A PCR-RFLP Assay targeting RPS8 gene for the discrimination between bovine Babesia and Theileria species in China.

BACKGROUND: Bovine babesiosis and theileriosis is an important hemoprotozoal disease in cattles and yaks in tropical and subtropical regions leading to significant economic losses. In the field, the risk of co-infection between the bovine Babesia and Theileria species is very high. Thus, it is necessary to develop a simple, accurate, rapid and cost-effective method for large-scale epidemic investigation, in particular for the detection of co-infection in field.
METHODS: In this study, DNA sequences of a ribosomal protein S8 (RPS8) gene from eight species of cattle piroplasms in China were used to develop a species-specific PCR-RFLP diagnostic tool. The eight Theileria and Babesia species could be differentiated by digesting the RPS8 PCR product with Mbo I.
RESULTS: The sensitivity of the PCR assays was 0.1 pg DNA for Babesia species but 1 pg DNA for Theileria species. The clearly different size of the PCR-RFLP products allowed for a direct discrimination between eight bovine Theileria and Babesia species (T. annulata, T. sinensis, T. sergenti, B. ovata, B. bovis, B. bigemina, B. major and Babesia species Kashi isolate).
CONCLUSION: Our results indicated that the established method based on the RPS8 gene was a reliable molecular diagnostic tool for the simultaneous detection and identification of bovine Babesia and Theileria species in China, which could be applicable for the survey of parasite dynamics, epidemiological studies as well as prevention and control of the disease.

Background

Piroplasms, comprising mainly the genera Babesia and Theileria, are tick-transmitted protozoa that are pathogenic to ruminants, horses, pigs, dogs, cats and cattle, and in some cases, even to humans. In the vertebrate hosts, the infection usually causes fever, anemia and haemoglubinuria, and in severe cases, death [1, 2]. Animals that recover from acute or primary infections remain chronically infected, and act as reservoirs for ticks [3].

Eight species of bovine Babesia and Theileria (B. bigemina, B. bovis, B. major, B. ovata, an unidentified Babesia sp., T. annulata, T. sergenti and T. sinensis) have been identified in China [4]. The eight species of bovine Babesia and Theileria species can cause a significant loss in meat and milk production from cattles in some parts of China. Boophilus microplus has been demonstrated to be the vector of B. bigemina and B. bovis [5], while Haemaphysalis longicornis and H. punctata are potential vectors of B. major [6, 7]. H. longicornis is also considered to be the vector of B. ovata and T. sergenti [4, 8]. Nymphal progeny derived from female Hyalomma anatolicum anatolicum collected from the field were shown to be capable of transmitting an unidentified Babesia sp. (Designated Babesia Usp.) to calves [9]. Hyalomma spp., including Hyalomma detritum, Hy. a. anatolicum and Hy. rufipes, are distributed mainly in semi-dry and desert-land in Northern China, and have been reported to be vectors of T. annulata [10]. T. sinensis is transmitted by H. qinghaiensis [11]. In the field, the risk of co-infection between the eight bovine Babesia and Theileria species is very high. The species are morphylogically indistinguishable, and molecular techniques have become the key to species identification. So it is necessary to develop a simple, reliable and cost-effective method that is suitable for large-scale epidemic investigation, particularly for the detection of co-infection in field [12].

In the work described here, an informative molecular target has been identified in the ribosomal protein S8 (RPS8) gene from bovine Babesia and Theileria species endemic in China. The amplified gene fragment containing non-coding regions varied extensively both in length and in sequence, and allowed the development of an assay for species differentiation based solely on fragment size when combined with a simple PCR-restriction fragment length polymorphism (RFLP) protocol.

Methods

Ethics statement

All animal experiments were performed according to the protocols approved by the Animal Care and Use Committee of the Lanzhou Veterinary Research Institute (permit number 2009–26).

Parasite species

The isolates used in this study were listed in Table 1. Babesia bovis (Shanxian and Lushi) [13], B. bigemina (Kunming and Lushi) [14], B. major (Yili) [7], B. ovata (Wenchuan and Lushi and Zhangjiachuan) [15], Babesia sp. Kashi2 (Kashi) [16],Theileria annulata (Xingjiang and Ningxia and Sanmenxia) [17], T. sergenti (Lushi) [4], T. sinensis (Weiyuan and Lintan and Lintao) [18].

Table 1

The location, vector and RPS8 (coding and non-coding regions) gene accession numbers for Babesia and Theileria species used in this study

Parasite	Location	Tick vector	RPS8 Accession No.
Babesia bovis	Shanxian	Boophilus microplus	JN400408
B. bovis	Lushi	B. microplus	JN400409
B. bigemina	Kunming	B. microplus	JN400410
B. bigemina	Lushi	B. microplus	JN400411
B. major	Yili	Haemaphysalis punctata	JN400412
B. ovata	Lushi	H. longicornis	JN400413
B. ovata	Wenchuan	H. longicornis	JN400414
B. ovata	Zhangjiachuan	H. longicornis	JN400415
Babesia sp. Kashi2	Kashi	Hyalomma spp.	JN400416
Theileria annulata	Sanmenxia	H. detritum	JN400419
T. annulata	Xinjiang	H. scupense	JN400420
T. annulata	Ningxia	H. detritum	JN400428
T. annulata	Ankara	H. detritum	NC_011099
T. sergenti	Lushi	H. longicornis	JN400421
T. orientalis	Shintoku	H. longicornis	AP011947
T. siensis	Lintan	H. qinghaiensis	JN400422
T. siensis	Weiyuan	H. qinghaiensis	JN400423
T. siensis	Lintao	H. qinghaiensis	JN400427

DNA extraction

The calves, aged between 12 and 24 months old, were infected by inoculating 5 ml of cryopreserved infected blood stock of these Babesia and Theileria isolates into the jugular vein. When the parasitemia reached 5 %, blood was collected into heparin vacutainer tubes via jugular venipuncture. The infected blood was resuspended in PSG buffer in the presence of SDS (final concentration was 2 %) and proteinase K (final concentration was 1 mg/ml). The solution was incubated at 42 °C for 14 h. Parasite DNA was extracted by conventional phenol/chloroform for deproteinization of the aqueous solution containing the desired nucleic acid. The purified DNAs were precipitated by the addition of two volumes of cold absolute ethanol. The pellet was dried, dissolved in sterile distilled water and kept at −20 °C until use. Control DNA was isolated from blood of uninfected cattle and blood of Trypanosoma brucei evansi infected mouse [19].

PCR-RFLP analysis

To develop a PCR-RFLP technique for species- and strain-specific diagnosis of bovine Babesia and Theileria parasites, sequences conserved in all Babesia and Theileria species were identified from sequence alignment and used as primers in a single PCR protocol. For the PCR step, a PCR product that was about 707–855 bp long was amplified using primers 5′- ATGGGTATTTCACGTGACAG -3′ and 5′- GCGTTTCTTCTTATCCATACG -3′. Each PCR mixture (total volume, 50 μl) contained 5 μl of 10 × PCR buffer, 6 mM MgCl2, deoxynucleoside triphosphate at a concentration of 200 μM each, primer at a concentration of 200 nM each, 2.5 U of Taq polymerase, and 20 ng of DNA template. A total of 35 cycles, each consisting of 94 °C for 45 s, 54 °C for 45 s, and 72 °C for 1 min, were performed; an initial hot start at 94 °C for 3 min and a final extension step at 72 °C for 7 min were also included.

For restriction fragment analysis, 20 μl of the PCR products was digested in a 50-μl reaction mixture containing 20 U of MboI (Takara) and 5 μl of the appropriate restriction buffer at 37 °C for 1 h, under conditions recommended by the supplier. The digested products were fractionated on a 3.0 % agarose gel and visualized by ethidium bromide staining. In additional, predicted restriction fragment length polymorphism (RFLP) patterns were produced in silico using the web-based software In Silico [20]. Image analysis of the electrophoretic gels was performed with 1-day Manager Software (TDI, Madrid, Spain).

Results and discussion

PCR amplification of RPS8 gene from the DNA yielded a product of 709 bp for T. annulata isolates, 713 bp for T. sergenti Lushi isolate, 707 bp for T. sinensis isolates. Similarly, Babesia species yielded products that were similar or identical in size. PCR products of B. bigemina isolates, B. major, B. ovata isolates, B. bovis isolates, and Babesia sp. Kashi2 were 849, 847, 849, 820, 855 bp, respectively (Table 2, Fig. 1). Specificity for Babesia and Theileria was confirmed by the absence of products from samples of Trypanosoma brucei evansi and cattle genomic DNA (Fig. 1). The single PCR was quite sensitive (0.1 pg genomic DNA of Babesia species and 1 pg genomic DNA of Theileria species), as demonstrated by the amplification of serial diluted DNA samples (data not shown). Amplicon size alone could not distinguish the species. However, on digestion with Mbo I, fragment polymorphism was visible post gel electrophoresis of the digested DNA (Table 2, Fig. 2). Thus RFLP will clearly distinguish among Babesia- and Theileria- infected cattles. However, this is based on a limited sample size and we need to confirm that there is no intra-specific restriction polymorphism, particularly for the complex Theileria buffeli/orientalis group [21, 22].

Table 2

The amplicon size, intron size, and Mbo I restriction fragment of RPS8 (coding and non-coding regions) genes of Babesia and Theileria species used in this study

Species	Strain	Amplicon size (bp)	Mbo I
Theileria sergenti	Lushi	713	464, 249
T. orientalis	Shintoku	713	464, 249
T. annulata	Xingjiang, Ningxia and Sanmenxia	709	227, 203, 182, 97
T. annulata	Ankara	709	227, 203, 182, 97
T. sinensis	Weiyuan, Lintao and Lintan	707	430, 182, 95
Babesia bigemina	Kunming and Lushi	849	506, 243, 100
B. bovis	Shanxian and Lushi	820	341, 243, 99, 90, 37
B. major	Yili	847	274, 243, 231, 99
Babesia sp. Kashi2	Kashi	855	476, 274, 99, 37
B. ovata	Zhangjiachuan, Wenchuan and Lushi	849	275, 242, 232, 99

Fig. 1

PCR products of a fragment of the RPS8 gene. Lane 1, 2000 bp size markers; lane 2: T. sergenti; lane 3, T. annulata; lane 4, B. bovis; lane 5, B. major; lane 6, B. bigemina; lane 7, T. sinensis; lane 8, B. ovata; lane 9, Babesia sp. Kashi 2; lane 10, Trypanosoma brucei evansi;lane 11, Negative control, cattle genomic DNA

Fig. 2

Fragments of the RPS8 (coding and non-coding regions) gene digested with MboI. Lane 1, 2000 bp size marker; lane 2, B. bovis (Shanxian and Lushi isolates); lane 3, T. sergenti (Lushi isolate); lane 4, B. major (Yili isolate); lane 5, T. annulata (Sanmenxia and Xinjiang and Ningxia isolates); lane 6, Babesia sp. Kashi (Kashi isolate) 2; lane 7, B. bigemina (Kunming and Lushi isolates); lane 8, T. sinensis (Weiyuan and Lintan and Lintao isolates); lane 9, B. ovata (Wenchuan and Lushi and Zhangjiachuan isolates)

A more practical assay is required to classify piroplasms such as Theileria and Babesia isolates since current serological and morphological tests cannot discriminate between closely related species [12]. Although reverse line blot (RLB) assay for the simultaneous identification of bovine Babesia and Theileria species has been developed, its use for routine diagnosis is restricted by various factors. These include the availability of reagents, complexity of operating procedures, special equipment needs and high susceptibility in the subjective interpretation of the hybridisation signal [23, 24]. Although nucleic acid-based tests such as real-time PCR and Loop-mediated isothermal amplification (LAMP) demonstrate significant sensitivity and specificity, they are only suitable for single species differentiation [25-29]. It would be desirable to have a ‘universal’ PCR-based test for the simultaneous detection and identification of these parasites. This requires the analysis of a molecular target conserved among piroplasms, yet variable enough to design a reliable species identification protocol.

In our previous study, RPS8 rDNA was confirmed to be a useful and novel genetic marker for defining species boundaries and for detecting closely related species, similar to 18S rDNA, because it tends to have little intra-species variation but considerable inter-species difference. It is relatively simple to amplify RPS8 rDNA by polymerase chain reaction (PCR) based on the highly conserved rDNA flanking both RPS8 regions [30, 31]. In this study, our results indicated that the RPS8-based PCR-restriction fragment length polymorphism was a simple and reliable molecular diagnostic tool for the simultaneous detection and identification of bovine Babesia and Theileria species in China, which could be applicable for the survey of parasite dynamics, epidemiological studies as well as prevention and control of the disease.

Conclusions

In this work, we found that utilizing PCR with restriction fragment length polymorphism (RFLP) on the RPS8 gene can be useful for the differentiation of the most common pathogenic Babesia and Theileria species infecting cattles in China. However, more samples are needed to verify the usefulness of the RPS8 (coding and non-coding regions) gene as a marker for the detection of the most Babesia and Theileria species, particularly for some closely related species.