Literature DB >> 26329827

Development of novel multiplex microsatellite polymerase chain reactions to enable high-throughput population genetic studies of Schistosoma haematobium.

B L Webster1,2, M Rabone3, T Pennance4,5, A M Emery6, F Allan7, A Gouvras8, S Knopp9,10,11, A Garba12, A A Hamidou13, K A Mohammed14, S M Ame15, D Rollinson16, J P Webster17,18.   

Abstract

BACKGROUND: Human urogenital schistosomiasis caused by Schistosoma haematobium is widely distributed across Africa and is increasingly targeted for control and regional elimination. The development of new high-throughput, cost-effective molecular tools and approaches are needed to monitor and evaluate the impact of control programs on the parasite populations. Microsatellite loci are genetic markers that can be used to investigate how parasite populations change over time and in relation to external influences such as control interventions.
FINDINGS: Here, 18 existing S. haematobium microsatellite loci were optimised to enable simultaneous amplification across two novel multiplex microsatellite PCR's, each containing nine loci. Methods were developed for the cost effective and rapid processing and microsatellite analysis of S. haematobium larval stages stored on Whatman-FTA cards and proved robust on miracidia and cercariae collected from Zanzibar and Niger.
CONCLUSION: The development of these novel and robust multiplex microsatellite assays, in combination with an improved protocol to elute gDNA from Whatman-FTA fixed schistosome larval stages, enables the high-throughput population genetic analysis of S. haematobium. The molecular resources and protocols described here advance the way researchers can perform multi locus-based population genetic analyses of S. haematobium as part of the evaluation and monitoring of schistosomiasis control programmes.

Entities:  

Mesh:

Year:  2015        PMID: 26329827      PMCID: PMC4557312          DOI: 10.1186/s13071-015-1044-6

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Findings

Introduction

Infection with the blood fluke Schistosoma haematobium causes human urogenital schistosomiasis throughout Africa, parts of the Middle East, Madagascar and the Indian Ocean Islands, with an estimated 110 million people infected [1]. Several efforts are underway to control morbidity and ultimately to eliminate S. haematobium infection predominantly through the large-scale administration of the drug praziquantel (PZQ) [1]. The development of new high-throughput, low cost, molecular tools and approaches are now imperative, not only to elucidate the epidemiology and evolution of schistosomiasis but also to monitor and evaluate the impact of progressing control programs [2]. Here we present an enhanced method enabling the high-throughput and cost effective preparation of gDNA from individual schistosome larval stages facilitating multi-loci genetic analysis together with two novel S. haematobium multiplex microsatellite PCRs. Microsatellite loci are highly variable DNA markers in widespread use within the schistosomiasis research community as they enable population-level analysis [3]. The principal drawback of microsatellite markers has been the cost and labour associated with the need to genotype multiple loci. Significant cost and timesaving can be achieved by developing multiplex PCR systems that amplify multiple microsatellite loci in single reactions. The methods outlined here facilitate the high-throughput microsatellite-based population genetic analyses of S. haematobium.

Microsatellite multiplex design and optimisation

S. haematobium microsatellite loci were available from [4] and [3]. Loci that were di, tri or tetra-mer repeats, non-compound, robust and had multiplexing potential were selected for further optimisation. Eighteen loci were chosen in total (15 from [3] and three from [4], Table 1). Initially the functionality and specificity of all the primer pairs were confirmed by amplifying all the loci in singleplex 12.5 μl reactions using 10 ng of S. haematobium reference gDNA obtained from the Schistosomiasis Collection at the Natural History Museum (SCAN [5]) and the Type-it Microsatellite PCR Kit (Qiagen) according to the manufacturer’s protocol.
Table 1

Details of the 18 selected microsatellite loci and the characteristics of the two multiplex microsatellite PCR assays. Loci Sh1-15 are from Travis et al., 2013 and Loci C102, C111 and C131 are from Gower et al., 2011. For Niger Ho = 0.596, He = 0.609, for Pemba Ho = 0.599, He = 0.638. The overall Ho = 0.597, He = 0.623

Panel 1MarkerForward Primer 5'- 3'Reverse Primer 5'- 3'DyeSize Range (bp)RepeatANigerZanzibar
H o H e H o H e
Panel 1C102TGTCTCTGTGAATGACCGAATTTAGATGAATAATAATGTTGAAACCACVIC184–199ATT60.420.370.020.02
Sh1GCATCCAATTTCGTACACCCACATTAGGCCAACAAGVIC245–284AAT130.760.720.840.80
Sh14GTCCTCCTTCCCTCTTTGCACATTCGTCCTAGATATCGNED184–240ACTC150.940.850.860.88
C131CTTGTCATTTGGGCATTGTGCATGGTGAGGTTCAAACGTGNED253–265AAT40.000.000.000.00
Sh6GGGATGTATGCAGACTTGTTGTTTGGCTGCAGTAACNED309–321AAT70.480.440.840.76
Sh9GCTGAGCTTGAGATTGCTTCTGTCCCATCGATACC6-FAM197–227AAT110.460.760.460.86
Sh3GCTGAGCTTGAGATTGCTTCTGTCCCATCGATACC6-FAM270–366AAT300.760.860.940.86
C111CCCTTGTCTTCAATGCGTTAGAACGTCTAACTGGCGATCAPET201–225ATT90.740.670.760.68
Sh7TCCAAGCACCATTATCAAGACGGAAACTTGTTGAAATGPET293–311AAT70.460.620.420.48
Panel 2Sh2TTAGTGTGTTTGGCTTCAACCCTCGAATGAAATCCTGACNED155–218AAT210.840.900.560.89
Sh5TGTGCACAAGAAAGATTAAATGACGACAATGTTGCAAGTTCNED263–314AAT160.780.810.360.48
Sh13GAGCAGCTATTTCGTATCGACCGTGGACAGTTCATCAG6-FAM163–211AAT170.780.720.680.64
Sh4CCCATCGCTGATATTAAAGTCTAGTCGTCTTGGGATCC6-FAM268–313AAT130.840.780.720.79
Sh10CGCATGTCATACCTATCTCCGCTTATCAGGCCTATCTCCPET183–207AAT90.180.340.740.70
Sh12CGTCTTAGTGAGCCAGATGCTCGTGGACATCATCAGPET245–278AAC110.060.060.560.65
Sh8CTAAACTGGCAAGATTTCCAACGTGCCTTTATTTCPET282–321AAT140.760.810.840.83
Sh11TTGGTTTAGAAATTACATCACCCCAACAATATTAATGGACAGCVIC183–213ATC90.680.580.680.69
Sh15CTTTCAGTAGGATTTGTTGCGACGTCAAGCACTGTACVIC274–301ATC100.780.650.500.466

Panel = single mulitplex PCR. A = observed number of alleles. Dye = the fluorescent dye label of the forward primer (VIC = green, NED = yellow, 6-FAM = Blue, PET = red). Ho = observed heterozygosity, He = expected heterozygosity

Details of the 18 selected microsatellite loci and the characteristics of the two multiplex microsatellite PCR assays. Loci Sh1-15 are from Travis et al., 2013 and Loci C102, C111 and C131 are from Gower et al., 2011. For Niger Ho = 0.596, He = 0.609, for Pemba Ho = 0.599, He = 0.638. The overall Ho = 0.597, He = 0.623 Panel = single mulitplex PCR. A = observed number of alleles. Dye = the fluorescent dye label of the forward primer (VIC = green, NED = yellow, 6-FAM = Blue, PET = red). Ho = observed heterozygosity, He = expected heterozygosity The loci were successfully divided into two multiplex panels each incorporating nine loci that gave the maximum size difference between each locus and a maximum of four overlapping loci at any size range, together with minimal variance of the annealing temperature of all the primers (Tm) (Table 1). Within each panel the forward primer for each locus was 5' labelled with a fluorescent reporter dye according to the 5-dye detection system. Overlapping fragments were assigned a different dye and the maximum distance was maintained between fragments labelled with the same dye to enable accurate identification. The multiplex microsatellite PCRs for each panel were carried out in 12.5 μl reactions using 10 ng of S. haematobium reference gDNA and the Type-it Microsatellite PCR Kit (Qiagen) according to the manufacturer’s protocol. Different Tm values were tested with the optimal Tm that gave uniform and specific amplification for all loci in each panel determined at 54 °C. Singleplex and multiplex amplicons were visualised on 3 % gel red agarose gels before 2 μl of 1: 50 dilutions were mixed with 0.35 μl of GS500Liz size standard (Applied Biosystems) before being denatured for 5 mins at 95 °C and injected at a 10 s injection speed into an Applied Biosystems 3130xl DNA Analyser. Allele peaks were visualised in Geneious version 6.1.4 (www.geneious.com [6]) using the microsatellite plugin. The multiplex PCRs proved robust giving identical peak scores in repeated reactions, in singleplex versus multiplex reactions, and significant stutter peaks, n-1 products and allelic drop-out were not observed.

Multiplex PCR optimisation and application on field-collected S. haematobium miracidia and cercaria

A novel, high-throughput and cost effective non-wash Whatman-FTA alkaline DNA elution protocol has been developed which provides ~38 μl of eluted DNA from a single schistosome larval stage which has been fixed on a classic indicating Whatman-FTA card. This three-step protocol is very simple, quick and is suitable for multi-well processing. Individual larval DNA is alkaline eluted from a single 2.0 mm Whatman-FTA punch and subsequently neutralised, providing usable DNA for many downstream applications including microsatellite and fragment analysis, mitochondrial and nuclear DNA/gene amplification (http://www.gelifesciences.com). The solutions (1 and 2) needed for the DNA elution steps can be easily made with standard laboratory chemicals at an insignificant cost, especially compared to alternative DNA preparation methods. Individual S. haematobium miracidia were collected directly from individual urine samples of infected children in Niger and Pemba Island (Zanzibar, United Republic of Tanzania [7]). S. haematobium cercariae were also obtained from naturally infected Bulinus globosus snails from Niger. All samples were collected and individually preserved on Whatman-FTA cards [8, 9]. DNA elutions were carried out in low profile 1.2 ml 96 square well storage microplates with 96 square well sealing cap mats which facilitates DNA elution. The 2.0 mm Whatman-FTA punch containing the DNA from a single larval stage was incubated at room temperature in 14 μl of Solution 1 (0.1 M NaOH, 0.3 mM EDTA, pH13.0) for 5 mins. Subsequently, 26 μl of Solution 2 (0.1 M TrisHCl, pH7.0) was added, the mixture was pulse vortexed three times, incubated for a further ten minutes at room temperature and then pulse vortexed ten times. The eluted DNA was then transferred to a 96 well storage plate and either used immediately or stored at -20 °C for future use. The two multiplex microsatellite PCRs were performed on each available sample in 12.5 μl reactions using 2 μl of the eluted DNA and the Type-it Microsatellite PCR Kit (Qiagen) according to the manufacturer’s protocol with the addition of 1.25 μl of the Type-it Microsatellite PCR Kit Q-Solution. Optimal cycling parameters were, an initial denaturing step of 95 °C for 5 mins followed by 32 cycles of 95 °C for 30 s, 54 °C for 90 s, 72 °C for 3 mins and followed by a final elongation step of 60 °C for 30 mins. Reactions were checked by 3 % agarose gel electrophoresis and then diluted 1 in 10 before being denatured and injected at an optimal speed of 12 s into the Applied Biosystems 3130xl DNA analyser for analysis. Allele peaks were checked and edited using Geneious 6.1.4 (www.geneious.com [6]) before being placed into amplicon size “bins” and exported for analysis. Panel 1 and 2 allele data were compiled for each sample for analysis (Additional file 1: Table S1). Data were analysed from ten miracidia, from five children from Koutoukale Zeno (Lat. 13.680, Long. 1.738) in Niger, five children from Chambani school (Lat. 5.33457 Long. 39.77256) on Pemba Island, Zanzibar, United Republic of Tanzania and also from 16 cercariae from two infected Bulinus snails from Niger. All loci amplified successfully with no significant stutter peaks or n-1 products. Whilst low peak height was often observed in the loci Sh7 (Panel 1) compared to the other loci and was lower in samples from Niger compared to Pemba, the data were still scorable. Genetic diversity indices were calculated using the program GenAlEx 6.5 [10] and the presence of null alleles and allele dropout was evaluated using Micro-Checker [11]. The numbers of alleles observed across the loci ranged from 2 to 33 with loci C131 being the least diverse. Higher genetic diversity was observed in the Pembamiracidial population compared to that from Niger (Table 1). Cercariae obtained from each individual snail had identical genotypes, showing they were clonal, derived from a single miracidium.

Inter-species specificity

The cross-reactivity of the multiplex microsatellite PCRs was also assessed on S. mansoni, which causes intestinal schistosomiasis and is very common throughout Africa and can sometimes be found ectopically excreted in urine samples in endemic co-infection foci [12]. Singleplex and multiplex reactions were performed on 10 ng of reference gDNA from individual S. mansoni male worms obtained from the Schistosomiasis Collection at the Natural History Museum (SCAN [5]). Cross-reactivity was found to be low: seven loci failed to amplify, six gave low and/or non-specific amplification, two exhibited a size shift and only three among the total of 18 loci amplified well and were within the size range expected (Table 2).
Table 2

Cross reactivity of the two multiplex microsatellite PCR assays on S. mansoni

MarkerSize Range (bp)
Panel 1C102allelic drop-out
Sh1245–284
Sh14low amplification
C131low amplification
Sh6309–321
Sh9low amplification
Sh3allelic drop-out
C111allelic drop-out
Sh7allelic drop-out
Panel 2Sh2allelic drop-out
Sh5low amplification
Sh13allelic drop-out
Sh4254
Sh10168
Sh12242–272
Sh8allelic drop-out
Sh11allelic drop-out
Sh15allelic drop-out
Cross reactivity of the two multiplex microsatellite PCR assays on S. mansoni In conclusion, this study describes two novel robust and informative multiplex microsatellite assays enabling the simultaneous amplification of 18 individual loci; facilitating population genetic analysis of all S. haematobium life-cycle stages. Protocols are presented that facilitate high-throughput, and cost effective processing and robust genetic analysis of S. haematobium larval stages. Such tools can greatly assist large-scale population genetic analysis of human schistosome populations such as that now underway within the SCORE programme (http://score.uga.edu). The alkaline elution of larval schistosome DNA from Whatman-FTA stored samples is simple, quick, high-throughput and low cost, providing adequate amounts of gDNA preparations for multiple molecular analyses and repeats, significantly overcoming the limitations encountered from the standard Whatman-FTA preparations [2]. Additionally, the multiplexing of the microsatellite loci significantly reduces the resources associated with genotyping multiple microsatellite loci for analysis.

Ethics statement

For the Niger sample collection, ethical approval was obtained from the St Mary’s Hospital Local Ethics Research Committee (part of the Imperial College London Research Ethics Committee (ICREC; (EC NO: 03.36. R&D No: 03/SB/033E)) in London, United Kingdom. For the Zanzibar sample collection, ethical approval was obtained from the Zanzibar Medical Research and Ethics Committee (ZAMREC, reference no. ZAMREC 0003/Sept/011) in Zanzibar, United Republic of Tanzania, the “Ethikkomission beider Basel” (EKBB, reference no. 236/11) in Basel, Switzerland, and the Institutional Review Board of the University of Georgia (project no. 2012-10138-0). Within both Niger and Zanzibar, all aspects of sample collections were carried out in the framework of the disease control activities implemented and approved by the local Ministry of Health (MoH) and adopted by regional and local administrative and health authorities. The study participants were informed about the study objectives and procedures. Written consent was obtained from parents prior to sample collection from children. Participation was voluntary and children could withdraw or be withdrawn from the study at any time without obligation. All children were offered PZQ (40 mg/kg single oral dose) treatment in the frame of the following school-based or community-wide treatment carried out by the MoH.
  10 in total

1.  Epidemiology of mixed Schistosoma mansoni and Schistosoma haematobium infections in northern Senegal.

Authors:  Lynn Meurs; Moustapha Mbow; Kim Vereecken; Joris Menten; Souleymane Mboup; Katja Polman
Journal:  Int J Parasitol       Date:  2012-02-16       Impact factor: 3.981

2.  Population genetics of Schistosoma haematobium: development of novel microsatellite markers and their application to schistosomiasis control in Mali.

Authors:  C M Gower; A F Gabrielli; M Sacko; R Dembelé; R Golan; A M Emery; D Rollinson; J P Webster
Journal:  Parasitology       Date:  2011-06-17       Impact factor: 3.234

3.  Development and application of an ethically and epidemiologically advantageous assay for the multi-locus microsatellite analysis of Schistosoma mansoni.

Authors:  C M Gower; J Shrivastava; P H L Lamberton; D Rollinson; B L Webster; A Emery; N B Kabatereine; J P Webster
Journal:  Parasitology       Date:  2006-11-13       Impact factor: 3.234

4.  Evolutionary concepts in predicting and evaluating the impact of mass chemotherapy schistosomiasis control programmes on parasites and their hosts.

Authors:  Joanne P Webster; Charlotte M Gower; Alice J Norton
Journal:  Evol Appl       Date:  2008-02       Impact factor: 5.183

5.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

6.  Genetic diversity within Schistosoma haematobium: DNA barcoding reveals two distinct groups.

Authors:  Bonnie L Webster; Aiden M Emery; Joanne P Webster; Anouk Gouvras; Amadou Garba; Oumar Diaw; Mohmoudane M Seye; Louis Albert Tchuem Tchuente; Christopher Simoonga; Joseph Mwanga; Charles Lange; Curtis Kariuki; Khalfan A Mohammed; J Russell Stothard; David Rollinson
Journal:  PLoS Negl Trop Dis       Date:  2012-10-25

7.  Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.

Authors:  Matthew Kearse; Richard Moir; Amy Wilson; Steven Stones-Havas; Matthew Cheung; Shane Sturrock; Simon Buxton; Alex Cooper; Sidney Markowitz; Chris Duran; Tobias Thierer; Bruce Ashton; Peter Meintjes; Alexei Drummond
Journal:  Bioinformatics       Date:  2012-04-27       Impact factor: 6.937

8.  Study and implementation of urogenital schistosomiasis elimination in Zanzibar (Unguja and Pemba islands) using an integrated multidisciplinary approach.

Authors:  Stefanie Knopp; Khalfan A Mohammed; Said M Ali; I Simba Khamis; Shaali M Ame; Marco Albonico; Anouk Gouvras; Alan Fenwick; Lorenzo Savioli; Daniel G Colley; Jürg Utzinger; Bobbie Person; David Rollinson
Journal:  BMC Public Health       Date:  2012-10-30       Impact factor: 3.295

9.  Schistosomiasis collection at NHM (SCAN).

Authors:  Aidan M Emery; Fiona E Allan; Muriel E Rabone; David Rollinson
Journal:  Parasit Vectors       Date:  2012-09-03       Impact factor: 3.876

10.  Significant variance in genetic diversity among populations of Schistosoma haematobium detected using microsatellite DNA loci from a genome-wide database.

Authors:  Travis C Glenn; Stacey L Lance; Anna M McKee; Bonnie L Webster; Aidan M Emery; Adhemar Zerlotini; Guilherme Oliveira; David Rollinson; Brant C Faircloth
Journal:  Parasit Vectors       Date:  2013-10-17       Impact factor: 3.876

  10 in total
  17 in total

1.  Potential drivers for schistosomiasis persistence: Population genetic analyses from a cluster-randomized urogenital schistosomiasis elimination trial across the Zanzibar islands.

Authors:  Tom Pennance; M Inês Neves; Bonnie L Webster; Charlotte M Gower; Stefanie Knopp; Iddi Simba Khamis; Shaali M Ame; Said M Ali; Muriel Rabone; Aidan Emery; Fiona Allan; Mtumweni Ali Muhsin; Khamis Rashid Suleiman; Fatama Kabole; Martin Walker; David Rollinson; Joanne P Webster
Journal:  PLoS Negl Trop Dis       Date:  2022-10-10

2.  Transmission and diversity of Schistosoma haematobium and S. bovis and their freshwater intermediate snail hosts Bulinus globosus and B. nasutus in the Zanzibar Archipelago, United Republic of Tanzania.

Authors:  Tom Pennance; Shaali Makame Ame; Amour Khamis Amour; Khamis Rashid Suleiman; Mtumweni Ali Muhsin; Fatma Kabole; Said Mohammed Ali; John Archer; Fiona Allan; Aidan Emery; Muriel Rabone; Stefanie Knopp; David Rollinson; Joanne Cable; Bonnie L Webster
Journal:  PLoS Negl Trop Dis       Date:  2022-07-05

3.  Population Genetic Structure and Hybridization of Schistosoma haematobium in Nigeria.

Authors:  Amos Mathias Onyekwere; Olivier Rey; Jean-François Allienne; Monday Chukwu Nwanchor; Moses Alo; Clementina Uwa; Jerome Boissier
Journal:  Pathogens       Date:  2022-03-31

4.  Whole genome amplification and exome sequencing of archived schistosome miracidia.

Authors:  Winka Le Clec'h; Frédéric D Chevalier; Marina McDew-White; Fiona Allan; Bonnie L Webster; Anouk N Gouvras; Safari Kinunghi; Louis-Albert Tchuem Tchuenté; Amadou Garba; Khalfan A Mohammed; Shaali M Ame; Joanne P Webster; David Rollinson; Aidan M Emery; Timothy J C Anderson
Journal:  Parasitology       Date:  2018-05-28       Impact factor: 3.234

5.  Erratum to: Development of novel multiplex microsatellite polymerase chain reactions to enable high-throughput population genetic studies of Schistosoma haematobium.

Authors:  B L Webster; M Rabone; T Pennance; A M Emery; F Allan; A Gouvras; S Knopp; A Garba; A A Hamidou; K A Mohammed; S M Ame; D Rollinson; J P Webster
Journal:  Parasit Vectors       Date:  2015-10-09       Impact factor: 3.876

6.  Impacts of host gender on Schistosoma mansoni risk in rural Uganda-A mixed-methods approach.

Authors:  Suzan C M Trienekens; Christina L Faust; Keila Meginnis; Lucy Pickering; Olivia Ericsson; Andrina Nankasi; Arinaitwe Moses; Edridah M Tukahebwa; Poppy H L Lamberton
Journal:  PLoS Negl Trop Dis       Date:  2020-05-13

7.  Interactions between Schistosoma haematobium group species and their Bulinus spp. intermediate hosts along the Niger River Valley.

Authors:  Tom Pennance; Fiona Allan; Aidan Emery; Muriel Rabone; Jo Cable; Amadou Djirmay Garba; Amina Amadou Hamidou; Joanne P Webster; David Rollinson; Bonnie L Webster
Journal:  Parasit Vectors       Date:  2020-05-24       Impact factor: 3.876

Review 8.  Parasite Population Genetic Contributions to the Schistosomiasis Consortium for Operational Research and Evaluation within Sub-Saharan Africa.

Authors:  Joanne P Webster; Maria Inês Neves; Bonnie L Webster; Tom Pennance; Muriel Rabone; Anouk N Gouvras; Fiona Allan; Martin Walker; David Rollinson
Journal:  Am J Trop Med Hyg       Date:  2020-07       Impact factor: 2.345

9.  Multihost Transmission of Schistosoma mansoni in Senegal, 2015-2018.

Authors:  Stefano Catalano; Elsa Léger; Cheikh B Fall; Anna Borlase; Samba D Diop; Duncan Berger; Bonnie L Webster; Babacar Faye; Nicolas D Diouf; David Rollinson; Mariama Sène; Khalilou Bâ; Joanne P Webster
Journal:  Emerg Infect Dis       Date:  2020-06       Impact factor: 6.883

10.  Mapping freshwater snails in north-western Angola: distribution, identity and molecular diversity of medically important taxa.

Authors:  Fiona Allan; Jose Carlos Sousa-Figueiredo; Aidan M Emery; Rossely Paulo; Clara Mirante; Alfredo Sebastião; Miguel Brito; David Rollinson
Journal:  Parasit Vectors       Date:  2017-10-10       Impact factor: 3.876

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.