Lan Zhao1, Eduardo Oliver1, Klio Maratou2, Santosh S Atanur2, Olivier D Dubois1, Emanuele Cotroneo1, Chien-Nien Chen1, Lei Wang1, Cristina Arce1, Pauline L Chabosseau2, Joan Ponsa-Cobas3, Maria G Frid4, Benjamin Moyon5, Zoe Webster5, Almaz Aldashev6, Jorge Ferrer3, Guy A Rutter7, Kurt R Stenmark4, Timothy J Aitman2, Martin R Wilkins1. 1. Centre for Pharmacology and Therapeutics, Division of Experimental Medicine, Imperial College London, Hammersmith Hospital, London W12 0NN, UK. 2. Physiological Genomics and Medicine Group, Medical Research Council Clinical Sciences Centre, Hammersmith Hospital, London W12 0NN, UK. 3. Section of Epigenomics and Disease, Department of Medicine, Faculty of Medicine, Imperial College London, Hammersmith Hospital, London W12 0NN, UK. 4. Department of Pediatrics and Medicine, Division of Critical Care Medicine and Cardiovascular Pulmonary Research Laboratories, University of Colorado Denver, Denver, Colorado 80045, USA. 5. Transgenics and Embryonic Stem Cell Laboratory, Medical Research Council Clinical Sciences Centre, Hammersmith Hospital, London W12 0NN, UK. 6. Institute of Molecular Biology and Medicine, 3 Togolok Moldo Street, Bishkek 720040, Kyrgyzstan. 7. Section of Cell Biology and Functional Genomics, Division of Diabetes, Endocrinology and Metabolism, Imperial College London, Hammersmith Hospital, London W12 0NN, UK.
Abstract
The typical response of the adult mammalian pulmonary circulation to a low oxygen environment is vasoconstriction and structural remodelling of pulmonary arterioles, leading to chronic elevation of pulmonary artery pressure (pulmonary hypertension) and right ventricular hypertrophy. Some mammals, however, exhibit genetic resistance to hypoxia-induced pulmonary hypertension. We used a congenic breeding program and comparative genomics to exploit this variation in the rat and identified the gene Slc39a12 as a major regulator of hypoxia-induced pulmonary vascular remodelling. Slc39a12 encodes the zinc transporter ZIP12. Here we report that ZIP12 expression is increased in many cell types, including endothelial, smooth muscle and interstitial cells, in the remodelled pulmonary arterioles of rats, cows and humans susceptible to hypoxia-induced pulmonary hypertension. We show that ZIP12 expression in pulmonary vascular smooth muscle cells is hypoxia dependent and that targeted inhibition of ZIP12 inhibits the rise in intracellular labile zinc in hypoxia-exposed pulmonary vascular smooth muscle cells and their proliferation in culture. We demonstrate that genetic disruption of ZIP12 expression attenuates the development of pulmonary hypertension in rats housed in a hypoxic atmosphere. This new and unexpected insight into the fundamental role of a zinc transporter in mammalian pulmonary vascular homeostasis suggests a new drug target for the pharmacological management of pulmonary hypertension.
The typical response of the adult mammalian pulmonary circulation to a low oxygen environment is vasoconstriction and structural remodelling of pulmonary arterioles, leading to chronic elevation of pulmonary artery pressure (pulmonary hypertension) and right ventricular hypertrophy. Some mammals, however, exhibit genetic resistance to hypoxia-induced pulmonary hypertension. We used a congenic breeding program and comparative genomics to exploit this variation in the rat and identified the gene Slc39a12 as a major regulator of hypoxia-induced pulmonary vascular remodelling. Slc39a12 encodes the zinc transporter ZIP12. Here we report that ZIP12 expression is increased in many cell types, including endothelial, smooth muscle and interstitial cells, in the remodelled pulmonary arterioles of rats, cows and humans susceptible to hypoxia-induced pulmonary hypertension. We show that ZIP12 expression in pulmonary vascular smooth muscle cells is hypoxia dependent and that targeted inhibition of ZIP12 inhibits the rise in intracellular labile zinc in hypoxia-exposed pulmonary vascular smooth muscle cells and their proliferation in culture. We demonstrate that genetic disruption of ZIP12 expression attenuates the development of pulmonary hypertension in rats housed in a hypoxic atmosphere. This new and unexpected insight into the fundamental role of a zinc transporter in mammalian pulmonary vascular homeostasis suggests a new drug target for the pharmacological management of pulmonary hypertension.
We have reported previously that the Fisher 344 (F344) rat strain is resistant to hypoxia-induced pulmonary hypertension compared to the Wistar Kyoto (WKY) strain[2]. Linkage analysis of a F2 population derived from inbred WKY × F344 rats identified a quantitative trait locus (QTL) on chromosome 17[2]. Based on this observation, we next conducted ten successive microsatellite-guided backcrosses of offspring with WKY rats and derived two congenic strains in which the original QTL was dissected and represented as partially overlapping regions of a donor F344 genome interposed onto the genetic background of the WKY recipient strain (Extended Data Fig. 1, 2). Resistance to hypoxia-induced pulmonary hypertension was detected in one of the congenic strains (R47A, Fig. 1a-d, Extended Data Fig. 2). Three subcongenic strains (SubA, SubB and SubC) were derived by further backcrosses of R47A onto the WKY background and the congenic interval was fine-mapped to a region of 8.28 Mbp containing an estimated 65 genes (rat chr17: 85,072,475-93,347,784) (Fig. 1 and Extended Data Fig. 2a). Whole genome sequencing (>20X coverage) of the WKY and F344 parental strains[4] revealed 13 non-synonymous coding SNPs affecting 9 genes within the refined congenic interval, and 6 indels resulting in frameshift mutations in 4 genes (Extended Data Table 1). Polymorphic examination of the 13 SNPs and 6 indels in 2 additional rat strains susceptible to hypoxia-induced pulmonary hypertension (the spontaneously hypertensive and fawn-hooded rat strains, respectively) excluded 5 SNPs and 5 indels and narrowed the genes of interest to 7 (Slc39a12, St8sia6, Cubn, Nmt2, Dclre1c, Hspa14 and Cdnf,
Fig. 1e and Extended Data Table1). Further polyphen analysis allowed us to exclude 5 listed genes (St8sia6, Cubn, Nmt2, Dclre1c and Cdnf) as the non-synonymous coding changes were predicted to be benign. We identified Slc39a12, with a loss of thymidine at position 88,575,534 leading to a frameshift mutation in exon 11, as the highest priority candidate gene for further investigation.
Extended Data Figure 1
Generation of congenic and sub-congenic strains
Congenic rat lines were produced by introgression of the F344 chromosome 17 QTL segment onto the WKY genetic background by repeated backcrossing. Congenic rat strain R47A (WKY.F344-D17Got91/D17Rat51) contains 15Mbp from the F344 donor region that maps to the distal end of the QTL on a WKY background. Three sub-congenic strains, SubA (WKY.F344-D17Got91/D17Rat47), SubB (WKY.F344-D17Rat47/D17Rat51) and SubC (WKY.F344-D17Rat131/D17Rat51), were produced containing separate fragments of the R47A donor region by backcrossing of (R47A × WKY) F1 with WKY parental rats. Three recombination events within the R47A congenic interval break the congenic interval into three smaller and overlapping sub-congenic intervals (Figure 1, main text).
Extended Data Figure 2
Dissection of QTL and Cardiovascular phenotype of rat strains
a. The hypoxia-resistant F344 phenotype tracks with the congenic R47A line. Rats were kept in 10%O2 for 2 weeks and right ventricular hypertrophy (RV/LV+Sep) was significantly attenuated in the congenic R47A strain (0.32±0.03, n=13, **P<0.01) compared to WKY rats (0.37±0.03, n=15), whereas congenic R42 rats (0.36±0.03, n = 17) were similar (NS) to WKY rats. b. An illustrative genetic map showing the relationship of the congenic strains (R42, R47A), subcongenic strains (SubA, SubB, SubC) and Slc39a12 to the original QTL (defined by a LOD score >3; Zhao et al Circulation 2001,103, 442-447) on a physical map of chromosome 17 (using Rat Genome Assembly v5.0). In normoxia, WKY, F344, R47A, SubA, SubB and SubC rats show no significant differences in c. mean pulmonary artery pressure (mPAP), d. right ventricular hypertrophy (RV/LV+Septum ratio) and e. vascular muscularisation (n=8 each group); f. Systemic blood pressure (SBP) is similar in all strains in both normoxia and hypoxic conditions. g. F344, R47A and SubB rats exhibit attenuated pulmonary vascular remodelling after 2 weeks exposure to a 10% O2 atmosphere compared to WKY, SubA and SubC rats (n=6 each group). Values are expressed as the mean ± standard error of the mean (SEM). *P<0.05, **P<0.01, ***P<0.001 compared to WKY (% of fully muscularised and partially muscularised vessels); ##P<0.01, ###P<0.001 compared to WKY (% of non-muscularised vessels) after One-Way ANOVA analysis followed by Bonferroni correction for multiple testing.
Figure 1
The pulmonary vascular response to hypoxia in the F344 rat is influenced by a region of chromosome 17 containing Slc39a12
a. A genetic map of 3 sub-congenic strains (SubA, SubB and SubC) derived from the R47A congenic strain (originally derived from a WKYxF344 cross) backcrossed with the WKY parental strain. The refined congenic region (orange) of 8.28Mb containing 65 genes is within the SubB strain. b-d. SubB exhibits attenuated pulmonary hypertension after 2 weeks exposure to a 10% O2 atmosphere compared to WKY, SubA and SubC rats: b. mean pulmonary artery pressure (mPAP); c. right ventricular hypertrophy (RV/LV+Septum ratio) (n=17 WKY, 15 F344, 14 R47A, 8 SubA, 10 SubB, 10 SubC); d. vascular muscularisation (n=6 each group). Dotted line indicates mean measurements from all the rats in a normal oxygen atmosphere (21%O2; mPAP = 14.7±0.3 mmHg; RVH=0.270±0.004; % muscularization=34.2±0.36; for actual values in rat strains see Extended Data Fig. 3). Values are expressed as mean ± standard error of the mean (SEM). *P<0.05, **P<0.01, ***P<0.001 compared to WKY after one-way ANOVA analysis followed by Bonferroni correction for multiple testing. e. The genes of interest (Slc39a12, St8sia6, Cubn, Nmt2, Dclre1c, Hspa14 and Cdnf) identified within the SubB congenic interval. The frameshift mutation in Slc39a12 introduces a stop-codon, resulting in a truncated protein.
Extended Data Table 1
Frameshift and Non-Synonymous coding mutations in the refined congenic interval of F344 and the other hypoxia susceptible strains, WKY, spontaneously hypertensive (SHR) and fawn-hooded (FHH) rat strains.
Genotype code: 0 = Homozygous reference allele; 1 = Heterozygous; 2 = Homozygous alternate allele; 6 = Ambiguous. Green square = shared genotype between F344 and susceptible strains; Bold = candidate genes; Blue = most important polymorphism
Slc39a12 encodes the solute carrier 39 zinc transporter family (ZIP1 - 14) member 12 (ZIP12) and has high specificity for zinc[5]. The ZIP family tightly regulates cellular zinc homeostasis in numerous cell types by promoting zinc uptake from the extracellular space or release from intracellular compartments. The rat Slc39a12 gene contains 12 exons and the ZIP12 protein comprises 688 amino acids with a secondary structure comprising 8 transmembrane domains (TMD). In the F344 strain the frameshift mutation in Slc39a12 introduces a stop-codon predicting a C-terminal truncated ZIP12 protein of 553 amino acids (Extended Data Fig. 3a). This affects the conserved zinc transporting aqueous cavity between TMD IV to V, resulting in the loss of the metalloprotease motif (HEXPHE), which would be expected to lead to a reduction in zinc transport[6].
Extended Data Figure 3
Hypoxia-induced pulmonary vascular remodeling in parental strains
a. Upper panel sequence shows the WKY protein sequence (688aa) and lower panel shows the truncated F344 protein sequence (553aa). Stars (*) mark the mutated amino acids compared to WKY protein. Dotted line indicates the C-terminal truncated region in F344. The grey square highlights the metalloprotease motif. b. Prominent ZIP12 immunostaining is seen in remodelled pulmonary arterioles in the chronically hypoxic WKY rat alongside vessels with a double elastic lamina (stained with Van Gieson, EVG) but not F344 lungs exposed to hypoxia. (Red arrow: vessel with double elastic lamina; blue arrow: vessel with single elastic lamina)
A pathognomonic histological signature of chronic hypoxia-induced pulmonary hypertension is thickening of the pulmonary vascular media (due to hyperplasia and hypertrophy of smooth muscle cells) and the muscularisation of previously unmuscularised pulmonary arterioles[7]. We found that ZIP12 mRNA levels were very low and ZIP12 protein undetectable by immunohistochemistry in the pulmonary vasculature of adult WKY rats housed in a normal oxygen atmosphere, but WKY rats exposed to hypoxia showed markedly increased lung ZIP12 mRNA levels and pronounced ZIP12 expression in remodelled pulmonary arterioles (Fig. 2a-b and Extended Data Fig. 3b). ZIP12 expression was evident in vascular smooth muscle but also other cell types (endothelial and interstitial cells) known to contribute to structural changes seen in hypoxic lungs. In contrast, and consistent with a frameshift mutation in Slc39a12 predicting a C-terminal truncated protein, ZIP12 was undetectable with an antibody directed at the C-terminus of the protein in the lungs of chronically hypoxic F344 rats (Fig. 1b and Extended Data Fig. 3b).
Figure 2
Slc39a12 encodes a zinc transporter, ZIP12, which is up-regulated in pulmonary vascular tissue from mammals exposed to chronic hypoxia
a. ZIP12 mRNA levels in control and hypoxic WKY rat lungs (n=6 each group). b. Prominent ZIP12 immunostaining in remodelled pulmonary arterioles in WKY but not F344 rat lungs exposed to hypoxia. c. No ZIP12 staining was detected in pulmonary arteries of low altitude (normoxia control, CO calf) calves and sea-level humans, yet prominent ZIP12 immunostaining was observed in the remodelled pulmonary arteries of calves with severe pulmonary hypertension (Hx calf), in cattle naturally susceptible to pulmonary hypertension at altitude (“Brisket disease”, BD), as well as Kyrgyz highlanders residing above 2500m. d. Design of the luciferase reporter vector pGL4.10 containing a 5′ region of ZIP12 which includes a hypoxia response element (HRE) encoding for both HIF-1α and HIF-2α binding motifs or a mutant HRE sequence where the 5′-ACGTG-3′ motif has been replaced by 5′-AGCAG-3′(mHRE). e. Human pulmonary artery smooth muscle cells (HPASMCs) transfected with the ZIP12 HRE reporter vector demonstrated a significantly increased luciferase activity after exposure to hypoxia, but not in the cells transfected with the mutant HRE vector (n=6 per group). f. Increased levels of HIF-1α and HIF-2α bound to the ZIP12 HRE assayed by ChIP-qPCR of chromatin from HPASMCs cultured in normoxia and hypoxic conditions (n=3 per group). Data are calculated as percentage of input levels, with the dotted line marking percentages below mock immunoprecipitation (IP). Values are expressed as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 compared to normoxic control after One-Way ANOVA analysis followed by Bonferroni correction for multiple testing. NS, not significant.
Slc39a12 is highly conserved across species[8] and transcribed constitutively in many tissues (www/biogps.org). To investigate the relevance of our observations in rats to other susceptible animal species, as well as humans, we examined ZIP12 expression in whole lung samples of 1) neonatal calves housed in a normal atmosphere or exposed to hypobaric hypoxia for two weeks (barometric pressure, PB = 445mmHg, equivalent to 4500m altitude, 12% O2), 2) older (yearling) cattle with naturally occurring pulmonary hypertension (so-called “Brisket disease”) developed as a result of prolonged pasturing at high altitude (2,438 to 3,505m), and 3) human subjects at sea level and Kyrgyz highlanders residing above 2500m. ZIP12 expression, which is undetectable by immunohistochemistry in healthy bovine and human lung exposed to a normal oxygen atmosphere (Fig. 2c), is clearly visible in the remodelled pulmonary vessels from chronic hypoxia exposure, indicating that ZIP12 up-regulation in pulmonary vasculature is a common response to hypoxia (Fig. 2c).To better understand the regulation of ZIP12 by hypoxia, we exposed human pulmonary vascular smooth muscle cells in culture to hypoxia (2%O2). Increased HIF protein and ZIP12 gene expression was observed in hypoxic cells; mRNA levels of other zinc transporters, ZIP6, ZIP7, ZIP10 and ZnT8, were unchanged (Extended Data Fig. 4a-b). Further examination of the Slc39a12 gene using HOMER analysis[9] revealed a hypoxia response element (HRE) encoding both HIF-1α and HIF-2α binding motifs (Fig. 2d) at 1kb downstream of the ZIP12 transcription start site (human (hg19) chr10: 18,241,879-18,241,887). We cloned a 1.5kb fragment of the 5′ region of ZIP12 containing this HRE into the luciferase reporter vector, pGL4.10 (Fig. 2d). Human pulmonary vascular smooth muscle cells transfected with the ZIP12 HRE reporter vector demonstrated significantly increased luciferase activity after exposure to hypoxia, while the luciferase activity of cells transfected with the mutant HRE vector (a substitution of the 5′-ACGTG-3′ motif by 5′- AGCAG-3′; Fig. 2d) remained at basal normoxia levels (Fig. 2e). Chromatin immunoprecipitation (ChIP) followed by real time PCR confirmed the enrichment of both HIF-1α and HIF-2α binding to this ZIP12 HRE after hypoxia exposure (Fig. 2f).
Extended Data Figure 4
ZIP12 upregulation in response to hypoxia exposure and measurements of intracellular labile zinc concentration and proliferation of human pulmonary artery smooth muscle cells (HPASMCs) in normoxia conditions
a. Upregulation of ZIP12 in HPASMCs exposed to hypoxia, in contrast to other zinc transporters (n=6). b. Representative western blots demonstrating increased HIF-2α expression in HPASMCs after 24h hypoxia exposure. c. Confocal laser scanning images of HPASMC transfected with eCALWY-4 probe. Intracellular free zinc was not affected by transfection with ZIP12 siRNA in normoxia. d. Representative traces showing the changes in fluorescence ratio usng the eCALWY-4 probe. e. Quantification of intracellular zinc levels (n=10). f. ZIP12 siRNA did not affect proliferation of HPASMCs in normoxic conditions (n=5).
We then explored the contribution of ZIP12 to the regulation of intracellular zinc levels in human pulmonary vascular smooth muscle cells. Intracellular labile zinc measured using a genetically-encoded fluorescence resonance energy transfer (FRET) based zinc probe, eCALWY-4[10], exhibited a striking increase in cells exposed to hypoxia for 48h, and this was markedly reduced by inhibiting ZIP12 expression with a targeted siRNA (Fig. 3a-e). Inhibition of ZIP12 expression with siRNA also inhibited hypoxia-induced pulmonary vascular smooth muscle cell proliferation (Fig. 3f). ZIP12 siRNA transfection did not affect intracellular zinc levels or proliferation in normoxia (Extended Data Fig. 4c-f). These data suggest that disrupted ZIP12 expression exerts a direct effect on pulmonary vascular cells in response to hypoxia and contributes to the resistant pulmonary hypertension phenotype exhibited in F344 strain.
Figure 3
ZIP12 knockdown inhibits hypoxia-induced increase in intracellular labile zinc concentration and proliferation of human pulmonary artery smooth muscle cells (HPASMCs)
a. Representative wide-field microscope images of HPASMC transfected with eCALWY-4 probe. Hypoxia exposure produced a striking increase in intracellular free zinc (resulting in decreased FRET)[10]. This was inhibited by transfection with ZIP12 siRNA. TPEN-mediated Zn2+ chelation was used to derive maximum fluorescence and 100 μM ZnCl2 in the presence of the Zn2+ ionophore and pyrithione (ZnPyr) was used to derive the minimum fluorescence. b. Representative traces showing the changes in fluorescence ratio of the eCALWY-4 probe. Steady-state fluorescence intensity ratio citrine/cerulean (R) was measured, then maximum and minimum ratios were determined to calculate free Zn2+ concentration using the formula: [Zn2+] = Kd×(Rmax-R)/(R-Rmin), where the Kd for eCALWY-4 is 630 pM, the maximum ratio (Rmax) was obtained upon intracellular zinc chelation with 50 μM TPEN and the minimum ratio (Rmin) was obtain upon zinc saturation with 100 μM ZnCl2 in the presence of the Zn2+ ionophore, pyrithione (5 μM)[10]. c. Quantification of intracellular zinc levels (n=10 each group). d. Chronic hypoxia (48h) increases ZIP12 mRNA levels in HPASMCs, which is inhibited by Slc39a12 siRNA (n=5 each group). e. Representative immunoblot of ZIP12 demonstrating inhibition of hypoxia-stimulated ZIP12 protein expression by Slc39a12 siRNA in HPASMCs (n=3). f. ZIP12 siRNA inhibits hypoxia-induced proliferation in HPASMCs (n=5 each group). *P<0.05, ***P<0.001 compared to control group, #P<0.05 compared to hypoxia group. Scr, scramble siRNA control.
To provide direct genetic confirmation that disrupted ZIP12 expression attenuates the pulmonary vascular response to hypoxia we employed zinc finger nuclease technology[11] to introduce mutations in Slc39a12 in the hypoxia-susceptible WKY rat strain. A mutant line was generated containing a frame-shift resulting in a truncated ZIP12 protein with loss-of-function (Extended Data Fig. 5). Inter-cross of heterozygous animals generated homozygous (ZIP12−/−), heterozygous (ZIP12+/−) and wild-type rats that were then exposed to hypoxia (10%O2) for 2 weeks. ZIP12−/− rats demonstrated lower pulmonary artery pressures, right ventricular hypertrophy and vascular remodelling than wild-type rats (Fig. 4a-c; Extended Data Fig. 6a-d) with ZIP12+/− rats exhibiting an intermediate phenotype. Wild-type rats resembled WKY rats after exposure to hypoxia showing markedly increased lung ZIP12 expression in the remodelled pulmonary arterioles, in contrast to the absence of expression in ZIP12−/− rats (Fig. 4d-e). Comparison of the ZIP12−/− response to hypoxia with the WKY and F344 parental strains reveals that mutation of Slc39a12 is responsible for about 50% of the resistance observed in the F344 strain, highlighting the importance of Slc39a12 as a hypoxia-susceptibility gene but also suggesting that other genes yet to be identified may also contribute.
Extended Data Figure 5
Design of specific Slc39a12 ZFN and confirmation of mutant line
a. CompoZr™ Custom Zinc Finger Nucleases (Sigma-Aldrich) for the rat Slc39a12 gene were designed to target exon 8 (a; Sigma-Aldrich). b-d. Cel-I surveyor assay and gene sequencing confirmed NHEJ-induced mutations in at least one pup (mutant 77). e. The 4bp (AGTT) deletion followed by 2bp insertion (TA) into mutant 77 caused a frame-shift in coding, introducing a stop codon leading to a truncated protein. Red star refers to stop codon. c. We subsequently genotyped next generation litters using SwaI (cutting point: 5′-ATTTAAAT-3′), showing 100% digestion for homozygous pups (−/−), 50% for heterozygous (+/−) and no DNA digestion for wild type rats (+/+).
Figure 4
Genetic disruption of ZIP12 in WKY rat attenuates hypoxia-induced pulmonary hypertension
a-c. Zinc finger nucleases were used to disrupt ZIP12 in the WKY strain. Rats deficient in ZIP12 demonstrate allele dose-dependent attenuation of hypoxia-induced pulmonary hypertension compared to wild-type (WT) rats: a. mean pulmonary artery pressure (mPAP); b. right ventricular hypertrophy (RV/LV+Septum) (normoxia groups: n=10 WT, 8 ZIP12+/−, 12 ZIP12−/−; hypoxia groups: n=14 WT, 16 ZIP12+/−, 12 ZIP12−/−); c. pulmonary arteriole muscularisation (n=5 each group). ***p<0.001 compared to normoxia WT group, #p<0.05 compared to hypoxia WT group after one-way ANOVA analysis followed by Bonferroni correction for multiple testing. d. ZIP12 was undetectable by Western blot in hypoxic ZIP12−/− rats but increased in hypoxic wide-type (WKY) rats (n=3 each group). e. ZIP12 expression by immunohistochemistry of WT and ZIP12−/− rat lungs before and after hypoxia (2 weeks). f. ZIP12 expression in lungs from a chronic iron deficient rat, monocrotaline (MCT) rat and a patient with idiopathic pulmonary arterial hypertension (IPAH). g. Double immunofluorescence demonstrates co-localisation of ZIP12 and smooth muscle actin in the remodelled vessels from the IPAH patient.
a. Representative lung sections from wild-type (WT) and ZIP12 −/− rats 2 weeks after hypoxia exposure. Elastic van Gieson (EVG) staining showing double elastic lamina (red arrow) in WT but single elastic laminae (blue arrow) in ZIP12−/− rats. b. Genetic disruption of ZIP12 in WKY rat attenuated pulmonary vascular remodelling after 2 weeks exposure to a 10% O2 atmosphere compared to wild-type (WT) rats (n=5 each group). *P<0.01 compared to WT (% of fully muscularised vessels); ##P<0.01, ###P<0.001 compared to WT (% of non-muscularised vessels) after One-Way ANOVA analysis followed by Bonferroni’s multiple comparison test. c. Ki67 staining showing reduced proliferation in hypoxic ZIP12−/− rat lungs compared to the WT strain. *P<0.01 compared to WT. d. Representative sections from hypoxic WT and ZIP12−/− rats lungs showing differences in staining with the proliferation marker, Ki67. e-g. Genetic disruption of ZIP12 in WKY rat did not influence e. systemic blood pressure (SBP) or f. cardiac output (CO) but attenuated hypoxia-induced increases in g. pulmonary vascular resistance (n=7 each group). Values are expressed as the mean ± standard error of the mean (SEM). *P<0.05, **P<0.01 compared to normoxic rats, #p<0.05 compared to wild-type (WT) hypoxic rats after One-Way ANOVA analysis followed by Bonferroni correction for multiple testing. h. ZIP12 targeted siRNA inhibition attenuates stress fibre formation in human pulmonary vascular smooth muscle cells (HPASMCs) in hypoxia (n=5 each group). **p<0.01 compared to normoxia control group, #p<0.05 compared to hypoxia control group. i. Representative pictures of actin stress fibre in HPASMCs. j. ex vivo angiogenesis studies demonstrated that vascular outgrowth from ZIP12−/− pulmonary vessels in response to hypoxia was attenuated compared to vessels from wild-type (WT) rats (n=12 each group, 2 rings/rat, 6 ZIP12 −/− and 6 WT rats). *P<0.05 compared to normoxia WT group; #P<0.05, ## P<0.01 and ### P<0.001 compared to hypoxia ZIP12−/− group. k. Representative pictures of pulmonary arteriole ring outgrowth at day 6.
Systemic blood pressure and cardiac output in the hypoxic ZIP12−/− rats was similar to that of wild-type rats (Extended Data Fig. 6e-g) signifying that the reduced pulmonary artery pressures in the ZIP12−/− rat in chronic hypoxia is due to reduced pulmonary vascular resistance (PVR; mean pulmonary artery pressure = PVR × cardiac output). Both vascular tone and structural remodeling contribute to PVR, and increased pulmonary vascular tone preceeds the structural changes. ZIP12 expression may increase PVR by increasing pulmonary vascular tone. Zinc-thiolate signaling has been reported to mediate the constriction of pulmonary microvascular endothelial cells in acute hypoxia through activation of protein kinase C and inhibition of myosin light chain phosphatase, inducing stress fibre formation and endothelial cell contraction[12]. We have shown that ZIP12 targeted siRNA attenuates stress fibre formation in human pulmonary vascular smooth muscle cells cultured in hypoxia (Extended Data Fig. 6h-f). But given the time-dependent induction of ZIP12 expression in pulmonary vasculature by hypoxia, the main contribution of ZIP12 is likely to be in regulating the response to chronic rather than acute hypoxia. In further support of a direct effect on structural remodelling of pulmonary arterioles, we investigated angiogenesis ex vivo using pulmonary arteriole rings dissected from ZIP12−/− and wild-type rats. Vascular outgrowth from ZIP12−/− vessels in response to hypoxia was attenuated compared to vessels from wild-type rats (Extended Data Fig. 6j-k).The underlying mechanisms through which ZIP12 affects hypoxic responses remain to be defined. Excess intracellular zinc concentrations mediated by upregulation of ZIP family members have been observed in a variety of tumour tissues and linked to cell proliferation and survival[13-15]. Zinc is a structural component of a large variety of intracellular proteins, including enzymes and transcription factors. Zinc binding motifs have been identified in drug targets for pulmonary hypertension, for example, phosphodiesterase type 5 (PDE5) and histone deacetylases[16,17]. Reduced ZIP12 expression and intracellular labile zinc levels would be expected to inhibit PDE5 activity[18], and we have previously shown that PDE5 inhibition attenuated pulmonary vascular smooth muscle proliferation in culture[19].Following on from our demonstration that ZIP12 is hypoxia-inducible and a key regulator of the pulmonary vascular response to chronic alveolar hypoxia exposure, we examined lung ZIP12 expression in other presentations of pulmonary hypertension where tissue hypoxia is an important driver of pathology. Again, in contrast to healthy lungs, ZIP12 expression was clearly evident in lung tissues from chronic iron deficient rats[20] and rats exposed to monocrotaline, as well as patients with idiopathic pulmonary arterial hypertension (IPAH) [21] (Fig. 4f), prominent in the remodeled pulmonary vasculature as identified by co-staining with smooth muscle actin (Fig. 4g). HIF-activation in these tissues was confirmed by upregulation of carbonic anhydrase IX, a recognized HIF-regulated biochemical signature of tissue hypoxia[22] (Extended Data Fig. 7). Interestingly, the F344 rat strain has previously been reported to exhibit some resistance to monocrotaline-induced pulmonary hypertension [23]; this was recapitulated in the ZIP12−/− rat (Extended Data Fig. 8). These data signal a fundamental role for ZIP12 in the regulation of pulmonary vascular homeostasis in hypoxic stress, relevant to the pathogenesis of pulmonary hypertension beyond that associated with life in a low oxygen atmosphere. The current treatments for pulmonary hypertension centre on the pharmacological manipulation of signaling mechanisms used by vasoactive factors and have limited therapeutic benefit. Our observations open a new avenue of research into the therapeutic potential of ZIP12 inhibition and suppressed excursions of intracellular free zinc as a novel strategy for preventing or treating pulmonary hypertension.
Extended Data Figure 7
Carbonic anhydrase (CAIX) expression
a. Representative sections demonstrating increased CAIX expression in remodelled pulmonary arterioles in the lungs of rats exposed to alveolar hypoxia (2 weeks), monocrotaline (MCT, 3 weeks) or a chronic iron deficient diet (4 weeks). b-c. No CAIX staining was detected in pulmonary arteries of low altitude (normoxia control, CO calf) calves and sea level humans, but prominent CAIX immunostaining was observed in the remodelled pulmonary arteries of calves with severe pulmonary hypertension (Hx calf), in cattle with naturally occurring pulmonary hypertension (“Brisket disease”, BD) as well as patients with idiopathic pulmonary arterial hypertension (IPAH).
Extended Data Figure 8
Genetic disruption of ZIP12 in WKY rat attenuated monocrotaline-induced pulmonary hypertension
a. Mean pulmonary artery pressure (mPAP), b. right ventricular hypertrophy (RV/LV+Septum) and c. pulmonary arteriole muscularisation. (n=5 each group). Values are expressed as the mean ± standard error of the mean (SEM). *P<0.05, **P<0.01 compared to wild-type (WT) monocrotaline group after unpaired Student t-test. d. Representative lung sections from wild-type (WT) and ZIP12 −/− rats 3 weeks after monocrotaline injection. Elastic van Gieson (EVG) staining showing double elastic lamina (red arrow) in WT but single elastic laminae (blue arrow) in ZIP12−/− rats.
Methods
Animals
Inbred Wistar-Kyoto (WKY, Charles River, UK) and Fischer 344 rats (F344, Harlan, UK) were used as original strains. Animals were maintained at a constant temperature (20°C to 22°C) with a 12-hour on/12-hour off light cycle, with food and water ad libitum. All experiments were conducted under the project licence PPL70/7425 in accordance with the UK Home Office Animals (Scientific Procedures) Act 1986 (London, UK). To ascertain the pulmonary artery pressure phenotype, male rats (WKY, F344, congenic and sub-congenic strains, ZIP12 transgenic rats) aged 10-12 weeks were studied in batches, with the parental WKY strain included as an internal control in each batch studied. Sample sizes were chosen on the basis of experience of pulmonary artery pressure variation in the parental strains. A sample size of at least n=5 per group was predicted to detect a difference in mean pulmonary arterial pressure ≥ 5mmHg (standard deviation = 3) with 95% power with 95% confidence. Additional animals were studied to obtain sufficient tissue for supportive analyses.
Generation of congenic and sub-congenic strains
To investigate the involvement of the chromosome 17 QTL in the pulmonary hypertension (PH) phenotype, we introgressed the F344 chromosome QTL segment into the WKY genetic background by repeated backcrossing[2]. We produced a congenic rat strain, R47A (WKY.F344-D17Got91/D17Rat51), which contains 15Mbp from the F344 donor region that maps to the distal end of the QTL on the WKY background.Subsequently, we generated 3 sub-congenic strains Sub-A (WKY.F344-D17Got91/D17Rat47), Sub-B (WKY.F344-D17Rat47/D17Rat51) and Sub-C (WKY.F344-D17Rat131/D17Rat51). These three recombination events divide the R47A congenic interval into three smaller and overlapping sub-congenic intervals (Extended Data Fig. 1).
Microsatellite genotyping of congenic rats
Congenic and sub-congenic rats were genotyped using simple sequence length polymorphism (SSLP) markers (Extended Data Table 2). In order to reduce the unknown regions between the markers, rats were also genotyped using primers specifically designed to amplify known regions containing insertions or deletions in one of the two parental strains (Extended Data Table 2). Genomic DNA was isolated from rat ear clippings using Hot Sodium Hydroxide and Tris (HotSHOT) extraction[24]. Forward primers were fluorescently labelled with 6-FAM. PCR products together with the fluorescent size marker (ROX 400HD, Applied Biosystems) were diluted in formamide and run on a 3730xl DNA Analyzer (Applied Biosystems). Results were analysed using GeneMapper v3.7 software (Applied Biosystems).
Extended Data Table 2
Polymorphism markers for congenic strain genotyping.
Rat chr 17
Genetic map
Primers
Expected size (bp)
Genotyping information
Marker
SHRSP × BN
Physical map possition
FORWARD
REVERSE
WKY
F344
R47A
Sub A
Sub B
Sub C
D17Rat41
38.27
80234337 - 80234511
CCTTTCCCTTTCCACTCTCC
GGTAAGGGTGGTGGCAGTAG
171
157
WW
WW
WW
WW
D17Rat44
40.89
81612362 - 81612488
CAGACAAAACCCCAGCATTT
AGCAGAAAGAACCAGGCAGA
133
121
WW
WW
WW
WW
D17Got91
82277435 - 82277611
CCAGACACCAACATCACACC
CCTTCATGTGTGGAGTGTTTATG
160
176
FF
FF
WW
WW
D17Rat43
40.89
82337230 - 82337376
CACTCACTTGCTGGCTGTCT
GAGAAGAAGCTGGAGAGGCA
150
124
FF
FF
WW
WW
D17Rat42
40.33
82505422-82505562
TGCCGCTATTAAAAAGTAACTGC
CCAAAGGCATAAAAATCTTTCC
141
121
FF
FF
WW
WW
D17Rat62
42.35
83479938 - 83480058
GAAAGGATGGCAGGTTTTTG
TCCACAGGCTCACTGTCACT
143
121
FF
FF
WW
WW
D17Rat46
42.33
83600152-83600282
TGGGTTCTTTCATTCCTTGC
GCTCACCCACACACACATTC
135
125
FF
FF
WW
WW
D17Rat47
43.34
85072353 - 85072475
CCCTGCTTTCTGCTTTGAAC
TGCATATACGAATTACAGCTCAA
114
126
FF
FF
FF
WW
Del85862103
85862060 - 85862261
CACCATGAGCTCAGCAGTGT
ACACCGTCTGGCTCTCTCAG
203
193
FF
WW
FF
WW
In85923365
85923262- 85923495
ACCTTTGGCTCGGTCCTATC
AAACTTGGGTACCAGCACCA
235
243
FF
WW
FF
WW
D17Got93
86032700 - 86032904
CACTACACCTCCCAACGTCC
CTGTTGTGCCTCCTGACTAATG
227
215
FF
WW
FF
WW
D17Mit8
45.19
87465135 - 87465345
GGTCGGCATTATGGCTAAGA
CTATAGCCTCTAGGGAGGGG
193
195
FF
WW
FF
WW
D17Rat60
45.19
88268817 - 88269054
GGGGTCCAGCACTTAGCAT
GTTTTGATCATGGGGACGTT
239
241
FF
WW
FF
WW
D17Rat48
45.19
88667790 - 88667952
CACATGTCTAACTTGCCACATACA
TTTGCTGTTTCTTGTTCATGTG
166
156
FF
WW
FF
WW
Del89391756
89391713 - 89391951
TCCATGTTTTATCACCGGAAG
ATCTGATGCATGCCATAGCC
230
238
FF
WW
FF
WW
In90455808
90455697 - 90455921
AAGTTAGCCTTCCCCAAGGA
TCTGGTCTTTCCCATGTTCC
233
225
FF
WW
FF
WW
D17Rat131
47.54
93347784 - 933447990
TTAAGAAGGGCAAGCAAGGA
TCCCCATAAAAAGAAAAGGAA
203
213
FF
WW
FF
FF
D17Rat51
47.54
96587775 - 96587905
TCCCACTGGTCAATCCATTT
ACATGCAGACAGAACATTCCT
144
148
FF
WW
FF
FF
Illumina Genome Sequencing Library preparations
Five micrograms of male WKY/Ncrl (two animals) and F344/Ncrl (one animal) rats were used to construct paired-end whole-genome libraries with 300-550 bp insert size. Genomic DNA was prepared by standard phenol chloroform extraction followed by treatment with DNAse free RNAse. DNA quality was assessed by spectrophotometry (260/280 and 260/230) and gel electrophoresis before library construction. Genomic DNA was sheared for 90 sec (Covaris S2, KBioscience, Herts, UK), using 10% duty cycle, 5 intensity and 200 cycles per burst. The shearing efficiency was assessed by Qubit 2.0 fluorometer measurements (Life Technologies Ltd, Paisley, UK) and gel electrophoresis. The library was prepared as recommended (Illumina Genomic DNA sample prep kit protocol) with 9 cycles of PCR amplification (Illumina Inc., Hayward, CA). Constructed libraries were assessed with an Agilent 2100 bioanalyser using a HS DNA assay (Agilent Technologies, Edinburgh, UK) and quantified using a KAPA Illumina SYBR Universal Lib QPCR kit (Anachem Ltd, Bedfordshire, UK). The resulting libraries were sequenced on an Illumina HiSeq2000 following the manufacturer’s instructions. Polymorphisms were confirmed by capillary sequencing.
Generation and genotyping of WKY.Slc39a12 (+/−) and (−/−) rats
CompoZr™ Custom Zinc Finger Nucleases targeting the rat Slc39a12 gene were designed and purchased from Sigma-Aldrich (Extended Data Fig. 3). Pronuclei from fertilized WKY oocytes were microinjected with ZFN mRNA (2 ng/μl). Three out of eleven pups were positive for Slc39a12 mutations, as revealed by Cel-I surveyor assay and gene sequencing[11]. One pup (mutant 77) hosted a stop codon 15 amino acids from the ZFN binding site, resulting in a truncated protein of 490 amino acids (54 KDa), 198 amino acids smaller than the wild type protein, and introduced a sequence coding for 5′-ATTTAAAT-3′, a binding site for the SwaI restriction enzyme. Mutant 77 was selected as a founder to mate with a WKY female. Pups were genotyped by amplifying DNA and digesting with SwaI. The primers used to amplify the region of interest were forward 5′-GCAATGGTTTTCCACAGTGA-3′ and reverse 5′-GCGCACTGAGGCTTTAAGAA-3′.
Pulmonary hypertension phenotyping
Pulmonary hypertension was induced by placing animals in a normobaric hypoxic chamber (FIO2 = 10%) for 2 weeks or by subcutaneous injection of monocrotaline (60 mg/kg; Sigma-Aldrich). All studies were performed using the same equipment and all haemodynamic measurements made by the same operator. At the end of each experimental period, animals were weighed and anesthetized (Hypnorm 1ml/kg i.m.; Mydazolam 0.8ml/kg i.p.). Pulmonary arterial pressure was measured with a pre-curved catheter inserted through the right jugular vein. Systemic blood pressure was assessed via carotid artery cannulation. Cardiac output was measured by thermodilution. Pulmonary vascular resistance (PVR) was calculated using the standard equation: PVR = mean pulmonary artery pressure / cardiac output. All data were recorded with a PowerLab Data Acquisition system (AD Instruments) and analysed using LabChart 7 software.The animals were then killed and the heart dissected and individual chamber weights recorded. The ratio of right ventricle to left ventricle plus the septum mass (RV/LV+sep) was calculated as RV hypertrophy index. Some collected tissues were snap frozen in liquid nitrogen and stored at −80°C for further biochemical measurements. The left lung was fixed by inflation with 10% formalin in phosphate-buffered saline, embedded in paraffin, sectioned for histology. Transverse rat lung sections were processed for elastic van Gieson (EVG) staining. Peripheral vessels <100 μm diameter were counted at x40 magnification objective and pulmonary vascular remodelling was expressed as the proportion of vessels with double elastic lamina (>75% of the circumference as fully muscularised, 25-75% as partially muscularised) to total vessels counted. Counting was performed twice by observers blinded to treatment.
Ex vivo angiogenesis assay of pulmonary arteriole
Angiogenesis assay of arterial rings was performed as previously described[25]. Pulmonary arterioles (1st and 2nd order) were dissected from rat lungs viewed under the microscope. One mm sections were placed in matrigel (50μl/well) in a 96-well plate, allowed to gel for 30mins at room temperature, then incubated for up to 6 days with endothelial cell culture medium MV2 with 5% foetal calf serum (PromoCell). On days 3, 4, 5 and 6, the length of the longest sprouts was measured under the microscope (4 × objective). On day 6 arteriole ring fluorescent images were taken by staining the tissue with calcein (Invitrogen) for 15 minutes at 37°C.
Anti-ZIP12 Antibody production
An antibody raised against the five last amino-acids at the C terminus (Ct) of both the human and the rat ZIP12 protein was produced in rabbits following previous methodology[26]. Rabbits were immunized with synthetic peptides conjugated to keyhole limpet hemocyanin ([CYS(KLH)]QNIKI). Peptide sequence was confirmed to be ZIP12 specific using RStudio. Immunized rabbit serum containing anti-ZIP12 antibody specificity was confirmed by immunoblotting with rat lung lysates or human pulmonary smooth muscle cells. A single band at about 70 kDa was visible in the immunoblots.
Lung Immunohistochemistry and Immunofluorescence
Human IPAH and control lung samples were obtained from the Imperial College pulmonary hypertension biorepository (ethics reference numbers: 01-210 & 2001/6003) where samples are deposited following informed patient consent. Anonymised Kyrgyz high-altitude lung samples were obtained from post-mortem lung following approval of the local ethics committee (reference 02-23/880).Lung sections were immunostained with rabbit anti-ZIP12 (1:1000), Ki67 (1:50; Thermo Scientific) and rabbit anti-CAIX (1:100) antibodies. For immunohistochemistry, horseradish peroxidase conjugated secondary anti-rabbit antibody (1:200) was used. Double immunofluorescence with anti-αSMA (1:100) was performed using fluorescence secondary antibodies, anti-mouse Alexa 488 and anti-rabbit Alexa 568 (1:2000, Invitrogen). Images (green for ZIP12 and red for αSMA) were detected under Leica confocal microscope (TCS SP2 AOBS).
Human pulmonary artery smooth muscle cell culture
Human pulmonary artery smooth muscle cells (HPASMCs) from PromoCell and Lonza were grown in Human Smooth Muscle Cell Growth Medium 2 (PromoCell). The cells were cultured under normal oxygen tension (20% O2, 5% CO2) or exposed to hypoxia (2% O2, 5% CO2, 92% N2) for 48-72hr. A Bromodeoxyuridine (BrdU) cell proliferation assay (Millipore) was used to assess cell proliferation following manufacturer’s conditions.
ZIP12 siRNA transfection
Cells were transfected overnight with 50pmol siRNA against ZIP12 (s8397, Ambion), or negative siRNA (4390844, Ambion) as a control, using Lipofectamine RNAiMAX (Invitrogen Life Technologies) according to manufacturer’s conditions.
Quantification of actin fibre formation
Cells were cultured on plastic coverslips (Nunc), transfected with scramble or ZIP12 siRNA and exposed to hypoxia as described previously. After 48h exposure, cells were fixed with 4% formaldehyde solution in phosphate buffered saline (PBS) for 10 minutes at room temperature. Cells were then incubated with Alexa 568-conjugated phalloidin (1/200; Invitrogen) for F-actin detection under confocal microscopy. Sequential XYZ-sections (approximately 12 section of 1μm2 / view) were obtained and 3D images were reconstructed. Quantification of actin stress fibres was determined by volume rendering in Image-J. Actin volume per cell was expressed as fold increase from normoxic control (value set at 1).
Quantification of zinc concentration by FRET measurement
Cells on coverslips were washed twice in Krebs-HEPES-bicarbonate (KHB) buffer (140mM NaCl, 3.6mM KCl, 0.5mM NaH2PO4, 0.2mM MgSO4, 1.5mM CaCl2, 10mM Hepes, 25mM NaHCO3), which was warmed, bubbled with 95% O2: 5% CO2, set to pH 7.4, and contained 3mM glucose. Imaging of zinc using eCALWY sensors was carried out as optimized before[10,27]. Briefly, cells were maintained at 37°C throughout with a heating stage (MC60, LINKAM, Scientific Instruments), and KHB buffer was perfused (1.5 to 2ml/minute) with additions as stated in the Figures. Images were captured at 433 nm monochromatic excitation wavelength (Polychrome IV, Till photonics) using an Olympus IX-70 wide-field microscope with a 40x/1.35NA oil immersion objective and a zyla sCMOS camera (Andor Technology) controlled by Micromanager software[28]. Acquisition rate was 20 images/minute. Emitted light was split and filtered by a Dual-View beam splitter (Photometrics) equipped with a 505dcxn dichroic mirror and two emission filters (Chroma Technology - D470/24 for cerulean and D535/30 for citrine).Image analysis was performed with ImageJ software[29] using a home-made macro and the fluorescence emission ratios were derived after subtracting background. Steady-state fluorescence intensity ratio citrine/cerulean (R) was measured, then maximum and minimum ratios were determined to calculate free Zn2+ concentration using the following formula: [Zn2+] = K×(R-R)/(R-R). The maximum ratio (Rmax) was obtained upon intracellular zinc chelation with 50 μM TPEN and the minimum ratio (Rmin) was obtain upon zinc saturation with 100 μM ZnCl2 in the presence of the Zn2+ ionophore, pyrithione (5 μM)[10].
HIF-motif analysis and cloning
HOMER[9] was used to scan for HIF-1α and HIF-2α recognition motifs in the region 2kb upstream and 1.5 kb down-stream of the ZIP12 transcription start site. Results with a HOMER score < 6.5 were discarded. A 5′ region of ZIP12 gene containing these motif (HRE) (human (hg19) chr10:18,240,587-18,242,100) was cloned into the multicloning site of pGL4.10, which encodes the luciferase reporter gene luc2, by Gibson Assembly (NEB, E2611S). Three nucleotide substitutions in the core of the predicted HIF1/2α binding site motif were created by site-mutagenic PCR to produce a disabling mutant (Figure 2 d).
Transfection and luciferase assay
HPASMCs were seeded in 24 well plates at 70-80% confluence. Cells were transfected with 300ng of each plasmid together with 2ng of Renilla plasmid using Lipofectamine® 2000 (Life Technologies), exposed to hypoxia and lysed according to the manufacturer’s conditions. Luciferase activity was measured using Dual-Luciferase® Reporter Assay Chemistry (Promega) as previously described[30]. Experiments were repeated in two cells lines, n=6 per line.
Chromatin immunoprecipitation and PCR
Specific protein-DNA interactions were examined by chromatin immunoprecipitation (ChIP) followed by quantitive PCR (Chromatin immunoprecipitation Assay Kit, Millipore). Protein-DNA crosslinks were achieved by fixation with 1% formaldehyde for 10 minutes at room temperature. DNA-protein complexes from 2×106 cells were sheared to lengths between 200 and 500 base-pairs by sonicator (Bioruptor). The precleared fragments were incubated with 10 μg of HIF-1α or HIF-2α specific antibody (Novus Biologicals), or without antibody (as a negative control) overnight, followed by immunoprecipitation by Protein A Agarose/Salmon Sperm DNA (50% Slurry). The crosslinks were reversed by heating at 65°C overnight, followed by Proteinase K digestion at 45°C for 2 hours. DNA was then recovered with QIAquick PCR purification kit (Qiagen) for quantitative PCR to prove affinity against ZIP12 promoter region (Figure 2d). Experiments were conducted in two separate cell lines (n=3 each) and gave the same result.Quantitative PCR was performed as previously described in the methodology, using 1ul of DNA sample, and using the forward primer 5-TTTCCCAACCTGGGTCCTAT-3 and the reverse primer 5-AGCAGCCAAAAAGCTTGCTA-3. Ct values were normalized compared to the values detected in the starting non-inmunoprecipitated DNA sample (input). Protein-DNA affinity was confirmed when normalized Ct values were above the basal levels measured in the negative control.
Quantitative real time RT-PCR
RNA was extracted from lungs using RNeasy Mini Kit (Qiagen). PCR was performed with an ABI 7500 Sequence Detection System (Applied Biosystems). Quantitative PCR was performed using a two-step protocol starting with cDNA synthesis using the ImProm-II™ Reverse Transcription System (Promega), followed by PCR using the Power SYBR Green PCR Master Mix (Applied Biosystems). A total of 100ng of cDNA per sample was used. All samples were amplified using biological triplicates with two technical replicates per sample. The 7500 Sequence Detection System software (Applied Biosystems) was used to obtain CT values. Results were analysed using the comparative CT method[31]. Samples were normalized to a reference gene, Ubc (for rat samples) or Cyclophilin (for human cell samples), to account for cDNA loading differences.
Western blot
Frozen rat tissues (lungs) and cell pellets were homogenized in RIPA buffer (50mM tris-HCl, pH 8.0, 150mM sodium chloride, 1.0% Igepal, 0.5% sodium deokycholate, 0.1% sodium dodecyl sulphate) (Sigma) supplemented with protease inhibitor (Roche). Western blotting was performed using Mini-PROTEAN® TGX™ Precast Gels (Bio-rad) following the manufacture’s suggestions. Blots were incubated for 1h at room temperature with Anti-ZIP12 (1:10,000); Anti-HIF1α (1:1000, Novus Biological); or Anti-HIF2α (1:1000, Novus Biological). Proteins were detected by Clarity western ECL substrate (Bio-rad). Optical densities of individual bands were measured using ImageJ software and protein expressions were standardised with Vinculin.
Statistical analysis
Data are presented as mean ± the standard error of the mean (SEM). Data were tested for normality using the Kolmogorov-Smirnov. All data were confirmed normally distributed with similar variance between comparator groups. Data were analysed using one-way ANOVA followed by Bonferroni post-test adjustment for multiple comparisons or unpaired t-test. Graphpad Prism was used for all statistical analysis.
Other Bioinformatics analyses
The Ensembl database[32] was mined with the BioMart tool[33] to identify all transcribed elements in the CI region. Search was limited to chromosome 17 between positions 85,072,475-93,347,758. PolyPhen analysis was used to predict the possible impact of described SNP on amino acid substitution on the structure and function of a human protein[34].
Generation of congenic and sub-congenic strains
Congenic rat lines were produced by introgression of the F344 chromosome 17 QTL segment onto the WKY genetic background by repeated backcrossing. Congenic rat strain R47A (WKY.F344-D17Got91/D17Rat51) contains 15Mbp from the F344 donor region that maps to the distal end of the QTL on a WKY background. Three sub-congenic strains, SubA (WKY.F344-D17Got91/D17Rat47), SubB (WKY.F344-D17Rat47/D17Rat51) and SubC (WKY.F344-D17Rat131/D17Rat51), were produced containing separate fragments of the R47A donor region by backcrossing of (R47A × WKY) F1 with WKY parental rats. Three recombination events within the R47A congenic interval break the congenic interval into three smaller and overlapping sub-congenic intervals (Figure 1, main text).
Dissection of QTL and Cardiovascular phenotype of rat strains
a. The hypoxia-resistant F344 phenotype tracks with the congenic R47A line. Rats were kept in 10%O2 for 2 weeks and right ventricular hypertrophy (RV/LV+Sep) was significantly attenuated in the congenic R47A strain (0.32±0.03, n=13, **P<0.01) compared to WKY rats (0.37±0.03, n=15), whereas congenic R42 rats (0.36±0.03, n = 17) were similar (NS) to WKY rats. b. An illustrative genetic map showing the relationship of the congenic strains (R42, R47A), subcongenic strains (SubA, SubB, SubC) and Slc39a12 to the original QTL (defined by a LOD score >3; Zhao et al Circulation 2001,103, 442-447) on a physical map of chromosome 17 (using Rat Genome Assembly v5.0). In normoxia, WKY, F344, R47A, SubA, SubB and SubC rats show no significant differences in c. mean pulmonary artery pressure (mPAP), d. right ventricular hypertrophy (RV/LV+Septum ratio) and e. vascular muscularisation (n=8 each group); f. Systemic blood pressure (SBP) is similar in all strains in both normoxia and hypoxic conditions. g. F344, R47A and SubB rats exhibit attenuated pulmonary vascular remodelling after 2 weeks exposure to a 10% O2 atmosphere compared to WKY, SubA and SubC rats (n=6 each group). Values are expressed as the mean ± standard error of the mean (SEM). *P<0.05, **P<0.01, ***P<0.001 compared to WKY (% of fully muscularised and partially muscularised vessels); ##P<0.01, ###P<0.001 compared to WKY (% of non-muscularised vessels) after One-Way ANOVA analysis followed by Bonferroni correction for multiple testing.
Hypoxia-induced pulmonary vascular remodeling in parental strains
a. Upper panel sequence shows the WKY protein sequence (688aa) and lower panel shows the truncated F344 protein sequence (553aa). Stars (*) mark the mutated amino acids compared to WKY protein. Dotted line indicates the C-terminal truncated region in F344. The grey square highlights the metalloprotease motif. b. Prominent ZIP12 immunostaining is seen in remodelled pulmonary arterioles in the chronically hypoxic WKY rat alongside vessels with a double elastic lamina (stained with Van Gieson, EVG) but not F344 lungs exposed to hypoxia. (Red arrow: vessel with double elastic lamina; blue arrow: vessel with single elastic lamina)
ZIP12 upregulation in response to hypoxia exposure and measurements of intracellular labile zinc concentration and proliferation of human pulmonary artery smooth muscle cells (HPASMCs) in normoxia conditions
a. Upregulation of ZIP12 in HPASMCs exposed to hypoxia, in contrast to other zinc transporters (n=6). b. Representative western blots demonstrating increased HIF-2α expression in HPASMCs after 24h hypoxia exposure. c. Confocal laser scanning images of HPASMC transfected with eCALWY-4 probe. Intracellular free zinc was not affected by transfection with ZIP12 siRNA in normoxia. d. Representative traces showing the changes in fluorescence ratio usng the eCALWY-4 probe. e. Quantification of intracellular zinc levels (n=10). f. ZIP12 siRNA did not affect proliferation of HPASMCs in normoxic conditions (n=5).
Design of specific Slc39a12 ZFN and confirmation of mutant line
a. CompoZr™ Custom Zinc Finger Nucleases (Sigma-Aldrich) for the rat Slc39a12 gene were designed to target exon 8 (a; Sigma-Aldrich). b-d. Cel-I surveyor assay and gene sequencing confirmed NHEJ-induced mutations in at least one pup (mutant 77). e. The 4bp (AGTT) deletion followed by 2bp insertion (TA) into mutant 77 caused a frame-shift in coding, introducing a stop codon leading to a truncated protein. Red star refers to stop codon. c. We subsequently genotyped next generation litters using SwaI (cutting point: 5′-ATTTAAAT-3′), showing 100% digestion for homozygous pups (−/−), 50% for heterozygous (+/−) and no DNA digestion for wild type rats (+/+).
a. Representative lung sections from wild-type (WT) and ZIP12 −/− rats 2 weeks after hypoxia exposure. Elastic van Gieson (EVG) staining showing double elastic lamina (red arrow) in WT but single elastic laminae (blue arrow) in ZIP12−/− rats. b. Genetic disruption of ZIP12 in WKY rat attenuated pulmonary vascular remodelling after 2 weeks exposure to a 10% O2 atmosphere compared to wild-type (WT) rats (n=5 each group). *P<0.01 compared to WT (% of fully muscularised vessels); ##P<0.01, ###P<0.001 compared to WT (% of non-muscularised vessels) after One-Way ANOVA analysis followed by Bonferroni’s multiple comparison test. c. Ki67 staining showing reduced proliferation in hypoxic ZIP12−/− rat lungs compared to the WT strain. *P<0.01 compared to WT. d. Representative sections from hypoxic WT and ZIP12−/− rats lungs showing differences in staining with the proliferation marker, Ki67. e-g. Genetic disruption of ZIP12 in WKY rat did not influence e. systemic blood pressure (SBP) or f. cardiac output (CO) but attenuated hypoxia-induced increases in g. pulmonary vascular resistance (n=7 each group). Values are expressed as the mean ± standard error of the mean (SEM). *P<0.05, **P<0.01 compared to normoxic rats, #p<0.05 compared to wild-type (WT) hypoxic rats after One-Way ANOVA analysis followed by Bonferroni correction for multiple testing. h. ZIP12 targeted siRNA inhibition attenuates stress fibre formation in human pulmonary vascular smooth muscle cells (HPASMCs) in hypoxia (n=5 each group). **p<0.01 compared to normoxia control group, #p<0.05 compared to hypoxia control group. i. Representative pictures of actin stress fibre in HPASMCs. j. ex vivo angiogenesis studies demonstrated that vascular outgrowth from ZIP12−/− pulmonary vessels in response to hypoxia was attenuated compared to vessels from wild-type (WT) rats (n=12 each group, 2 rings/rat, 6 ZIP12 −/− and 6 WT rats). *P<0.05 compared to normoxia WT group; #P<0.05, ## P<0.01 and ### P<0.001 compared to hypoxia ZIP12−/− group. k. Representative pictures of pulmonary arteriole ring outgrowth at day 6.
Carbonic anhydrase (CAIX) expression
a. Representative sections demonstrating increased CAIX expression in remodelled pulmonary arterioles in the lungs of rats exposed to alveolar hypoxia (2 weeks), monocrotaline (MCT, 3 weeks) or a chronic iron deficient diet (4 weeks). b-c. No CAIX staining was detected in pulmonary arteries of low altitude (normoxia control, CO calf) calves and sea level humans, but prominent CAIX immunostaining was observed in the remodelled pulmonary arteries of calves with severe pulmonary hypertension (Hx calf), in cattle with naturally occurring pulmonary hypertension (“Brisket disease”, BD) as well as patients with idiopathic pulmonary arterial hypertension (IPAH).
Genetic disruption of ZIP12 in WKY rat attenuated monocrotaline-induced pulmonary hypertension
a. Mean pulmonary artery pressure (mPAP), b. right ventricular hypertrophy (RV/LV+Septum) and c. pulmonary arteriole muscularisation. (n=5 each group). Values are expressed as the mean ± standard error of the mean (SEM). *P<0.05, **P<0.01 compared to wild-type (WT) monocrotaline group after unpaired Student t-test. d. Representative lung sections from wild-type (WT) and ZIP12 −/− rats 3 weeks after monocrotaline injection. Elastic van Gieson (EVG) staining showing double elastic lamina (red arrow) in WT but single elastic laminae (blue arrow) in ZIP12−/− rats.Frameshift and Non-Synonymous coding mutations in the refined congenic interval of F344 and the other hypoxia susceptible strains, WKY, spontaneously hypertensive (SHR) and fawn-hooded (FHH) rat strains.Genotype code: 0 = Homozygous reference allele; 1 = Heterozygous; 2 = Homozygous alternate allele; 6 = Ambiguous. Green square = shared genotype between F344 and susceptible strains; Bold = candidate genes; Blue = most important polymorphismPolymorphism markers for congenic strain genotyping.
Authors: John Wharton; Julian W Strange; Gigi M O Møller; Ellena J Growcott; Xiaohui Ren; Angela P Franklyn; Stephen C Phillips; Martin R Wilkins Journal: Am J Respir Crit Care Med Date: 2005-04-07 Impact factor: 21.405
Authors: L Zhao; A Sebkhi; D J Nunez; L Long; C S Haley; J Szpirer; C Szpirer; A J Williams; M R Wilkins Journal: Circulation Date: 2001-01-23 Impact factor: 29.690
Authors: R M Tuder; M Chacon; L Alger; J Wang; L Taraseviciene-Stewart; Y Kasahara; C D Cool; A E Bishop; M Geraci; G L Semenza; M Yacoub; J M Polak; N F Voelkel Journal: J Pathol Date: 2001-10 Impact factor: 7.996
Authors: Emanuele Cotroneo; Ali Ashek; Lei Wang; John Wharton; Olivier Dubois; Sophie Bozorgi; Mark Busbridge; Kambiz N Alavian; Martin R Wilkins; Lan Zhao Journal: Circ Res Date: 2015-03-12 Impact factor: 17.367
Authors: Yuqing Zhang; Uddalak Bharadwaj; Craig D Logsdon; Changyi Chen; Qizhi Yao; Min Li Journal: Clin Cancer Res Date: 2010-02-16 Impact factor: 12.531
Authors: Lan Zhao; Chien-Nien Chen; Nabil Hajji; Eduardo Oliver; Emanuele Cotroneo; John Wharton; Daren Wang; Min Li; Timothy A McKinsey; Kurt R Stenmark; Martin R Wilkins Journal: Circulation Date: 2012-06-18 Impact factor: 29.690
Authors: Santosh S Atanur; Ana Garcia Diaz; Klio Maratou; Allison Sarkis; Maxime Rotival; Laurence Game; Michael R Tschannen; Pamela J Kaisaki; Georg W Otto; Man Chun John Ma; Thomas M Keane; Oliver Hummel; Kathrin Saar; Wei Chen; Victor Guryev; Kathirvel Gopalakrishnan; Michael R Garrett; Bina Joe; Lorena Citterio; Giuseppe Bianchi; Martin McBride; Anna Dominiczak; David J Adams; Tadao Serikawa; Paul Flicek; Edwin Cuppen; Norbert Hubner; Enrico Petretto; Dominique Gauguier; Anne Kwitek; Howard Jacob; Timothy J Aitman Journal: Cell Date: 2013-07-25 Impact factor: 41.582
Authors: Claire Healy; Natalia Munoz-Wolf; Janné Strydom; Lynne Faherty; Niamh C Williams; Sarah Kenny; Seamas C Donnelly; Suzanne M Cloonan Journal: Respir Res Date: 2021-04-29
Authors: Thomas Bertero; William M Oldham; Katherine A Cottrill; Sabrina Pisano; Rebecca R Vanderpool; Qiujun Yu; Jingsi Zhao; Yiyin Tai; Ying Tang; Ying-Yi Zhang; Sofiya Rehman; Masataka Sugahara; Zhi Qi; John Gorcsan; Sara O Vargas; Rajan Saggar; Rajeev Saggar; W Dean Wallace; David J Ross; Kathleen J Haley; Aaron B Waxman; Victoria N Parikh; Teresa De Marco; Priscilla Y Hsue; Alison Morris; Marc A Simon; Karen A Norris; Cedric Gaggioli; Joseph Loscalzo; Joshua Fessel; Stephen Y Chan Journal: J Clin Invest Date: 2016-08-22 Impact factor: 14.808
Authors: Adrian I Abdo; Hai Bac Tran; Sandra Hodge; John F Beltrame; Peter D Zalewski Journal: Biol Trace Elem Res Date: 2020-08-10 Impact factor: 3.738