 to 0.69 and 0.04 to 0.79, respectively. Evidence for linkage disequilibrium was found for six loci as well as indication of one null allele. We find that these novel microsatellites and their multiplex-PCR assays are suitable for further research on fine- and large-scale population-genetic studies of Epirrita autumnata.Entities:
Keywords: Lepidoptera; multiplex PCR; population genetics; tri- and tetranucleotide microsatellites
Mesh:
Year: 2015 PMID: 26393576 PMCID: PMC4613323 DOI: 10.3390/ijms160922541
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Figure 1Chromatograms from capillary electrophoresis (ABI 3130xl) showing multiplex PCR reactions I–VI (see also Table 1) for the 21 microsatellites developed for E. autumnata. The peak height (Relative fluorescence units (RFU)) is indicated on the Y-axis, and fragment length (base-pairs) is indicated on the X-axis. The names of the microsatellites markers are indicated below the peaks.
Twenty-one microsatellite loci arranged into six multiplex PCR panels for E. autumnata.
| Multiplex Panel | Locus | Primer Sequences (5ʹ–3ʹ) a | Repeat Motif | Size Range (bp) b | Primer Conc., Dye | GenBank Accession Number |
|---|---|---|---|---|---|---|
| I | A021 | F: CCTAAGAGGGAGGCCCATGT | TGA | 86–95 | 2 µM, FAM | KT428619 |
| R: CAGCTTGGTTCGTTAGCAAGG | ||||||
| A019 | F: GCGTTGGCGCATCTGTAAAT | CAT | 146–173 | 3 µM, FAM | KT428620 | |
| R: CGCCACAGAGGTCGTCAAA | ||||||
| A022 | F: CTGCGTGCTAAAACCTACGGA | CAT | 141–147 | 1 µM, VIC | KT428621 | |
| R: CAGCAGTGGACTTCTTCTGGC | ||||||
| A016 | F: AGACCTACACCTGAGTGCATCTTAGTT | CAT | 135–141 | 3 µM, NED | KT428622 | |
| R: CCATCCCAGGTGTGGTGATT | ||||||
| II | D005 | F: CGGTGGTTGCTATGGGTGTT | CTT | 142–163 | 2 µM, FAM | KT428623 |
| R: TTGCATTCTATGTGGGAGGCT | ||||||
| A015 | F: AATTGTATGCCACCGCTGCT | CAT | 301–325 | 2 µM, FAM | KT428624 | |
| R: TCCGTCTGCCAAGTGTA | ||||||
| A139 | F: ACCTGCGATTACCAATCCGA | GAT | 140–149 | 1 µM, NED | KT428625 | |
| R: TTCCGTGGTTCTTCTTCATCAAC | ||||||
| III | B115 | F: TTATAGGTGTCGGTTAAACACTTTAAAAAC | ACT | 141–148 | 2 µM, VIC | KT428626 |
| R: GGTTAAGGCTGCGCTAAAGCT | ||||||
| A107 | F: TAGGGCCAGCAGTGGACTTC | ATG | 147–201 | 2 µM, NED | KT428627 | |
| R: GTTTCTTTGGATGTCCCTTGGCCTTTA | ||||||
| IV | A124 | F: TGAATCGGTGCTCCAATAGGA | TAA | 115–124 | 3 µM, NED | KT428628 |
| R: GTCTCTGTTGACCCCAGGGA | ||||||
| A113 | F: AGACCTCGTCCAACAGTGGG | GAT | 144–165 | 1 µM, FAM | KT428629 | |
| R: AACATTGGACGATCTTATCGCC | ||||||
| D014 | F: TCGTTTTCATCTATTATTAGTTTAGGATTCA | CAAT | 140–156 | 2 µM, NED | KT428630 | |
| R: TTGTTGCACGCCTTAAATGG | ||||||
| B008 | F: TGCATTGTAATAGGACCTTCATATTTTT | ACAG | 173–178 | 5 µM, PET | KT428631 | |
| R: TTATAGGATCACTTTGTTGTCCGTCT | ||||||
| V | A114 | F: TGTCGAGCTCTACAAAAACTGCA | CAT | 118 | 2 µM, FAM | KT428632 |
| R: AATTGGGCCTCAGGTTTCTGT | ||||||
| A101 | F: GAAGCCGCGCTGTTTCTTAA | GTT | 151 | 1 µM, VIC | KT428633 | |
| R: GAGAGGTCGTCGAAACACCCT | ||||||
| A011 | F: CTAGACCGGAGGCAAACCAA | TGA | 153–159 | 0.5 µM, NED | KT428634 | |
| R: CAAAATGACGGTTTGAGCGA | ||||||
| A137 | F: GATCCAGGATCTGAAGCGGA | CAT | 153–174 | 1 µM, FAM | KT428635 | |
| R: AAGACCGTTCGTCATGGCAT | ||||||
| VI | A111 | F: GGCGGAGGTCTTTTCTAGCAG | ATG | 122–137 | 2 µM, FAM | KT428636 |
| R: AACAAGTTTGGGTTGCAAAAGTTT | ||||||
| A130 | F: AACACACTCGAGGGTCCCAA | CAT | 173–227 | 3 µM, FAM | KT428637 | |
| R: GTTCTAGGGCCAGCAGTGGA | ||||||
| A135 | F: TCCTCCAACTCTTTCCGTGG | CAT | 160–187 | 1 µM, PET | KT428638 | |
| R: TTATGGGTGAGGCTTCGTCC | ||||||
| A024 | F: TCGTCTGTAGATATCAACTGCTGGA | CAT | 145–199 | 1 µM, NED | KT428639 | |
| R: GTGGACGTAAGCAGGCTGGT |
a F forward, R reverse; b Allele size range in base pairs observed in 48 individuals of E. autumnata (see Table 4); and Conc., Concentration.
Basic statistics of 21 microsatellites loci developed for E. autumnata in a survey of 48 individuals from Northern Norway.
| Locus | NA | HO | FIS | HE | PI | FNULL | HWE |
|---|---|---|---|---|---|---|---|
| A021 | 3 | 0.438 | 0.1258 | 0.495 | 0.32 | 0.0249 | 0.2676 |
| A019 | 3 | 0.553 | −0.1423 | 0.479 | 0.32 | −0.0496 | 0.9699 |
| A022 | 3 | 0.4375 | 0.2654 | 0.5877 | 0.24 | 0.0918 | 0.0054 ** |
| A016 | 3 | 0.1667 | −0.0697 | 0.1543 | 0.72 | −0.0111 | 1.0000 |
| D005 | 7 | 0.6042 | 0.0347 | 0.6191 | 0.19 | 0.0091 | 0.6835 |
| A015 | 5 | 0.4583 | 0.3233 | 0.6680 | 0.17 | 0.1322 | 0.0001 ** |
| A139 | 3 | 0.229 | 0.1009 | 0.252 | 0.59 | 0.0178 | 0.2429 |
| B115 | 5 | 0.354 | 0.2766 | 0.483 | 0.34 | 0.0913 | 0.0420 * |
| A107 | 8 | 0.596 | 0.1796 | 0.717 | 0.12 | 0.0571 | 0.0341* |
| A124 | 4 | 0.479 | −0.0810 | 0.439 | 0.39 | −0.0225 | 0.7396 |
| A113 | 7 | 0.158 | 0.7739 | 0.682 | 0.14 | 0.3127 | 0.0000 ** |
| D014 | 6 | 0.106 | 0.4148 | 0.179 | 0.68 | 0.0625 | 0.0026 * |
| B008 | 2 | 0.08 | 0.6336 | 0.211 | 0.64 | 0.1083 | 0.0194 * |
| A114 | 1 | 0 | 0 | 0 | 1.00 | 0 | No |
| A101 | 1 | 0 | 0 | 0 | 1.00 | 0 | No |
| A011 | 2 | 0.041 | −0.0108 | 0.041 | 0.92 | −0.0009 | 1.0000 |
| A137 | 5 | 0.688 | 0.0061 | 0.645 | 0.16 | 0.0034 | 0.5214 |
| A111 | 8 | 0.404 | 0.4519 | 0.726 | 0.12 | 0.1722 | 0.0000 ** |
| A130 | 7 | 0.568 | 0.1975 | 0.698 | 0.14 | 0.055 | 0.0603 |
| A135 | 2 | 0.255 | −0.1231 | 0.225 | 0.62 | −0.0246 | 1.0000 |
| A024 | 13 | 0.614 | 0.2379 | 0.794 | 0.06 | 0.0833 | 0.0014 * |
NA: number of different alleles; HO: observed heterozygosity; FIS: inbreeding value; HE: expected heterozygosity; PI: probability of identity; FNULL: Null-alleles estimated with the Brookfiled1 method implemented in Micro-Checker (van Oosterhout et al., 2006 [25]); HWE: significance of departure from Hardy–Weinberg equilibrium; * <0.05, ** <0.01; and a Based on assay of 48 individuals from each locus.
Measurements of precision for 21 STRs from E. autumnata.
| Locus | Allele/Genotype a | Mean b | S.D. (bp) c |
|---|---|---|---|
| A021 allele A | 92 | 92.24 | 0.07 |
| A021 allele B | 95 | 95.49 | 0.1 |
| A019 allele A | 135 | 135.36 | 0.08 |
| A019 allele B | 138 | 138.47 | 0.08 |
| A022 allele A | 145 | 145.92 | 0.08 |
| A022 allele B | 188 | 188.56 | 0.1 |
| A016 allele A | 144 | 144.20 | 0.1 |
| A016 allele B | 147 | 148.62 | 0.09 |
| D005 allele A | 148 | 148.43 | 0.07 |
| D005 allele B | 154 | 154.99 | 0.03 |
| A015 allele A | 301 | 301.08 | 0.07 |
| A015 allele B | 310 | 309.28 | 0.07 |
| A139 allele A | 143 | 143.53 | 0.07 |
| B115 allele A | 141 | 141.70 | 0.06 |
| A107 allele A | 147 | 146.45 | 0.09 |
| A107 allele B | 201 | 201.98 | 0.05 |
| A124 allele A | 121 | 121.44 | 0.06 |
| A124 allele B | 124 | 124.24 | 0.07 |
| A113 allele A | 147 | 147.06 | 0.08 |
| D014 allele A | 152 | 152.47 | 0.07 |
| B008 allele A | 181 | 181.21 | 0.06 |
| A114 allele A | 118 | 118.48 | 0.06 |
| A101 allele A | 151 | 150.68 | 0.07 |
| A011 allele A | 159 | 158.89 | 0.08 |
| A137 allele A | 165 | 165.68 | 0.09 |
| A137 allele B | 171 | 171.55 | 0.08 |
| A111 allele A | 125 | 125.36 | 0.07 |
| A111 allele B | 131 | 131.64 | 0.07 |
| A130 allele A | 173 | 174.16 | 0.07 |
| A130 allele B | 227 | 227.31 | 0.08 |
| A135 allele A | 160 | 159.92 | 0.08 |
| A024 allele A | 154 | 154.10 | 0.06 |
| A024 allele B | 172 | 172.09 | 0.09 |
a Genotype nomenclature is based on PCR fragment sizes.; b Mean value allele sizes when measured with POP7 on ABI3730; and c SD from within-run measurement of 10 run per sample.
DNA sequencing of tandem repeat structure of 21 microsatellites from E. autumnata.
| Locus | Allele/Genotype a | Number Repeats | Repeat Structure |
|---|---|---|---|
| A021 allele A | 92 | 6 R | (TGA)6 |
| A021 allele B | 95 | 7 R | (TGA)7 |
| A019 allele A | 146 | – | (CAT) |
| A022 allele A | 141 * | 5 R | (CAT)5 |
| A022 allele B | 147 * | 6 R | (CAT)6 |
| A016 allele A | 138 | 6 R | (CAT)6 |
| D005 allele A | 148 | 7 R | (CTT)7 |
| D005 allele B | 154 | 9 R | (CTT)9 |
| A015 allele A | 301 | 5 R | (CAT)5 |
| A015 allele B | 322 | 6 R | (CAT)6 |
| A139 allele A | 140 | 7 R | (GAT)7 |
| A139 allele B | 143 | 8 R | (GAT)8 |
| B115 allele A | 141 | 7 R | (ACT)1(TT)(ACT)1(ACA)(ACT)5 |
| B115 allele B | 144 | 8 R | (ACT)1(TT)(ACT)1(ACA)(ACT)6 |
| A107 allele A | 147 | – | – |
| A107 allele B | 201 | 14 R | (ATG)6(AGGCTG)(ATG)3(ACG)(ATG)3(CTG)(ATG)2 |
| A124 allele A | 121 | 7 R | (TAA)7 |
| A124 allele B | 124 | 8 R | (TAA)8 |
| A113 allele A | 147 | 9 R | (GAT)9 |
| A113 allele B | 165 | 15 R | (GAT)15 |
| D014 allele A | 140 | – | (CAAT) |
| D014 allele B | 142 | – | – |
| B008 allele A | 173 | 5 R | (ACAG)2(ACAT)(ACAG)3 |
| B008 allele B | 181 | – | – |
| A114 allele A | 118 | 6 R | (CAT)6 |
| A101 allele A | 151 | 8 R | (GTT)3(GT)(GTT)2(T)(GTT)1(GTA)(GTT)2 |
| A011 allele A | 159 | 6 R | (TGA)3(TGT)(TGA)3 |
| A137 allele A | 165 | 7 R | (CAT)7 |
| A137 allele B | 171 | 9R | (CAT)9 |
| A111 allele A | 125 | 10 R | (ATG)10 |
| A111 allele B | 134 | 7 R | (ATG)7 |
| A130 allele A | 173 | 6 R | (CAT)6 |
| A130 allele B | 227 | 19 R | (CAT)7(CAGCCT)(CAT)6(CAGCCTCAC)(CAT)6 |
| A135 allele A | 160 | 10 R | (CAT)10 |
| A024 allele A | 145 | 6 R | (CAT)6 |
| A024 allele B | 187 | 17 R | CTGAT(CAT)2(CACA)(CAT)15 |
– Sequencing not interpretable; * Structure repeat is taken from the DNA sequences done at Armalil; and a Nomenclature of alleles is based on PCR fragment size.