Literature DB >> 26226635

The enterococcal cytolysin synthetase has an unanticipated lipid kinase fold.

Shi-Hui Dong1, Weixin Tang2, Tiit Lukk3, Yi Yu1, Satish K Nair1, Wilfred A van der Donk1.   

Abstract

The enterococcal cytolysin is a virulence factor consisting of two post-translationally modified peptides that synergistically kill human immune cells. Both peptides are made by CylM, a member of the LanM lanthipeptide synthetases. CylM catalyzes seven dehydrations of Ser and Thr residues and three cyclization reactions during the biosynthesis of the cytolysin large subunit. We present here the 2.2 Å resolution structure of CylM, the first structural information on a LanM. Unexpectedly, the structure reveals that the dehydratase domain of CylM resembles the catalytic core of eukaryotic lipid kinases, despite the absence of clear sequence homology. The kinase and phosphate elimination active sites that affect net dehydration are immediately adjacent to each other. Characterization of mutants provided insights into the mechanism of the dehydration process. The structure is also of interest because of the interactions of human homologs of lanthipeptide cyclases with kinases such as mammalian target of rapamycin.

Entities:  

Keywords:  Enterococcus faecalis; biochemistry; biophysics; dehydration; kinase; lanthipeptides; structural biology

Mesh:

Substances:

Year:  2015        PMID: 26226635      PMCID: PMC4550811          DOI: 10.7554/eLife.07607

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Cytolysin is produced by many clinical isolates of Enterococcus faecalis and consists of two post-translationally modified peptides termed cytolysin L and S (Figure 1A) (Gilmore et al., 1994; Cox et al., 2005). These peptides have lytic activity against various types of eukaryotic cells including immune cells (Cox et al., 2005; Bierbaum and Sahl, 2009). The production of cytolysin enhances virulence in infection models of E. faecalis, and epidemiological data support an association with acute patient mortality (Ike and Clewell, 1984; Huycke et al., 1991; Chow et al., 1993; Van Tyne et al., 2013). Cytolysin is a member of the lanthipeptides, a family of polycyclic peptides that are made in a two-step process involving dehydration of Ser and Thr residues to dehydroamino acids and subsequent addition of thiols of Cys residues to the dehydroamino acids (Figure 1B) (Knerr and van der Donk, 2012). This process, catalyzed by the enzyme CylM for cytolysin, generates the characteristic thioether crosslinks called lanthionine (Lan) and methyllanthionine (MeLan) (Figure 1). An N-terminal leader peptide in the substrates is important for substrate binding by lanthipeptide biosynthetic enzymes (Oman and van der Donk, 2010), but the post-translational modifications take place in the C-terminal core peptides.
Figure 1.

Biosynthesis of the enterococcal cytolysin.

(A) Biosynthetic route to cytolysin S (small subunit of cytolysin) and the structure of cytolysin L (large subunit of cytolysin). CylM dehydrates three Thr and one Ser in the precursor peptide CylLS to generate three Dhb residues and one Dha. The enzyme also catalyzes the conjugate addition of the thiols of Cys5 to Dhb1 and Cys21 to Dha17. The proteases CylB and CylA then remove the leader peptide in a step-wise manner to provide cytolysin S. In similar fashion, CylM catalyzes seven dehydrations of Ser and Thr residues and three cyclization reactions during the biosynthesis of the large subunit of cytolysin. Abu-S-Ala = methyllanthionine (MeLan); Ala-S-Ala = lanthionine (Lan); Dha = dehydroalanine; Dhb = dehydrobutyrine. (B) Post-translational modifications carried out by CylM during cytolysin biosynthesis. Xn = peptide linker.

DOI: http://dx.doi.org/10.7554/eLife.07607.003

Linear CylLL, calculated M: 7,082, average mass; observed M + H+: 7084, average mass. CylM modified CylLL, calculated M—7 H2O: 6956, average mass; observed M—7 H2O + H+: 6958, average mass. CylLS, calculated M: 7132, average mass; observed M + H+: 7134, average mass. CylM modified CylLS, calculated M—4 H2O: 7060, average mass; observed M—4 H2O + H+: 7062, average mass. The observed masses are consistent with the expected post-translational modifications shown in Figure 1.

DOI: http://dx.doi.org/10.7554/eLife.07607.004

The fragmentation pattern verifies the expected ring topology. The parent ions provided masses consistent with the expected structure and the MS/MS data corroborate the ring topology. CylM-modified CylLL core peptide, calculated (M—7 H2O + 3 H)3+: 1146.2, monoisotopic mass; observed (M—7 H2O + 3 H)3+: 1146.2, monoisotopic mass. CylM-modified CylLS core peptide, calculated (M—4 H2O + 2 H)2+: 1016.5, monoisotopic mass; observed (M—4 H2O + 2 H)2+: 1016.5, monoisotopic mass.

DOI: http://dx.doi.org/10.7554/eLife.07607.005

Biosynthesis of the enterococcal cytolysin.

(A) Biosynthetic route to cytolysin S (small subunit of cytolysin) and the structure of cytolysin L (large subunit of cytolysin). CylM dehydrates three Thr and one Ser in the precursor peptide CylLS to generate three Dhb residues and one Dha. The enzyme also catalyzes the conjugate addition of the thiols of Cys5 to Dhb1 and Cys21 to Dha17. The proteases CylB and CylA then remove the leader peptide in a step-wise manner to provide cytolysin S. In similar fashion, CylM catalyzes seven dehydrations of Ser and Thr residues and three cyclization reactions during the biosynthesis of the large subunit of cytolysin. Abu-S-Ala = methyllanthionine (MeLan); Ala-S-Ala = lanthionine (Lan); Dha = dehydroalanine; Dhb = dehydrobutyrine. (B) Post-translational modifications carried out by CylM during cytolysin biosynthesis. Xn = peptide linker. DOI: http://dx.doi.org/10.7554/eLife.07607.003

MALDI/TOF mass spectra for CylLL (A) and CylLS (B) peptides incubated with (magenta traces) or without (blue traces) CylM.

Linear CylLL, calculated M: 7,082, average mass; observed M + H+: 7084, average mass. CylM modified CylLL, calculated M—7 H2O: 6956, average mass; observed M—7 H2O + H+: 6958, average mass. CylLS, calculated M: 7132, average mass; observed M + H+: 7134, average mass. CylM modified CylLS, calculated M—4 H2O: 7060, average mass; observed M—4 H2O + H+: 7062, average mass. The observed masses are consistent with the expected post-translational modifications shown in Figure 1. DOI: http://dx.doi.org/10.7554/eLife.07607.004

ESI MS/MS analysis of CylLL (A) and CylLS (B) core peptides modified by CylM in vitro and treated with the protease CylA that removes the leader peptide.

The fragmentation pattern verifies the expected ring topology. The parent ions provided masses consistent with the expected structure and the MS/MS data corroborate the ring topology. CylM-modified CylLL core peptide, calculated (M—7 H2O + 3 H)3+: 1146.2, monoisotopic mass; observed (M—7 H2O + 3 H)3+: 1146.2, monoisotopic mass. CylM-modified CylLS core peptide, calculated (M—4 H2O + 2 H)2+: 1016.5, monoisotopic mass; observed (M—4 H2O + 2 H)2+: 1016.5, monoisotopic mass. DOI: http://dx.doi.org/10.7554/eLife.07607.005 To date, four distinct routes to lanthipeptides have been discovered, illustrating that the cyclic thioether motif is a privileged structural scaffold that has been independently accessed multiple times during evolution (Zhang et al., 2012). The thioether bridges introduce conformational constraints that facilitate target binding and reduce proteolytic susceptibility. The four routes differ primarily in the mechanism of dehydration. For the class I, III, and IV lanthipeptides, the mechanism of dehydration has been illuminated by crystallographic characterization of the dehydratases or close sequence homologs (Li et al., 2006, 2007; Goto et al., 2010; Ortega et al., 2015), but the mechanism of dehydration for class II lanthipeptide synthetases (LanMs) that include CylM has remained enigmatic. These enzymes show no clear sequence homology with non-lanthipeptide proteins and despite two decades of investigation, structural information on class II lanthipeptide synthetases has been unavailable. Such information would be valuable for obtaining inhibitors of cytolysin biosynthesis that could be therapeutically valuable. In addition, LanM lanthipeptide synthetases are involved in the biosynthesis of several lanthipeptides and their derivatives that are under clinical evaluation such as actagardine and duramycin (Grasemann et al., 2007; Steiner et al., 2008; Jones and Helm, 2009; Johnson, 2010; Oliynyk et al., 2010; Crowther et al., 2013). As such, structural information on this class of synthetases will also facilitate bioengineering of improved analogs. We describe here the 2.2 Å resolution structure of CylM and demonstrate that its dehydration domain surprisingly has structural similarity with eukaryotic lipid kinases despite the absence of notable sequence homology. These findings may also have implications for the three eukaryotic homologs of lanthipeptide cyclases, one of which was recently shown to interact with mammalian target of rapamycin (mTOR) complex 2 (Zeng et al., 2014).

Results and discussion

Overall structure and in vitro activity of CylM

CylM and its substrate peptides CylLL and CylLS were expressed in Escherichia coli as hexahistidine-tagged proteins and purified by metal affinity chromatography. Incubation of CylM with CylLL or CylLS in the presence of MgCl2 and adenosine triphosphate (ATP), and subsequent removal of the leader peptides by purified CylA, a serine protease of the cytolysin biosynthetic pathway (Booth et al., 1996), resulted in the desired number of dehydrations as determined by matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF MS) (Figure 1—figure supplement 1). Analysis of the peptides by tandem electrospray ionization mass spectrometry (ESI MS) demonstrated the formation of the correct ring structures (Figure 1—figure supplement 2).
Figure 1—figure supplement 1.

MALDI/TOF mass spectra for CylLL (A) and CylLS (B) peptides incubated with (magenta traces) or without (blue traces) CylM.

Linear CylLL, calculated M: 7,082, average mass; observed M + H+: 7084, average mass. CylM modified CylLL, calculated M—7 H2O: 6956, average mass; observed M—7 H2O + H+: 6958, average mass. CylLS, calculated M: 7132, average mass; observed M + H+: 7134, average mass. CylM modified CylLS, calculated M—4 H2O: 7060, average mass; observed M—4 H2O + H+: 7062, average mass. The observed masses are consistent with the expected post-translational modifications shown in Figure 1.

DOI: http://dx.doi.org/10.7554/eLife.07607.004

Figure 1—figure supplement 2.

ESI MS/MS analysis of CylLL (A) and CylLS (B) core peptides modified by CylM in vitro and treated with the protease CylA that removes the leader peptide.

The fragmentation pattern verifies the expected ring topology. The parent ions provided masses consistent with the expected structure and the MS/MS data corroborate the ring topology. CylM-modified CylLL core peptide, calculated (M—7 H2O + 3 H)3+: 1146.2, monoisotopic mass; observed (M—7 H2O + 3 H)3+: 1146.2, monoisotopic mass. CylM-modified CylLS core peptide, calculated (M—4 H2O + 2 H)2+: 1016.5, monoisotopic mass; observed (M—4 H2O + 2 H)2+: 1016.5, monoisotopic mass.

DOI: http://dx.doi.org/10.7554/eLife.07607.005

To investigate the mechanism of catalysis, we determined the 2.2 Å resolution structure of CylM in complex with adenosine monophosphate (AMP). The structure of the ∼110 kDa polypeptide consists of two distinct domains, with an N-terminal dehydration domain, composed of residues Asn4 through Pro624, and a C-terminal cyclization domain encompassed by Tyr641 through Glu992 (Figure 2A). The protein is a monomer in the crystal and in solution as determined by gel filtration analysis. Consistent with prior predictions, the cyclization domain consists of the α/α-barrel fold observed in the structure of the stand-alone class I Lan cyclase NisC (Li et al., 2006). As in NisC, CylM contains a single zinc ion near the center of the toroid coordinated by residues Cys875, Cys911, and His912, with a water molecule completing the tetrahedral coordination geometry at the metal. This zinc site is believed to activate the thiols of the Cys residues during the cyclization reaction (Li et al., 2006). The barrel of the NisC structure is interspersed with a structural element that resembles eukaryotic peptide-binding domains (Figure 2B), which is thought to bind the leader region of the substrate peptide. The C-terminal cyclization domain of CylM lacks this element but instead contains a β-sheet region composed of three antiparallel strands that is situated near the zinc ion (Figure 2A, red). This element, encompassing Ile666 through Leu690, is located on the opposite face of the toroid relative to the putative leader peptide-binding domain in NisC, where it flanks against the base of the N-terminal dehydration domain of CylM. A similar antiparallel β-stranded element engages the leader peptide in the mechanistically unrelated class I Lan dehydratase NisB (Ortega et al., 2015) and is also found in other enzymes involved in the biosynthesis of ribosomally synthesized and post-translationally modified peptides (RiPPs) (Koehnke et al., 2013; Burkhart et al., 2015; Koehnke et al., 2015) (Figure 2C). Thus, the leader peptide binding architecture may be conserved across RiPP biosynthetic enzymes, despite very high diversity of the reactions they catalyze (Arnison et al., 2013). To investigate whether the β-stranded element in the cyclase domain is important for the dehydration reaction, the N-terminal domain (residues 1–625) that lacks this element was expressed and purified with an N-terminal His6-tag. Incubation with CylLS substrate resulted in efficient dehydration (Figure 2—figure supplement 1), indicating that the β-stranded element is not required for the dehydration reaction. This observation is consistent with several very recent reports describing expression and activity of the two individual domains of various LanM enzymes and binding of their substrates to both domains (Ma et al., 2015; Shimafuji et al., 2015; Yu et al., 2015).
Figure 2.

(A) Overall structure of CylM.

(B) Structure of the class I lanthipeptide cyclase NisC illustrating the structural homology with the C-terminus of CylM. (C) Comparison of the putative peptide-binding β-strands of CylM with the peptide binding regions of other RiPP biosynthetic enzymes including NisB (involved in nisin biosynthesis, PDB 4WD9) and LynD (involved in cyanobactin biosynthesis; PDB 4V1T). (D) Structure of the lipid kinase PI3K that shares homology with the dehydration domain of CylM. (E) Domain organization of LanMs in comparison with that of lipid kinases. RBD, Ras-binding domain.

DOI: http://dx.doi.org/10.7554/eLife.07607.006

Calculated M—4 H2O: 8330, average mass; observed M—4 H2O + H+: 8334, average mass. Partial gluconoylation at the N-terminus of dehydrated CylLS occurred when expressing the peptide in E. coli BL21(DE3), resulting in a +178 Da peak in addition to the desired peptide mass (Aon et al., 2008).

DOI: http://dx.doi.org/10.7554/eLife.07607.007

DOI: http://dx.doi.org/10.7554/eLife.07607.008

Secondary structural elements are colored as in Figures 2A, 3A.

DOI: http://dx.doi.org/10.7554/eLife.07607.009

Figure 2—figure supplement 1.

MALDI-TOF mass spectrum for CylLS modified by the CylM dehydratase domain in Escherichia coli.

Calculated M—4 H2O: 8330, average mass; observed M—4 H2O + H+: 8334, average mass. Partial gluconoylation at the N-terminus of dehydrated CylLS occurred when expressing the peptide in E. coli BL21(DE3), resulting in a +178 Da peak in addition to the desired peptide mass (Aon et al., 2008).

DOI: http://dx.doi.org/10.7554/eLife.07607.007

(A) Overall structure of CylM.

(B) Structure of the class I lanthipeptide cyclase NisC illustrating the structural homology with the C-terminus of CylM. (C) Comparison of the putative peptide-binding β-strands of CylM with the peptide binding regions of other RiPP biosynthetic enzymes including NisB (involved in nisin biosynthesis, PDB 4WD9) and LynD (involved in cyanobactin biosynthesis; PDB 4V1T). (D) Structure of the lipid kinase PI3K that shares homology with the dehydration domain of CylM. (E) Domain organization of LanMs in comparison with that of lipid kinases. RBD, Ras-binding domain. DOI: http://dx.doi.org/10.7554/eLife.07607.006

MALDI-TOF mass spectrum for CylLS modified by the CylM dehydratase domain in Escherichia coli.

Calculated M—4 H2O: 8330, average mass; observed M—4 H2O + H+: 8334, average mass. Partial gluconoylation at the N-terminus of dehydrated CylLS occurred when expressing the peptide in E. coli BL21(DE3), resulting in a +178 Da peak in addition to the desired peptide mass (Aon et al., 2008). DOI: http://dx.doi.org/10.7554/eLife.07607.007

Topology diagrams for (A) CylM and (B) PI3 kinase P110γ.

DOI: http://dx.doi.org/10.7554/eLife.07607.008

Structure based alignment of biochemically characterized LanM enzymes.

Secondary structural elements are colored as in Figures 2A, 3A. DOI: http://dx.doi.org/10.7554/eLife.07607.009 Although the N-terminal dehydration domain lacks detectable sequence similarities with other proteins, the CylM structure reveals that this domain is architecturally related to the catalytic core of lipid kinases, such as phosphoinositide 3-kinase (PI3K) (Figure 2A,D) (Walker et al., 1999; Williams et al., 2009). The structural similarity with kinases is consistent with the proposed mechanism of dehydration by LanM proteins via first phosphorylation of Ser and Thr residues, followed by elimination of the phosphate (Chatterjee et al., 2005; You and van der Donk, 2007). Despite the structural homology, the topology of the CylM dehydration domain is quite different from those of canonical kinases (Figure 2E), resulting in a distinct connectivity between conserved secondary structural features (Figure 2—figure supplement 2), which can only be gleaned through a structure-based alignment (Figure 2—figure supplement 3).
Figure 2—figure supplement 2.

Topology diagrams for (A) CylM and (B) PI3 kinase P110γ.

DOI: http://dx.doi.org/10.7554/eLife.07607.008

Figure 2—figure supplement 3.

Structure based alignment of biochemically characterized LanM enzymes.

Secondary structural elements are colored as in Figures 2A, 3A.

DOI: http://dx.doi.org/10.7554/eLife.07607.009

Structural details of the kinase and elimination active sites

Like canonical kinases, the CylM dehydration domain is composed of an N-lobe spanning residues Lys135 through Ser279, and a C-lobe composed of residues Glu280 through Val508 (Figure 3A). A number of helices formed by residues Leu5 through Asn131 and a two-helix insert created by Ile180 through Tyr200 cap the N-lobe, and hence we name these the ‘capping helices’ (Figure 3A). A similar, but topologically distinct, four-helix bundle insertion (termed the FRB domain [Chen et al., 1995]) cradles the N-lobe of PI3K-related protein kinases (PIKKs) such as, mTOR and DNA-PKc (Figure 3B,C) (Choi et al., 1996; Sibanda et al., 2010; Yang et al., 2013). Another distinct domain that we term the kinase-activation (KA) domain (see below) is held in place through interactions with the ‘capping helices’ (Figure 3A). The CylM C-lobe is appended with two helices formed by Gln589 through Pro624 that are characteristic of lipid kinases (helices kα10 and kα11 in lipid kinase nomenclature) (Walker et al., 1999; Miller et al., 2010; Sibanda et al., 2010; Yang et al., 2013). Helix kα11 of CylM packs against the three-β-stranded proposed leader peptide-binding region in the cyclase domain (Figure 3A). In mTOR, the equivalent kα11 helix is necessary for stabilization of the activation loop (Figure 3B) (Yang et al., 2013). As a result of all of these architectural additions, the CylM dehydration domain is considerably larger than the catalytic domain of other protein and lipid kinases, with the exception of the aforementioned PIKKs that contain the FRB insertion within the N-lobe (Figure 3—figure supplement 1) (Sibanda et al., 2010; Yang et al., 2013).
Figure 3.

(A–C) Comparison of the kinase domains of (A) CylM, with those of (B) mammalian target of rapamycin (mTOR) and (C) DNA-PKc (a PI3 kinase).

Secondary structural elements are colored as in Figure 2A and structurally unique insertions are designated. (D) Close up of the CylM dehydratase active site showing the bound nucleotide, and the proximity of residues important for phosphorylation and phosphate elimination. A simulated annealing difference Fourier map (calculated without the nucleotide) is superimposed in blue mesh. (E) Solvent occluded surface showing the two possible peptide-binding grooves that flank the peptide β-strand element (red). A loop = activation loop.

DOI: http://dx.doi.org/10.7554/eLife.07607.010

Relevant structural and functional elements are noted.

DOI: http://dx.doi.org/10.7554/eLife.07607.011

Conserved active site residues implicated in the catalytic mechanism are labeled using the same color-coding as for the polypeptides.

DOI: http://dx.doi.org/10.7554/eLife.07607.012

The insertions in the kinase domain of CylM preclude binding of the CylA peptide substrate in a similar pose.

DOI: http://dx.doi.org/10.7554/eLife.07607.013

Figure 3—figure supplement 1.

Two views, rotated by 180o, of the superposition of the kinase active site of CylM (in purple) with the kinase domain of PI3 kinase (in cyan).

Relevant structural and functional elements are noted.

DOI: http://dx.doi.org/10.7554/eLife.07607.011

(A–C) Comparison of the kinase domains of (A) CylM, with those of (B) mammalian target of rapamycin (mTOR) and (C) DNA-PKc (a PI3 kinase).

Secondary structural elements are colored as in Figure 2A and structurally unique insertions are designated. (D) Close up of the CylM dehydratase active site showing the bound nucleotide, and the proximity of residues important for phosphorylation and phosphate elimination. A simulated annealing difference Fourier map (calculated without the nucleotide) is superimposed in blue mesh. (E) Solvent occluded surface showing the two possible peptide-binding grooves that flank the peptide β-strand element (red). A loop = activation loop. DOI: http://dx.doi.org/10.7554/eLife.07607.010

Two views, rotated by 180o, of the superposition of the kinase active site of CylM (in purple) with the kinase domain of PI3 kinase (in cyan).

Relevant structural and functional elements are noted. DOI: http://dx.doi.org/10.7554/eLife.07607.011

Superposition of the active sites of CylM (pink) with the co-crystal structures of transition state mimics bound to mTOR (cyan) and cyclin-dependent protein kinase CDK2 (green).

Conserved active site residues implicated in the catalytic mechanism are labeled using the same color-coding as for the polypeptides. DOI: http://dx.doi.org/10.7554/eLife.07607.012

Superposition of the active sites of CylM (pink) with cyclin-dependent protein kinase CDK2 bound to a peptide substrate (green).

The insertions in the kinase domain of CylM preclude binding of the CylA peptide substrate in a similar pose. DOI: http://dx.doi.org/10.7554/eLife.07607.013 All protein and lipid kinases contain a requisite ∼30-residue segment termed the activation loop that plays a major role in both regulation and function. Kinase activity is typically controlled through activation-induced conformational changes, consisting of a disorder-to-order transition of the activation loop, which aligns active site residues and provides part of the binding site for substrate. Unlike most kinases, the activation loop in the CylM dehydration domain, composed of residues Asn365 through Val383, is well defined in the absence of bound peptide substrate (Figures 2A, 3A). The orientation and stabilization of the activation loop is established through numerous interactions with the LanM-specific KA domain, which is itself held in place through interactions with the ‘capping helices’ (Figures 2A, 3A). The activation loop is presumably stabilized in a catalytically competent conformation, because unlike most lipid kinases, the dehydration activity of LanM enzymes is not dependent on exogenous regulatory protein activators. The activation loop in mTOR is similarly held in a catalytically competent conformation via interactions with a highly conserved and integral ∼35 residue FATC domain, which is stabilized through packing interactions with a ∼40 residue insertion in the C-lobe termed the LBE (Figure 3B) (Yang et al., 2013).

Substrate binding sites in CylM

In the CylM co–crystal structure, the bound AMP is located between the two lobes of the kinase domain (Figure 3D). The phosphate-binding loop (P-loop) is composed of residues Ser247 through Thr262 and is considerably longer than the equivalent feature in PI3Ks. It contains many residues that are poised to interact with the nucleotide phosphate, including Asp252 and His254. Mutational analysis suggests a second role for these residues in the elimination of phosphate from the phosphorylated peptide product (see below). The adenine is situated in a hydrophobic binding pocket common across other structurally characterized kinases that is defined by CylM residues Val272 (Ile831 in PI3Kγ), Val301 (Tyr867 in PI3Kγ), Ile354 (Met953 in PI3Kγ), and Val361 (Phe961 in PI3Kγ). The proposed mechanism for PIKKs involves a conserved DxH motif, and LanM-conserved residues Asp347 and His349 are poised for catalysis in CylM (Figure 3D). His349 may receive a proton from Ser/Thr in the substrate peptide (Miller et al., 2010), in which case Asp347 likely orients the Ser/Thr oxygen for nucleophilic attack onto the γ-phosphate of ATP. Alternatively, Asp347 could accept the proton from substrate (Yang et al., 2013). The invariant Lys residue that activates the γ-phosphate in kinases (Hanks and Hunter, 1995) is Lys274 in CylM. Additionally, two conserved residues, Asn352 and Asp364, are situated to act as divalent metal ligands to stabilize the incipient charge in the transition state, although slight reorientation of the side chain conformations must occur upon binding of the metal. A superposition of CylM with recent structures of the cyclin-dependent PIKK CDK2 (Bao et al., 2011) and mTOR (Yang et al., 2013), each bound to transition state mimics, reveals a near-perfect coincidence of equivalent residues at the active site, underscoring their importance in catalysis (Figure 3—figure supplement 2).
Figure 3—figure supplement 2.

Superposition of the active sites of CylM (pink) with the co-crystal structures of transition state mimics bound to mTOR (cyan) and cyclin-dependent protein kinase CDK2 (green).

Conserved active site residues implicated in the catalytic mechanism are labeled using the same color-coding as for the polypeptides.

DOI: http://dx.doi.org/10.7554/eLife.07607.012

The structure also suggests a model for how the substrate peptide can bind to the two active sites. A superposition of CylM with the CDK2-substrate peptide bound structure (Bao et al., 2011) reveals that the LanM-specific KA domain occludes the canonical peptide binding sites of protein and lipid kinases (Figure 3—figure supplement 3). Instead, a solvent-excluded surface diagram demarcates a groove that leads to the nucleotide-binding site of the dehydratase domain (Figure 3E). A second groove traces to the zinc ion in the cyclase domain.
Figure 3—figure supplement 3.

Superposition of the active sites of CylM (pink) with cyclin-dependent protein kinase CDK2 bound to a peptide substrate (green).

The insertions in the kinase domain of CylM preclude binding of the CylA peptide substrate in a similar pose.

DOI: http://dx.doi.org/10.7554/eLife.07607.013

Rate of ATP consumption in the presence of substrate peptide

In order to establish the functional relevance of the observed structural similarities between CylM and lipid kinases, we measured the kinetics for ATP hydrolysis by CylM in the presence of the substrate peptide CylLS. Using a commercially available coupled luminescence assay kit that detects adenosine diphosphate (ADP), the steady-state kinetic parameters for ATP consumption by CylM were measured affording an apparent KM value of 99 ± 6 μM for ATP and a kcat, app of 4.1 ± 0.1 min−1 (Figure 4); because poor solubility precluded saturation in the peptide substrate, these are apparent values. By way of comparison, prior studies established the kinetic parameters for the kinase domain of mTOR against the 4EBP1 peptide substrate yielding a KM of 9.5 μM for ATP and kcat of 0.91 min−1 (Tao et al., 2010). Thus, the catalytic efficiency of ATP consumption by CylM is roughly within the same order of magnitude of the basal activity of the kinase domain of mTOR (which is enhanced ∼fivefold in mTOR complex 1 [Tao et al., 2010]).
Figure 4.

Dependence of the rate of ADP production by CylM (1 μM) on ATP concentration in the presence of 100 μM CylLS.

DOI: http://dx.doi.org/10.7554/eLife.07607.014

Dependence of the rate of ADP production by CylM (1 μM) on ATP concentration in the presence of 100 μM CylLS.

DOI: http://dx.doi.org/10.7554/eLife.07607.014

Mutagenesis of potential catalytic residues involved in phosphorylation and phosphate elimination

Given the unanticipated lipid kinase fold, we focused our mechanistic studies on the CylM dehydration reaction. The aforementioned residues in the active site of CylM (Asp347, His349, Asn352, Asp364, and Lys274) are conserved in the LanM family. Their importance was investigated by replacement with Ala and assessing the activity with CylL, active site ofS as substrate. No dehydration could not be detected for any of the mutants with the exception of CylM-H349A and K274A that both produced a small amount of dehydrated CylLS as determined by MALDI-TOF MS (Figure 5 and Figure 5—figure supplements 1, 2 and Figure 5—source data 1–3).
Figure 5.

MALDI-TOF mass spectra of CylLS peptides co-expressed with CylM and CylM mutants in E. coli. M = unmodified CylLs; P = phosphorylation.

Peaks between the highlighted masses of multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 1.

DOI: http://dx.doi.org/10.7554/eLife.07607.015

All calculated masses are [M + H]. -: not observed.

DOI: http://dx.doi.org/10.7554/eLife.07607.016

All calculated masses are [M + H]. -: not observed.

DOI: http://dx.doi.org/10.7554/eLife.07607.017

All calculated masses are [M + H]. -: not observed.

DOI: http://dx.doi.org/10.7554/eLife.07607.018

M = unmodified CylLs; P = phosphorylation. Peaks between the masses of the highlighted multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 2.

DOI: http://dx.doi.org/10.7554/eLife.07607.019

M = unmodified CylLs; P = phosphorylation. Peaks between the highlighted masses of multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 3.

DOI: http://dx.doi.org/10.7554/eLife.07607.020

MALDI-TOF mass spectra of CylLS peptides co-expressed with CylM and CylM mutants in E. coli. M = unmodified CylLs; P = phosphorylation.

Peaks between the highlighted masses of multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 1. DOI: http://dx.doi.org/10.7554/eLife.07607.015

Calculated and observed masses of CylLS peptides modified by CylM and CylM mutants in E. coli.

All calculated masses are [M + H]. -: not observed. DOI: http://dx.doi.org/10.7554/eLife.07607.016

Calculated and observed masses of CylLS peptides incubated with CylM and CylM mutants in vitro for 30 min.

All calculated masses are [M + H]. -: not observed. DOI: http://dx.doi.org/10.7554/eLife.07607.017

Calculated and observed masses of CylLS peptides incubated with CylM and CylM mutants in vitro for 10 hr.

All calculated masses are [M + H]. -: not observed. DOI: http://dx.doi.org/10.7554/eLife.07607.018

MALDI-TOF mass spectra of CylLS peptides incubated with CylM and CylM phosphorylation-deficient mutants in vitro for 30 min (left) and 10 hr (right).

M = unmodified CylLs; P = phosphorylation. Peaks between the masses of the highlighted multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 2. DOI: http://dx.doi.org/10.7554/eLife.07607.019

MALDI-TOF mass spectra of CylLS peptides incubated with CylM elimination-deficient mutants in vitro for 30 min (left) and 10 hr (right).

M = unmodified CylLs; P = phosphorylation. Peaks between the highlighted masses of multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 3. DOI: http://dx.doi.org/10.7554/eLife.07607.020 CylM is distinct from canonical PIKKs in that it not only phosphorylates its substrate but also eliminates the phosphate to generate a dehydroamino acid. Previous mutagenesis studies identified four conserved residues in LanMs that are important for the phosphate elimination reaction (You and van der Donk, 2007; Ma et al., 2014). Inspection of the CylM structure shows that these four residues (Asp252, His254, Arg506, and Thr512) are in close proximity to each other despite a separation of >250 amino acids in primary sequence, and that they are situated in or immediately adjacent to the phosphorylation site (Figure 3D). Their importance was investigated using alanine substitution. Phosphorylated intermediates were detected for all four mutants, with partially dehydrated products observed for all except CylM-T512A (Figure 5 and Figure 5—figure supplements 1, 2 and Figure 5—source data 1–3). Thus, all four residues are important for phosphate elimination. Asp252 and His254 are in the P-loop, which is thought to activate NTPs for attack during hydrolysis or substrate phosphorylation by interacting with the γ-phosphate. The mutant phenotypes suggest that these residues may play a similar role of phosphate stabilization during the phosphate elimination reaction. Arg506 and Thr512 are located within the KA domain, suggesting that, in addition to stabilizing the activation loop, this domain also provides residues to assist in the elimination of phosphate. CylM thus offers insights into how an existing fold for an enzymatic activity (phosphorylation) can be adopted to carry out a second activity (elimination). The mechanism to achieve dehydration in CylM is decidedly different from that found in other lanthipeptide synthetases. In class I, the Ser and Thr side chain hydroxyl groups are activated by glutamylation in a glutamyl-tRNA-dependent process (Garg et al., 2013; Ortega et al., 2015). Class III and IV lanthipeptide synthetases are made up of separate Ser/Thr protein kinase, phosphoSer/phosphoThr elimination, and cyclase domains that are readily recognized by sequence homology (Goto et al., 2010). The distinct phosphorylation and elimination domains in these latter enzymes require the phosphorylated peptides to translocate from the kinase to the lyase active site, accounting for the observation of phosphorylated intermediates (Jungmann et al., 2014). The adjacency of the phosphorylation and elimination active sites in CylM provides an explanation for the lack of observed phosphorylated substrate peptides as intermediates in LanM catalysis if elimination occurs faster than peptide dissociation (Thibodeaux et al., 2014). To further investigate the elimination step, a mixture of phosphorylated CylLS peptides carrying different numbers of phosphate esters was obtained by co-expression of CylLS with the elimination-deficient CylM-R506A mutant in E. coli. The purified phosphorylated peptides were then incubated with wild-type CylM. Without addition of nucleotides, CylM did not eliminate the phosphates. However, when ADP or ADP analogs were supplied, the phosphorylated peptides were converted to dehydrated CylLS peptides (Figure 6 and Figure 6—figure supplements 1, 2). Collectively, our results are consistent with an ordered kinetic mechanism in which ADP needs to bind before the phosphorylated peptide or in which the presence of ADP within the active site increases the affinity for phosphorylated peptide intermediates. The results are also consistent with processive phosphorylation and elimination steps since ADP present in the active site from the phosphorylation reaction is required for the phosphate elimination reaction.
Figure 6.

MALDI-TOF mass spectra of phosphorylated CylLS intermediates incubated with CylM in the absence of nucleotides (black trace), and in the presence of AMP (adenosine 5′-monophosphate disodium salt) (blue trace), non-hydrolyzable ADP (adenosine 5′-(β-thio)diphosphate trilithium salt) (magenta trace), or non-hydrolyzable ATP (adenosine 5′-(β,γ-imido)triphosphate lithium salt hydrate) (red trace).

M = unmodified CylLs; P = phosphorylation. The data are shown for non-hydrolyzable analogs of ADP and ATP to distinguish whether the observed activity is due to the presence of these nucleotides, or to the activated phosphor-anhydride groups of ADP/ATP (see ‘Materials and methods’ for more information). See also Figure 6—figure supplement 1.

DOI: http://dx.doi.org/10.7554/eLife.07607.021

M = unmodified CylLs; P = phosphorylation.

DOI: http://dx.doi.org/10.7554/eLife.07607.022

M = unmodified CylLs; P = phosphorylation. Not only are the phosphates eliminated from pSer/pThr, ADP also is used to dehydrate non-phosphorylated Ser/Thr to afford fully, fourfold dehydrated peptide. See ‘Materials and methods’ for further discussion.

DOI: http://dx.doi.org/10.7554/eLife.07607.023

MALDI-TOF mass spectra of phosphorylated CylLS intermediates incubated with CylM in the absence of nucleotides (black trace), and in the presence of AMP (adenosine 5′-monophosphate disodium salt) (blue trace), non-hydrolyzable ADP (adenosine 5′-(β-thio)diphosphate trilithium salt) (magenta trace), or non-hydrolyzable ATP (adenosine 5′-(β,γ-imido)triphosphate lithium salt hydrate) (red trace).

M = unmodified CylLs; P = phosphorylation. The data are shown for non-hydrolyzable analogs of ADP and ATP to distinguish whether the observed activity is due to the presence of these nucleotides, or to the activated phosphor-anhydride groups of ADP/ATP (see ‘Materials and methods’ for more information). See also Figure 6—figure supplement 1.
Figure 6—figure supplement 1.

MALDI-TOF mass spectra of CylLS peptides incubated with CylM in the absence of nucleotides (black trace), and in the presence of AMP (adenosine 5′-monophosphate disodium salt) (blue trace), non-hydrolyzable ADP (adenosine 5′-(β-thio)diphosphate trilithium salt) (magenta trace), or non-hydrolyzable ATP (adenosine 5′-(β,γ-imido)triphosphate lithium salt hydrate) (red trace).

M = unmodified CylLs; P = phosphorylation.

DOI: http://dx.doi.org/10.7554/eLife.07607.022

DOI: http://dx.doi.org/10.7554/eLife.07607.021

MALDI-TOF mass spectra of CylLS peptides incubated with CylM in the absence of nucleotides (black trace), and in the presence of AMP (adenosine 5′-monophosphate disodium salt) (blue trace), non-hydrolyzable ADP (adenosine 5′-(β-thio)diphosphate trilithium salt) (magenta trace), or non-hydrolyzable ATP (adenosine 5′-(β,γ-imido)triphosphate lithium salt hydrate) (red trace).

M = unmodified CylLs; P = phosphorylation. DOI: http://dx.doi.org/10.7554/eLife.07607.022

MALDI-TOF mass spectra of phosphorylated CylLS intermediates incubated with CylM in the absence (black trace) or presence of ADP (magenta trace).

M = unmodified CylLs; P = phosphorylation. Not only are the phosphates eliminated from pSer/pThr, ADP also is used to dehydrate non-phosphorylated Ser/Thr to afford fully, fourfold dehydrated peptide. See ‘Materials and methods’ for further discussion. DOI: http://dx.doi.org/10.7554/eLife.07607.023

Potential implications for eukaryotic lanthionine cyclase (LanC)-like proteins

The unexpected structural homology of bacterial LanM proteins with eukaryotic lipid kinases may also have implications for the function of three mammalian LanC-like (LanCL) proteins (Chung et al., 2007; Sturla et al., 2009; Zhong et al., 2012; Huang et al., 2014). LanC proteins are stand-alone Lan cyclases such as NisC (Figure 2B). Both LanCL1 and LanCL2 bind glutathione (Chung et al., 2007), with the thiol of glutathione coordinating the conserved zinc site in LanCL1 (Zhang et al., 2009). Hence, the human proteins also appear to activate a thiol, like the LanC proteins and the homologous C-terminal domains of the bacterial LanM enzymes. Although the precise functions of LanCL proteins are currently still unresolved, human LanCL1 has been shown to be important for antioxidant activity that is key to neuronal survival (Huang et al., 2014). Furthermore, recent studies indicated regulation of and physical interactions between the human LanCL2 and the kinases Akt and mTORC2 (Zeng et al., 2014). The structure of CylM shows that its LanC domain interacts with the activation loop and the kα11 helix of the kinase domain. These observations provide a platform to further investigate the intermolecular interaction of LanCL proteins with mammalian kinases, such as mTOR, that have structural homology with the CylM kinase domain.

Conclusion

The structural and biochemical analysis of the lanthipeptide synthetase CylM provided here presents the first molecular picture for installation of the thioether crosslinks in the large family of class II lanthipeptides. Leader-dependent binding of the substrate would template movement of the core peptide between the dehydration and cyclization domains. The immediacy of the phosphorylation and phosphate-elimination sites allows for both reactions to occur in a processive manner to yield the dehydroamino residue, which can then be consigned to the cyclization domain for subsequent Michael-type addition reaction. The ordered activation loop in CylM precludes the need for an activation-induced conformational change, observed for other lipid kinases, as binding of the substrate is dictated largely by the leader sequence (Abts et al., 2013; Thibodeaux et al., 2015). The structure of the CylM protein now allows installation of probes to monitor the movement of the substrates between the two active sites in LanM proteins to better understand the substantial motions of the substrate peptides during catalysis (Thibodeaux et al., 2014). In addition, it facilitates inhibitor design to prevent biosynthesis of the cytolysin virulence factor in pathogenic E. faecalis, one of the causative agents of vancomycin-resistant enterococcal infections (Van Tyne et al., 2013).

Materials and methods

General methods

The genes encoding CylM, CylLL, and CylLS were synthesized by GeneArt (Invitrogen, Carlsbad, CA) with codon usage optimized for E. coli expression. All polymerase chain reactions were carried out on a C1000 thermal cycler (Bio-Rad, Hercules, CA). DNA sequencing was performed by ACGT, Inc (Wheeling, IL). Preparative HPLC was performed using a Waters Delta 600 instrument equipped with appropriate columns. LC-ESI-Q/TOF MS analyses were conducted using a Synapt G2 MS system equipped with Acquity UPLC (Waters, Milford, MA). MALDI-TOF MS was carried out on a Bruker Daltonics UltrafleXtreme MALDI-TOF/TOF mass spectrometer (Bruker, Billerica, MA). C18 zip-tip pipet tips were obtained from Millipore to desalt samples for MS analysis. Luminescence in 96-well plates was measured with a Synergy H4 Microplate Reader (BioTek, Winooski, VT). Oligonucleotides were purchased from Integrated DNA Technologies (Coralville, IA). Restriction endonucleases, DNA polymerases, T4 DNA ligase, and media components were obtained from New England Biolabs (Ipswich, MA) and Difco laboratories (Franklin Lakes, NJ), respectively. Chemicals were ordered from Sigma Aldrich (St Louis, MI) or Fisher Scientific (Hampton, NH). The ADP-Glo MAX Assay kit was obtained from Promega (Madison, WI). E. coli DH5α and E. coli BL21 (DE3) cells were used as host for cloning and plasmid propagation, and host for expression, respectively. Expression vectors (pET15b and pRSFDuet-1) were obtained from Novagen (Billerica, MA).

Cloning of cylM, cylL, and cylL genes into expression vectors

The cylM gene was cloned into the multiple cloning site 1 of a pRSFDuet-1 vector using EcoRI and NotI restriction sites to generate pRSFDuet-1/CylM plasmid. Primer sequences used are listed in Table 1. CylL and cylL genes were cloned into a pET15b vector using NdeI and BamHI restriction sites, resulting in pET15b/CylLL or pET15b/CylLS plasmids, respectively.
Table 1.

Primer sequences used for cloning of cylM and its mutants

DOI: http://dx.doi.org/10.7554/eLife.07607.024

Primer namePrimer sequence (5′-3′)
CylM_EcoRI_Duet_FPAAAAA GAATTCG GAAGATA ATCTGATTAA T
CylM_NotI_Duet_RPAAAAA GCGGCCGC TTACAGT TCAAACAGCA G
CylM_D252A_QC_FPAGGGT GCA AGCCAT AGCCGTGGTAAAACCGTT AGC
CylM_D252A_QC_RPATGGCT TGC ACCCT GGC TTTCGCTAAT GCTATTCAGT
CylM_H254A_QC_FPGATAGC GCT AGCCGT GGT AAAACCGTT AGCACCCTG
CylM_H254A_QC_RPACGGCT AGC GCTA TC ACCCTGGC TTTCGCTAAT G
CylM_D347A_QC_FPGTTACC GCT CTGCAT TATGAAAACATCATTGCCCATGGC
CylM_D347A_QC_RPAT GCAG AGC GGT AAC ATTAAAC AGAAAGGCAA TGCCAATCAG
CylM_H349A_QC_FPCCGATCTG GCT TATGAAAA CATCATTGCCCATGGCGAATA
CylM_H349A_QC_RPTTTTCATA AGC CAGATCGG T AACATTAAAC AGAAAGGCAA TGCCAAT
CylM_N352A_QC_FPCATTATGAA GCC ATCATTGC CCATGGCGAATATCCG GTGATT
CylM_N352A_QC_RPGCAATGAT GGC TTCATAATG CAGATCGGT AACATTAAAC AGAAAGGC
CylM_D364A_QC_FPGTGATTATT GCT AATGAAACC TTTTTTCAGCAGAATATTCCGATTGAATTT
CylM_D364A_QC_RPGGTTTC ATT AGC AATA ATCAC CGGAT ATTCGCCATG GGC
CylM_R506A_QC_FPTGATTGTG GCC AATGTTAT TCGTCCGACCCAGCGTTA
CylM_R506A_QC_RPA TAACATT GGC CACAATCA GA TTCTGCAGAT TATTATTAAT ATAGGCCAGA
CylM_T512A_QC_FPGTCCG GCC CAG C GTTATGCAGATATGCTGGAA TTTAGC
CylM_T512A_QC_RPCTG GGCCGGAC GAA TAACATTGCG CACAATCAGA
CylM_NdeI_FPAAAAA CATATG GAAGATA ATCTGATTAA T
CylM625_KpnI_RPAAAAA GGTACC TTA GTACGGGTTA TAAATATTCA G
Primer sequences used for cloning of cylM and its mutants DOI: http://dx.doi.org/10.7554/eLife.07607.024

Construction of pRSFDuet-1 derivatives for expression of CylM mutants and for co-expression of CylLS with CylM mutants

The plasmids pRSFDuet-1/CylM-D347A, pRSFDuet-1/CylM-H349A, pRSFDuet-1/CylM-N352A, pRSFDuet-1/CylM-D364A, pRSFDuet-1/CylM-D252A, pRSFDuet-1/CylM-H254A, pRSFDuet-1/CylM-R506A, pRSFDuet-1/CylM-T512A, pRSFDuet-1/CylLS/CylM-D347A-2, pRSFDuet-1/CylLS/CylM-H349A-2, pRSFDuet-1/CylLS/CylM-N352A-2, pRSFDuet-1/CylLS/CylM-D364A-2, pRSFDuet-1/CylLS/CylM-D252A-2, pRSFDuet-1/CylLS/CylM-H254A-2, pRSFDuet-1/CylLS/CylM-R506A-2 and pRSFDuet-1/CylLS/CylM-T512A-2 were generated using QuikChange methodology using pRSFDuet-1/CylM and pRSFDuet-1/CylLS/CylM-2 as templates, respectively (Tang and van der Donk, 2013). Primer sequences are listed in Table 1.

Construction of the pRSFDuet-1/CylLS/CylM-1-625-2 plasmid

The cylM-1-625 gene was amplified and cloned into the MCS2 of pRSFDuet-1/CylLS to generate pRSFDuet-1/CylLS/CylM-1-625-2. Primer sequences are listed in Table 1.

Expression and purification of His6-CylLL and His6-CylLS peptides

E. coli BL21 (DE3) cells were transformed with pET15b/CylLL or pET15b/CylLS and plated on a LB plate containing 100 mg/l ampicillin. A single colony was picked and grown in 20 ml of LB in the presence of ampicillin at 37°C for 12 hr. The cell suspension was directly used to inoculate 2 l of fresh LB media. Cells were cultured at 37°C until the OD at 600 nm reached 0.5, and isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mM. Cells were cultured at 37°C for another 3–5 hr before harvesting. The cell pellet was resuspended at room temperature in LanA start buffer (20 mM NaH2PO4, 500 mM NaCl, 0.5 mM imidazole, 20% glycerol, pH 7.5 at 25°C) and lysed by sonication. The resulting sample was then centrifuged at 23,700×g for 30 min and supernatant was discarded. The remaining pellet was resuspended in LanA buffer 1 (6 M guanidine hydrochloride, 20 mM NaH2PO4, 500 mM NaCl, 0.5 mM imidazole, pH 7.5 at 25°C) and sonicated. Centrifugation was performed afterwards to pellet the debris and the soluble portion was passed through 0.45-µm syringe filters. His-tagged peptides were purified by immobilized metal ion affinity chromatography (IMAC) eluting with LanA elute buffer (4 M guanidine hydrochloride, 20 mM NaH2PO4, 500 mM NaCl, 1 M imidazole , pH 7.5 at 25°C). The eluted fractions were desalted by preparative HPLC using a Waters Delta-pak C4 column (15 µm 300 Å 25 × 100 mm). The resulting peptides were lyophilized to dryness and kept at −20°C for future use.

Expression and purification of His6-CylM and CylM mutants

E. coli BL21 (DE3) cells were transformed with pRSFDuet-1/CylM, pRSFDuet-1/CylM-D347A, pRSFDuet-1/CylM-H349A, pRSFDuet-1/CylM-N352A, pRSFDuet-1/CylM-D364A, pRSFDuet-1/CylM-D252A, pRSFDuet-1/CylM-H254A, pRSFDuet-1/CylM-R506A or pRSFDuet-1/CylM-T512A, and plated on a LB plate containing 50 mg/l kanamycin. A single colony was picked and grown in 20 ml of LB in the presence of kanamycin at 37°C for 12 hr. The cell suspension was directly used to inoculate 2 l of LB and cells were cultured at 37°C until the OD at 600 nm reached 0.5. The culture was cooled down on ice followed by the addition of IPTG to a final concentration of 0.1 mM. Cells were cultured at 18°C for additional 18 hr before harvesting. The harvested cells were resuspended on ice in LanM start buffer (20 mM HEPES, 1 M NaCl, pH 7.5 at 25°C) and lysed using a homogenizer. Insoluble debris was removed by centrifugation at 23,700×g for 45 min at 4°C and the supernatant was passed through 0.45-µm syringe filters. His-tagged proteins were purified by IMAC, eluting with a linear concentration gradient of imidazole from 30 mM to 200 mM. The eluted fractions were analyzed using SDS-PAGE. Fractions containing the desired protein were combined and concentrated using a centrifugal filtering device, and the buffer was exchanged to LanM start buffer using a gel-filtration column. Protein concentration was quantified by its absorbance at 280 nm. The extinction coefficient for His6-CylM was calculated as 140,110 M−1 cm−1. Aliquoted protein solutions were flash-frozen and kept at −80°C for further usage.

Expression and purification of His6-CylLS peptides co-expressed with CylM mutants

E. coli BL21 (DE3) cells were transformed with pRSFDuet-1/CylLS/CylM-D347A-2, pRSFDuet-1/CylLS/CylM-H349A-2, pRSFDuet-1/CylLS/CylM-N352A-2, pRSFDuet-1/CylLS/CylM-D364A-2, pRSFDuet-1/CylLS/CylM-D252A-2, pRSFDuet-1/CylLS/CylM-H254A-2, pRSFDuet-1/CylLS/CylM-R506A-2, pRSFDuet-1/CylLS/CylM-T512A-2, or pRSFDuet-1/CylLS/CylM-1-625-2, and plated on a LB plate containing 50 mg/l kanamycin. A single colony was picked and grown in 10 ml of LB in the presence of kanamycin at 37°C for 12 hr. The cell suspension was directly used to inoculate 1 l of LB and cells were cultured at 37°C until the OD at 600 nm reached 0.5. The culture was cooled down on ice followed by the addition of IPTG to a final concentration of 0.1 mM. Cells were cultured at 18°C for 18 hr before harvesting. To obtain both fully modified and linear CylLS as well as possible intermediates (partially modified CylLS) and reduce the bias introduced by peptide solubility, harvested cells were resuspended and lysed directly in LanA buffer 1 (6 M guanidine hydrochloride, 20 mM NaH2PO4, 500 mM NaCl, 0.5 mM imidazole, pH 7.5 at 25°C) by sonication. Debris was removed by centrifugation and the soluble portion was passed through 0.45-µm syringe filters. His-tagged CylLS was purified by IMAC, eluting with LanA elute buffer (4 M guanidine hydrochloride, 20 mM NaH2PO4, 500 mM NaCl, 1 M imidazole, pH 7.5 at 25°C). The eluted fractions were desalted with Strata-X polymeric reverse phase SPE columns and lyophilized to dryness.

Reconstitution of CylM activity in vitro

Presumably due to high hydrophobicity, the solubility of linear CylLL or CylLS peptides is extremely poor. For enzyme assays, 2 mg/ml peptide suspension was made in deionized water as stock solution for both peptides. The stock solution was vortexed to a homogenized suspension each time before any peptide was taken. However, given the presence of precipitation, the concentration of CylLL or CylLS peptides could not be tightly controlled. To reconstitute the activity of CylM in vitro, 20 µM of linear peptides were supplied in a reaction vessel with 4 mM MgCl2, 2 mM ATP, 2 mM DTT, 1 × 10−5 U thrombin (to remove the His-tag in situ) and 50 mM HEPES (pH 7.5), followed by the addition of CylM to a final concentration of 0.5 µM. Reactions were incubated at room temperature for 4 hr. Control reactions were set up with all other components in the absence of CylM. Each sample was zip-tipped and analyzed by MALDI-TOF MS. Aliquoted samples were treated by CylA (serine protease encoded in the biosynthetic pathway of cytolysin) to remove the leader peptides, and the resulting core peptides were analyzed by LC-MS or LC-MS/MS. ESI MS analysis confirmed a mass shift of 144 or 126 Da for CylLL, corresponding to a loss of 8 or 7 water molecules, with the 7-dehydrated peptide as the major product, and a mass shift of 72 Da for CylLS, corresponding to a loss of 4 water molecules (Figure 1—figure supplement 1). The results were consistent with the reported mass of CylLL‘ and CylLS’ as well as our previous observations using an E. coli co-expression system, where 7 dehydrations and 4 dehydrations were detected (Booth et al., 1996; Tang and van der Donk, 2013). Tandem MS (MS/MS) analysis indicated the desired ring systems were formed for both peptides (Figure 1—figure supplement 2).

In vitro modification of CylLS by CylM mutants

CylLS peptide (20 µM) was supplied to a reaction vessel in the presence of 4 mM MgCl2, 2 mM ATP, 2 mM DTT, 1 × 10−5 U thrombin (to remove the His-tag in situ) and 50 mM HEPES (pH 7.5). CylM and CylM mutant proteins were then added to a final concentration of 0.5 µM. Reactions were incubated at room temperature and aliquots were quenched by adding formic acid to a final concentration of 0.5% at desired time points. Each sample was then zip-tipped and analyzed by MALDI-TOF MS. With linear CylLS serving as the substrate, wild-type CylM finished the modification by eliminating 4 water molecules within 30 min of incubation when characterized using MALDI-TOF MS. In comparison, the four phosphorylation-deficient mutants were unable to convert the starting material into modified peptide using the same set up (Figure 5—figure supplement 1). A small amount of dehydrated product was observed for CylM-H349A, which afforded partially dehydrated intermediates when analyzed using the E. coli co-expression system (Figure 5—figure supplement 1). We further increased the incubation time to 10 hr at room temperature to facilitate the detection of any minimal level activity. Indeed, almost full modification of CylLS was achieved by CylM-H349A (Figure 5—figure supplement 1). Partially modified products with one dehydration and one phosphorylation were also detected for CylM-N352A, but CylLS remained unmodified in the presence of CylM-D347A and CylM-D364A even with elongated incubation time (Figure 5—figure supplement 1).
Figure 5—figure supplement 1.

MALDI-TOF mass spectra of CylLS peptides incubated with CylM and CylM phosphorylation-deficient mutants in vitro for 30 min (left) and 10 hr (right).

M = unmodified CylLs; P = phosphorylation. Peaks between the masses of the highlighted multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 2.

DOI: http://dx.doi.org/10.7554/eLife.07607.019

In vitro characterization of the four elimination-deficient mutants of CylM also provided similar phenotypes as what was observed using the co-expression system, except that CylM-H254A afforded fully modified CylLS after elongated incubation period (Figure 5—figure supplement 2), indicating that mutating histidine 254 to alanine slows down but does not abolish the phosphate-elimination activity of CylM. The T512A mutant did not eliminate the phosphate even with increased reaction time (Figure 5—figure supplement 2), suggesting that Thr512 is critical for the elimination activity of CylM.
Figure 5—figure supplement 2.

MALDI-TOF mass spectra of CylLS peptides incubated with CylM elimination-deficient mutants in vitro for 30 min (left) and 10 hr (right).

M = unmodified CylLs; P = phosphorylation. Peaks between the highlighted masses of multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 3.

DOI: http://dx.doi.org/10.7554/eLife.07607.020

Elimination activity of CylM in the presence of adenosine derivatives

Phosphorylated CylLS peptides carrying different numbers of phosphate esters were obtained by co-expression of His6-CylLS with CylM elimination-deficient mutant CylM-R506A. The IMAC-purified peptide mixture was dissolved in deionized water to make a 350 µM stock solution. Non-hydrolyzable ATP (adenosine 5′-(β,γ-imido)triphosphate lithium salt hydrate), non-hydrolyzable ADP (adenosine 5′-(β-thio)diphosphate trilithium salt) and AMP (adenosine 5′-monophosphate disodium salt) were reconstituted in deionized water and a stock solution of 20 mM was obtained for each. For elimination reactions, CylM was present at a final concentration of 0.5 µM in the presence of 1 mM MgCl2, 2 mM DTT and 50 mM HEPES (pH 7.5). Then adenosine derivatives (final concentration 500 µM) or deionized water (negative control) were added, followed by phosphorylated CylLS peptide to a final concentration of 35 µM, and the assay was incubated at room temperature for 2 hr. Parallel control reactions were set up using linear CylLS with a peptide concentration of 20 µM in the presence of 1 × 10−5 U thrombin (to remove the His-tag in situ). Samples were zip-tipped and analyzed by MALDI-TOF MS (Figure 6—figure supplement 1). Non-hydrolyzable adenosine derivatives were used for analysis of the elimination activity because we determined that CylM could use both ATP and ADP to dehydrate its substrates (i.e., both ATP and ADP can be used for phosphorylation). Hence, when the mixture of CylLS peptides that carry 1–3 phosphate esters were supplied to CylM in the presence of ATP or ADP, both elimination and dehydration reactions proceeded, which complicated the outcome and precluded data interpretation. For example, when ADP was supplied instead of non-hydrolyzable ADP, only fully (fourfold) dehydrated CylLS was observed (Figure 6—figure supplement 2). Since the phosphorylated peptides carried only 1–3 phosphate esters, the additional dehydrations resulted from conversion of non-phosphorylated Ser/Thr to Dha/Dhb. Therefore, to study the elimination reaction in isolation, non-hydrolyzable ATP and ADP analogs were used.
Figure 6—figure supplement 2.

MALDI-TOF mass spectra of phosphorylated CylLS intermediates incubated with CylM in the absence (black trace) or presence of ADP (magenta trace).

M = unmodified CylLs; P = phosphorylation. Not only are the phosphates eliminated from pSer/pThr, ADP also is used to dehydrate non-phosphorylated Ser/Thr to afford fully, fourfold dehydrated peptide. See ‘Materials and methods’ for further discussion.

DOI: http://dx.doi.org/10.7554/eLife.07607.023

Overexpression, purification, and crystallization of CylM

Single colonies of chemically competent E. coli Rosetta 2 cells, transformed with the pRSFDuet-1/CylM plasmid, were grown in LB media supplemented with kanamycin (50 µg/ml) and chloramphenicol (25 µg/ml). A 6 ml starter culture was grown overnight and used to inoculate 1 l of LB media supplemented with the same antibiotic. Liquid cultures were grown at 37°C with vigorous shaking, and protein production was induced with the addition of 0.5 mM IPTG when the OD600 reached 0.5 followed by further shaking for additional 20 hr at 18°C and 200 rpm. Cell pellets were harvested from the cultures by centrifugation at 4°C, followed by suspension of the pellet in ∼30 ml of buffer (500 mM NaCl, 10% glycerol, 20 mM Tris, pH 8.0). Frozen cell pellets were thawed and lysed by sonication, and the lysates were clarified by centrifugation at 4°C. The clear supernatant containing the soluble fraction was loaded onto a 5 ml immobilized metal ion affinity resin column (Hi-Trap Ni-NTA, GE Healthcare) pre-equilibrated with binding buffer (1 M NaCl, 5% glycerol, 20 mM Tris, pH 8.0). The column was washed with 50 ml of 12% elution buffer (1 M NaCl, 250 mM imidazole, 20 mM Tris, pH 8.0), and eluted by a linear gradient. Fractions containing the highest purity protein, as judged by Coomassie-stained SDS-PAGE, were pooled and further purified by size exclusion chromatography (Superdex Hiload 200 16/60, GE Healthcare) in 500 mM KCl, 20 mM HEPES, pH 7.5 buffer. The purified protein was concentrated using Amicon Ultra-4 centrifugal filters (10 KDa molecular weight cut-off, Millipore) and stored in liquid nitrogen until needed. The final concentration was quantified by Bradford analysis (Thermo Scientific). Crystals of LanM were obtained by hanging drop vapor diffusion method, by mixing 1 μl of protein (concentration of 2–6 mg/ml) with an equal volume of precipitant of either 0.2 M CaCl, 0.1 M HEPES pH 7.5, 10 mM betaine hydrochloride, and 28% PEG 400 (condition 1) or 0.2 M KCl, 0.05 M HEPES pH7.5, 10 mM barium chloride, and 33% 5/4 PO/OH (condition 2). Crystals were supplemented with either PEG 400 or 5/4 PO/OH to a final concentration of 35% (vol/vol) prior to vitrification by direct immersion in liquid nitrogen. Macro- and micro-seeding facilitated the formation of crystals suitable for diffraction data collection. SeMet CylM was expressed, purified, and crystallized in a similar manner. Native and SeMet data were collected at Sector 21 ID (LS-CAT, Advanced Photon Source, Argonne National Labs, IL) and data were integrated and scaled using HKL2000 (Otwinowski et al., 2003) or XDS (Kabsch, 2014). Crystallographic phases were determined by single wavelength anomalous diffraction methods from data collected on crystals of SeMet CylM to a resolution limit of 2.7 Å. Heavy atom sites were located using the SHELX (Sheldrick, 2010) suite of programs and refinement of heavy atom parameters in SHARP (Bricogne et al., 2003) yielded an initial figure of merit of 0.273. Multiple rounds of automated and manual model building using COOT (Emsley et al., 2010), interspersed with rounds of crystallographic refinement using REFMAC5 (Murshudov et al., 2011), resulted in convergence to the near final model (free R factor of 0.30). Ligand and water molecules were added at this stage and refinement was completed using BUSTER (Blanc et al., 2004). The validity of all models was routinely determined using MOLPROBITY (Chen et al., 2010) and by using the free R factor to monitor improvements during building and crystallographic refinement. Relevant data collection, phasing, and refinement statistics may be found in Table 2.
Table 2.

Data collection, phasing, and refinement statistics

DOI: http://dx.doi.org/10.7554/eLife.07607.025

NativeSeMet
Data collection
 Space groupP212121P212121
 Unit cell: a, b, c (Å)51.2, 90.7, 246.451.2, 90.9, 246.2
 Resolution (Å)*50.00–2.2 (2.24–2.2)50.00–2.8 (2.85– 2.8)
 Total reflections359,303169,660
 Unique reflections58,18025,354
 Rsym (%)6.3 (67.0)6.1 (53.8)
 I/σ(I)19.1 (1.7)16.7 (2.1)
 Completeness (%)97.9 (87.6)96.0 (88.4)
 Redundancy6.2 (5.1)6.0 (5.9)
Refinement
 Resolution (Å)25.0–2.2
 No. reflections used51,874
 Rwork/Rfree23.7/26.8
Number of atoms
 Protein7251
 Solvent160
 Metal/Nucleotide1/23
B-factors
 Protein52.9
 Solvent32.4
 Metal/Nucleotide54.1/62.3
R.m.s deviations
 Bond lengths (Å)0.011
 Bond angles (°)1.54

Highest resolution shell is shown in parenthesis.

R-factor = Σ(|Fobs| − k|Fcalc|)/Σ |Fobs|and R-free is the R value for a test set of reflections consisting of a random 5% of the diffraction data not used in refinement.

Data collection, phasing, and refinement statistics DOI: http://dx.doi.org/10.7554/eLife.07607.025 Highest resolution shell is shown in parenthesis. R-factor = Σ(|Fobs| − k|Fcalc|)/Σ |Fobs|and R-free is the R value for a test set of reflections consisting of a random 5% of the diffraction data not used in refinement.

ADP production by CylM

Stock solutions of 800 µM ATP and ADP were prepared by diluting the Ultra Pure ATP and ADP supplied with the ADP-Glo MAX Assay kit (Promega) in 1× reaction buffer (20 mM MgCl2, 2 mM DTT, and 50 mM HEPES pH 7.5). Mixtures of 50 µl of ATP (800 µM) and ADP were made in which the final ADP content varied from 0 to 20% (0, 8, 16, 24, 32, 40, 80, and 160 μM), which represents the percent conversion of ATP to ADP in the kinetic experiments. These standard solutions were designated the 800 μM series. Mixtures in a 400 µM series were prepared by diluting 25 µl of the 800 µM series samples with 25 µl 1× reaction buffer. Similarly, 200, 100, 50, and 25 µM series (25 µl each) were prepared. To each sample, 25 µl of the ADP-Glo Reagent was added and incubated for 40 min, followed by the addition of 50 µl of ADP-Glo Max Detection Reagent and incubation for 1 hr. All samples were then transferred into a white 96 well plate and the luminescence was measured by a plate reader. Standard curves (25, 50, 100, 200, 400, and 800 µM series) were created to correlate the ADP concentration with the luminescence. To measure the ATP consumption of CylM in vitro, 25 µl of reaction mixtures were prepared consisting of 100 µM linear peptide, 1 µM CylM, and 1× reaction buffer, followed by the addition of ATP to final concentrations of 25, 50, 100, 200, 400, and 800 µM. Control reactions were set up with all other components in the absence of CylM. Reactions were incubated at 25°C for 1, 2, 3, and 4 min before being stopped by adding 25 µl of ADP-Glo Reagent, which depletes the remaining ATP. After incubation for 40 min, ADP-Glo Max Detection Reagent (50 µl) was then added, the samples were incubated for 1 hr, and the luminescence was measured. ADP production in each sample was calculated by applying the corresponding standard curve. The curve of ATP consumption of CylM against ATP concentration was fitted using OriginPro 2015. All reactions were carried out in duplicate. eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for submitting your work entitled “The enterococcal cytolysin synthetase has an unanticipated lipid kinase fold” for peer review at eLife. Your submission has been favorably evaluated by Richard Losick (Senior Editor), a Reviewing Editor, and two reviewers. The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Two reviewers have read your manuscript and they both found its findings to be interesting and significant. The reviewers have also provided some useful comments for you to consider during revision. Specifically, they struggled to visualize the structural relatedness between CylM and lipid kinases as presented in Figure 3. It therefore seems important for you to improve this section of the manuscript and its presentation. In complementary ways, both reviewers also raised concerns about whether CylM truly exhibits kinase-like activities that would support the claim that structural homology implies functional homology. The reviewers have suggested some specific experiments to address this point, as well as to test whether the role of ADP in the CylM mechanism might be more than just structural. Hopefully, you can perform these additional experiments to more directly evaluate the kinase-like functions of CylM and the potential role of the ADP product in the second phosphate elimination step. Some of the specific comments of the reviewers are included below. Summary of reviews: The article by Dong et al. reveals the first structural information on a LanM lanthipeptide synthetase. The authors reveal that the enzyme contains a dehydratase domain that shares homology with lipid kinases. The authors provide a strong rationale for how the enzyme carries out a concerted phosphorylation, and elimination reaction. The van der Donk laboratory has a strong background in the study of these enzymes, and this structural work provides a strong underpinning to much of both theirs and others’ work in the field. The work is overall of high quality. However, there are a few points that need to be addressed before the work is ready for publication. Important revisions: 1) The authors do not show in the work the rates of ATP and peptide substrate turnover by the enzyme, and it would be interesting to see how effective this enzyme is compared to other protein and lipid kinases. The authors note that the activation loop appears to be maintained in an ordered active conformation. It would be useful to measure turnover of ATP to confirm that CylM indeed has reaction rates comparable to other protein or lipid kinases. A simple experiment could be devised to measure the rates of ATP to ADP turnover, and compare this to other lipid or protein kinases. 2) The authors show detailed structural comparisons between CylM and PI3Kγ in Figure 3. The authors describe this in words; however, in the figure it is very difficult to make out the insertions specific to CylM (specifically the overlay presented in Figure 3A). It would potentially be useful to see PI3K, CylM, and mTOR side by side to see the insertions present in CylM compared to PI3K, and its similarity to mTOR. Additionally, due to the use of multiple colors and the large format representation of secondary structure, it is very difficult to visualize the structural similarities in Figure 3A. The representation would benefit by superimposing the two structures using narrow loops (not ribbons) of small width, and in only two colors with proper depth queuing, in order to visualize the backbone. 3) One fascinating element of this manuscript was the activity dependence of ADP by the WT phosphate elimination. The authors include the use of non-hydrolyzable ADPγS, but offer little more discussion. Why didn't the authors use ADP alone? What other nucleotide analogs are sufficient for this reaction? Is the role merely structural (as implied) or could there be a catalytic element? Given that ADP is the product of the kinase 1/2 reaction, this special relationship deserves more thorough investigation. Minor points: 1) The discussion of LanC at the end of the Discussion seems to be premature. An alignment of the mTOR kinase domain with LanC would be essential to underscore if the LanC domain would be compatible for binding. As a side note the authors do not define LanC as the cyclase domain, and clarification in the wording of the text would be useful for readers outside of the field. 2) The authors have carried out very detailed analysis of substrates and phosphate ester analogs for both the wild type and mutant enzymes. What are the side products shown in Figure 4 for the mutants CylM D252A, and L247A? It would be interesting to see if these are potential trapped intermediates, or if these are contaminants from a given protein preparation. 3) For many lipid kinases it has been difficult to crystallise enzymes in the presence of nucleotide analogs. It would be useful to generate an omit map for AMPPNP, to give readers confidence in the occupancy of this pocket. 1) The authors do not show in the work the rates of ATP and peptide substrate turnover by the enzyme, and it would be interesting to see how effective this enzyme is compared to other protein and lipid kinases. The authors note that the activation loop appears to be maintained in an ordered active conformation. It would be useful to measure turnover of ATP to confirm that CylM indeed has reaction rates comparable to other protein or lipid kinases. A simple experiment could be devised to measure the rates of ATP to ADP turnover, and compare this to other lipid or protein kinases. A kinetic analysis of ATP consumption by CylM in the presence of its substrate CylLS was performed according to the reviewer’s suggestion. We confirmed that CylM exhibits kinase-like activities with an apparent KM value of 99 µM for ATP and an apparent kcat of 4.08 min‒1. The solubility of the substrate does not allow determination of its kinetic constants, but the kinetic parameters varying the ATP concentration are of the same magnitude of what were reported for the kinase domain of mTOR in the presence of the 4EBP1 peptide substrate. We felt that that was the best kinase for comparison since it is a lipid kinase-like enzyme but its substrates are proteins/peptides (like CylM). We believe these new data and the additional paragraph we added into the manuscript provides the reader with an idea regarding the overall kinetics of the kinase activity of CylM. Of course, the enzyme catalyzes more than just the phosphorylation (also elimination and cyclization) and it does so at multiple sites on its substrate. Hence, a detailed comparison with dedicated protein kinases is not readily accomplished. Nevertheless, the ordered loop observed in CylM does not seem to accelerate ATP hydrolysis significantly with this particular set up. We appreciate the suggestion of performing such an experiment. 2) The authors show detailed structural comparisons between CylM and PI3Kγ in . The authors describe this in words; however, in the figure it is very difficult to make out the insertions specific to CylM (specifically the overlay presented in ). It would potentially be useful to see PI3K, CylM, and mTOR side by side to see the insertions present in CylM compared to PI3K, and its similarity to mTOR. Additionally, due to the use of multiple colors and the large format representation of secondary structure, it is very difficult to visualize the structural similarities in . The representation would benefit by superimposing the two structures using narrow loops (not ribbons) of small width, and in only two colors with proper depth queuing, in order to visualize the backbone. We edited the original figures to show PI3K, CylM, and mTOR side by side (now Figure 3A-C) for a better comparison. Superimposed structures of CylM and PI3K with narrow loops are now provided in Figure 3–figure supplement 1 according to the reviewers’ suggestion. Superposition of the kinase active sites of CylM, mTOR, and CDK2 are now provided as new Figure 3–figure supplement 2. We appreciate the suggestions that have indeed improved the visualization of the text. 3) One fascinating element of this manuscript was the activity dependence of ADP by the WT phosphate elimination. The authors include the use of non-hydrolyzable ADPγS, but offer little more discussion. Why didn't the authors use ADP alone? What other nucleotide analogs are sufficient for this reaction? Is the role merely structural (as implied) or could there be a catalytic element? Given that ADP is the product of the kinase 1/2 reaction, this special relationship deserves more thorough investigation. We added a paragraph in the Materials and methods section to explain why we used non-hydrolyzable analogs. In short, we discovered that CylM can use both ATP and ADP to phosphorylate its substrates, although ATP is preferred over ADP. However, the use of ADP for phosphorylation presented a problem when we were trying to isolate just the elimination reaction. The substrates used for the latter activity was a mixture of CylLS peptides that carry different numbers of phosphate esters. When ADP was used to investigate the ability to eliminate the phosphates (as we described, no elimination is observed in the absence of nucleotides) elimination was observed, but the number of net dehydrations exceeded the number of initial phosphorylations. This is because new phosphorylations and eliminations were catalyzed by CylM in the presence of ADP. This unexpected observation complicated the outcome and made data interpretation difficult. For example, when ADP was supplied instead of non-hydrolyzable ADP using a similar set up, only fully dehydrated CylLS could be observed after incubation. We added new data in Figure 6–figure supplement 2 to illustrate this. Therefore, to study the elimination reaction in isolation, non-hydrolyzable ATP and ADP analogues were employed to minimize the effect resulted from CylM-catalyzed phosphorylation. Minor points: 1) The discussion of LanC at the end of the Discussion seems to be premature. An alignment of the mTOR kinase domain with LanC would be essential to underscore if the LanC domain would be compatible for binding. As a side note the authors do not define LanC as the cyclase domain, and clarification in the wording of the text would be useful for readers outside of the field. We now defined LanCL in the heading of the section and added a few sentences explaining how LanC/LanCL/LanM are related. We also removed the speculation about possible evolutionary origins and removed the statement that the CylM structure may be a preview of the interactions of mammalian LanCL proteins with kinases. We did leave in a discussion of the previously observed interaction between mTORC1 and LanCL1, since it was found well before the structure of CylM was determined. We believe that the CylM structure does provide a potential platform to use for investigation of the mTOR-LanCL2 interaction and that pointing this out is useful for the pertinent community who may not necessarily recognize the relevance of a LanM structure. 2) The authors have carried out very detailed analysis of substrates and phosphate ester analogs for both the wild type and mutant enzymes. What are the side products shown in for the mutants CylM D252A, and L247A? It would be interesting to see if these are potential trapped intermediates, or if these are contaminants from a given protein preparation. They are CylM-modified CylLS peptides carrying both phosphate esters and partial dehydrations. The presence of such intermediates indicates that the elimination activity of the CylM mutant was reduced but not completely abolished. We added mass tables with calculated and observed masses for each intermediate for a clearer presentation and we added a sentence to the legends explaining what these peaks are. 3) For many lipid kinases it has been difficult to crystallise enzymes in the presence of nucleotide analogs. It would be useful to generate an omit map for AMPPNP, to give readers confidence in the occupancy of this pocket. A simulated annealing difference Fourier map (calculated without the nucleotide) was generated and shown in Figure 3D. We appreciate the suggestion of adding such a figure.
  62 in total

Review 1.  Discovery, biosynthesis, and engineering of lantipeptides.

Authors:  Patrick J Knerr; Wilfred A van der Donk
Journal:  Annu Rev Biochem       Date:  2012-03-08       Impact factor: 23.643

2.  Briefly bound to activate: transient binding of a second catalytic magnesium activates the structure and dynamics of CDK2 kinase for catalysis.

Authors:  Zhao Qin Bao; Douglas M Jacobsen; Matthew A Young
Journal:  Structure       Date:  2011-05-11       Impact factor: 5.006

3.  Lanthionine synthetase C-like protein 1 interacts with and inhibits cystathionine β-synthase: a target for neuronal antioxidant defense.

Authors:  Wei-xia Zhong; Yu-bin Wang; Lin Peng; Xue-zhen Ge; Jie Zhang; Shuang-shuang Liu; Xiang-nan Zhang; Zheng-hao Xu; Zhong Chen; Jian-hong Luo
Journal:  J Biol Chem       Date:  2012-08-13       Impact factor: 5.157

4.  Steady-state kinetic and inhibition studies of the mammalian target of rapamycin (mTOR) kinase domain and mTOR complexes.

Authors:  Zhihua Tao; John Barker; Stone D-H Shi; Michael Gehring; Shaoxian Sun
Journal:  Biochemistry       Date:  2010-09-08       Impact factor: 3.162

Review 5.  New antibiotics for selective treatment of gastrointestinal infection caused by Clostridium difficile.

Authors:  Alan P Johnson
Journal:  Expert Opin Ther Pat       Date:  2010-10       Impact factor: 6.674

6.  Evolution of lanthipeptide synthetases.

Authors:  Qi Zhang; Yi Yu; Juan E Vélasquez; Wilfred A van der Donk
Journal:  Proc Natl Acad Sci U S A       Date:  2012-10-15       Impact factor: 11.205

7.  Evaluation of NVB302 versus vancomycin activity in an in vitro human gut model of Clostridium difficile infection.

Authors:  Grace S Crowther; Simon D Baines; Sharie L Todhunter; Jane Freeman; Caroline H Chilton; Mark H Wilcox
Journal:  J Antimicrob Chemother       Date:  2012-09-10       Impact factor: 5.790

8.  Structure of human lanthionine synthetase C-like protein 1 and its interaction with Eps8 and glutathione.

Authors:  Wenchi Zhang; Liang Wang; Yijin Liu; Jiwei Xu; Guangyu Zhu; Huaixing Cang; Xuemei Li; Mark Bartlam; Kenneth Hensley; Guangpu Li; Zihe Rao; Xuejun C Zhang
Journal:  Genes Dev       Date:  2009-06-15       Impact factor: 11.361

Review 9.  Ribosomally synthesized and post-translationally modified peptide natural products: overview and recommendations for a universal nomenclature.

Authors:  Paul G Arnison; Mervyn J Bibb; Gabriele Bierbaum; Albert A Bowers; Tim S Bugni; Grzegorz Bulaj; Julio A Camarero; Dominic J Campopiano; Gregory L Challis; Jon Clardy; Paul D Cotter; David J Craik; Michael Dawson; Elke Dittmann; Stefano Donadio; Pieter C Dorrestein; Karl-Dieter Entian; Michael A Fischbach; John S Garavelli; Ulf Göransson; Christian W Gruber; Daniel H Haft; Thomas K Hemscheidt; Christian Hertweck; Colin Hill; Alexander R Horswill; Marcel Jaspars; Wendy L Kelly; Judith P Klinman; Oscar P Kuipers; A James Link; Wen Liu; Mohamed A Marahiel; Douglas A Mitchell; Gert N Moll; Bradley S Moore; Rolf Müller; Satish K Nair; Ingolf F Nes; Gillian E Norris; Baldomero M Olivera; Hiroyasu Onaka; Mark L Patchett; Joern Piel; Martin J T Reaney; Sylvie Rebuffat; R Paul Ross; Hans-Georg Sahl; Eric W Schmidt; Michael E Selsted; Konstantin Severinov; Ben Shen; Kaarina Sivonen; Leif Smith; Torsten Stein; Roderich D Süssmuth; John R Tagg; Gong-Li Tang; Andrew W Truman; John C Vederas; Christopher T Walsh; Jonathan D Walton; Silke C Wenzel; Joanne M Willey; Wilfred A van der Donk
Journal:  Nat Prod Rep       Date:  2013-01       Impact factor: 13.423

10.  REFMAC5 for the refinement of macromolecular crystal structures.

Authors:  Garib N Murshudov; Pavol Skubák; Andrey A Lebedev; Navraj S Pannu; Roberto A Steiner; Robert A Nicholls; Martyn D Winn; Fei Long; Alexei A Vagin
Journal:  Acta Crystallogr D Biol Crystallogr       Date:  2011-03-18
View more
  24 in total

Review 1.  Mechanistic Understanding of Lanthipeptide Biosynthetic Enzymes.

Authors:  Lindsay M Repka; Jonathan R Chekan; Satish K Nair; Wilfred A van der Donk
Journal:  Chem Rev       Date:  2017-01-30       Impact factor: 60.622

2.  O-Methyltransferase-Mediated Incorporation of a β-Amino Acid in Lanthipeptides.

Authors:  Jeella Z Acedo; Ian R Bothwell; Linna An; Abby Trouth; Clara Frazier; Wilfred A van der Donk
Journal:  J Am Chem Soc       Date:  2019-10-15       Impact factor: 15.419

3.  Incorporation of Nonproteinogenic Amino Acids in Class I and II Lantibiotics.

Authors:  Nidhi Kakkar; Jessica G Perez; Wenshe R Liu; Michael C Jewett; Wilfred A van der Donk
Journal:  ACS Chem Biol       Date:  2018-02-21       Impact factor: 5.100

4.  Structure and tRNA Specificity of MibB, a Lantibiotic Dehydratase from Actinobacteria Involved in NAI-107 Biosynthesis.

Authors:  Manuel A Ortega; Yue Hao; Mark C Walker; Stefano Donadio; Margherita Sosio; Satish K Nair; Wilfred A van der Donk
Journal:  Cell Chem Biol       Date:  2016-02-11       Impact factor: 8.116

5.  Mechanistic Studies of the Kinase Domains of Class IV Lanthipeptide Synthetases.

Authors:  Julian D Hegemann; Liuqing Shi; Michael L Gross; Wilfred A van der Donk
Journal:  ACS Chem Biol       Date:  2019-06-24       Impact factor: 5.100

6.  Substrate Recognition by the Class II Lanthipeptide Synthetase HalM2.

Authors:  Imran R Rahman; Jeella Z Acedo; Xiaoran Roger Liu; Lingyang Zhu; Justine Arrington; Michael L Gross; Wilfred A van der Donk
Journal:  ACS Chem Biol       Date:  2020-04-28       Impact factor: 5.100

7.  CylA is a sequence-specific protease involved in toxin biosynthesis.

Authors:  Weixin Tang; Silvia C Bobeica; Li Wang; Wilfred A van der Donk
Journal:  J Ind Microbiol Biotechnol       Date:  2018-11-27       Impact factor: 3.346

8.  The Enterococcal Cytolysin Synthetase Coevolves with Substrate for Stereoselective Lanthionine Synthesis.

Authors:  Weixin Tang; Gabrielle N Thibodeaux; Wilfred A van der Donk
Journal:  ACS Chem Biol       Date:  2016-07-11       Impact factor: 5.100

9.  Leader Peptide Establishes Dehydration Order, Promotes Efficiency, and Ensures Fidelity During Lacticin 481 Biosynthesis.

Authors:  Christopher J Thibodeaux; Joshua Wagoner; Yi Yu; Wilfred A van der Donk
Journal:  J Am Chem Soc       Date:  2016-05-10       Impact factor: 15.419

Review 10.  New Insights into the Biosynthetic Logic of Ribosomally Synthesized and Post-translationally Modified Peptide Natural Products.

Authors:  Manuel A Ortega; Wilfred A van der Donk
Journal:  Cell Chem Biol       Date:  2016-01-21       Impact factor: 8.116

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.