| Literature DB >> 26329827 |
B L Webster1,2, M Rabone3, T Pennance4,5, A M Emery6, F Allan7, A Gouvras8, S Knopp9,10,11, A Garba12, A A Hamidou13, K A Mohammed14, S M Ame15, D Rollinson16, J P Webster17,18.
Abstract
BACKGROUND: Human urogenital schistosomiasis caused by Schistosoma haematobium is widely distributed across Africa and is increasingly targeted for control and regional elimination. The development of new high-throughput, cost-effective molecular tools and approaches are needed to monitor and evaluate the impact of control programs on the parasite populations. Microsatellite loci are genetic markers that can be used to investigate how parasite populations change over time and in relation to external influences such as control interventions.Entities:
Mesh:
Year: 2015 PMID: 26329827 PMCID: PMC4557312 DOI: 10.1186/s13071-015-1044-6
Source DB: PubMed Journal: Parasit Vectors ISSN: 1756-3305 Impact factor: 3.876
Details of the 18 selected microsatellite loci and the characteristics of the two multiplex microsatellite PCR assays. Loci Sh1-15 are from Travis et al., 2013 and Loci C102, C111 and C131 are from Gower et al., 2011. For Niger Ho = 0.596, He = 0.609, for Pemba Ho = 0.599, He = 0.638. The overall Ho = 0.597, He = 0.623
| Panel 1 | Marker | Forward Primer 5'- 3' | Reverse Primer 5'- 3' | Dye | Size Range (bp) | Repeat | A | Niger | Zanzibar | ||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
| ||||||||
| Panel 1 | C102 | TGTCTCTGTGAATGACCGAAT | TTAGATGAATAATAATGTTGAAACCAC | VIC | 184–199 | ATT | 6 | 0.42 | 0.37 | 0.02 | 0.02 |
| Sh1 | GCATCCAATTTCGTACAC | CCACATTAGGCCAACAAG | VIC | 245–284 | AAT | 13 | 0.76 | 0.72 | 0.84 | 0.80 | |
| Sh14 | GTCCTCCTTCCCTCTTTG | CACATTCGTCCTAGATATCG | NED | 184–240 | ACTC | 15 | 0.94 | 0.85 | 0.86 | 0.88 | |
| C131 | CTTGTCATTTGGGCATTGTG | CATGGTGAGGTTCAAACGTG | NED | 253–265 | AAT | 4 | 0.00 | 0.00 | 0.00 | 0.00 | |
| Sh6 | GGGATGTATGCAGACTTG | TTGTTTGGCTGCAGTAAC | NED | 309–321 | AAT | 7 | 0.48 | 0.44 | 0.84 | 0.76 | |
| Sh9 | GCTGAGCTTGAGATTG | CTTCTGTCCCATCGATACC | 6-FAM | 197–227 | AAT | 11 | 0.46 | 0.76 | 0.46 | 0.86 | |
| Sh3 | GCTGAGCTTGAGATTG | CTTCTGTCCCATCGATACC | 6-FAM | 270–366 | AAT | 30 | 0.76 | 0.86 | 0.94 | 0.86 | |
| C111 | CCCTTGTCTTCAATGCGTTA | GAACGTCTAACTGGCGATCA | PET | 201–225 | ATT | 9 | 0.74 | 0.67 | 0.76 | 0.68 | |
| Sh7 | TCCAAGCACCATTATCAAG | ACGGAAACTTGTTGAAATG | PET | 293–311 | AAT | 7 | 0.46 | 0.62 | 0.42 | 0.48 | |
| Panel 2 | Sh2 | TTAGTGTGTTTGGCTTCAAC | CCTCGAATGAAATCCTGAC | NED | 155–218 | AAT | 21 | 0.84 | 0.90 | 0.56 | 0.89 |
| Sh5 | TGTGCACAAGAAAGATTAAATG | ACGACAATGTTGCAAGTTC | NED | 263–314 | AAT | 16 | 0.78 | 0.81 | 0.36 | 0.48 | |
| Sh13 | GAGCAGCTATTTCGTATCG | ACCGTGGACAGTTCATCAG | 6-FAM | 163–211 | AAT | 17 | 0.78 | 0.72 | 0.68 | 0.64 | |
| Sh4 | CCCATCGCTGATATTAAAG | TCTAGTCGTCTTGGGATCC | 6-FAM | 268–313 | AAT | 13 | 0.84 | 0.78 | 0.72 | 0.79 | |
| Sh10 | CGCATGTCATACCTATCTCC | GCTTATCAGGCCTATCTCC | PET | 183–207 | AAT | 9 | 0.18 | 0.34 | 0.74 | 0.70 | |
| Sh12 | CGTCTTAGTGAGCCAGATG | CTCGTGGACATCATCAG | PET | 245–278 | AAC | 11 | 0.06 | 0.06 | 0.56 | 0.65 | |
| Sh8 | CTAAACTGGCAAGATTTC | CAACGTGCCTTTATTTC | PET | 282–321 | AAT | 14 | 0.76 | 0.81 | 0.84 | 0.83 | |
| Sh11 | TTGGTTTAGAAATTACATCACC | CCAACAATATTAATGGACAGC | VIC | 183–213 | ATC | 9 | 0.68 | 0.58 | 0.68 | 0.69 | |
| Sh15 | CTTTCAGTAGGATTTGTTG | CGACGTCAAGCACTGTAC | VIC | 274–301 | ATC | 10 | 0.78 | 0.65 | 0.50 | 0.466 | |
Panel = single mulitplex PCR. A = observed number of alleles. Dye = the fluorescent dye label of the forward primer (VIC = green, NED = yellow, 6-FAM = Blue, PET = red). Ho = observed heterozygosity, He = expected heterozygosity
Cross reactivity of the two multiplex microsatellite PCR assays on S. mansoni
| Marker | Size Range (bp) | |
|---|---|---|
| Panel 1 | C102 | allelic drop-out |
| Sh1 | 245–284 | |
| Sh14 | low amplification | |
| C131 | low amplification | |
| Sh6 | 309–321 | |
| Sh9 | low amplification | |
| Sh3 | allelic drop-out | |
| C111 | allelic drop-out | |
| Sh7 | allelic drop-out | |
| Panel 2 | Sh2 | allelic drop-out |
| Sh5 | low amplification | |
| Sh13 | allelic drop-out | |
| Sh4 | 254 | |
| Sh10 | 168 | |
| Sh12 | 242–272 | |
| Sh8 | allelic drop-out | |
| Sh11 | allelic drop-out | |
| Sh15 | allelic drop-out |