Literature DB >> 26096655

Effects of a Formula Containing Two Types of Prebiotics, Bifidogenic Growth Stimulator and Galacto-oligosaccharide, and Fermented Milk Products on Intestinal Microbiota and Antibody Response to Influenza Vaccine in Elderly Patients: A Randomized Controlled Trial.

Shinya Nagafuchi1, Taketo Yamaji2, Akihiro Kawashima3, Yukiko Saito4, Takeshi Takahashi5, Takayuki Yamamoto6, Mitsuo Maruyama7, Hiroyasu Akatsu8,9,10.   

Abstract

We investigated the effect of a formula containing two different prebiotics (bifidogenic growth stimulator and galacto-oligosaccharide) and fermented milk products on intestinal microbiota and antibody responses to an influenza vaccine in enterally fed elderly in-patients. Patients were administered either formula containing prebiotics and fermented milk products (group F: n = 12, 79.9 ± 9.5 years old) or standard formula (group C: n = 12, 80.7 ± 10.1 years old) via percutaneous endoscopic gastrostomy during a 14-week intervention period. Subjects were immunized with an influenza vaccine (A/H1N1, A/H3N2, and B) at week 4 of the intervention. Blood biochemical indices, intestinal bacteria populations and antibody titers were analyzed. Bifidobacterium counts increased significantly in group F compared with group C. The enhanced antibody titers against A/H1N1 were maintained in group F for a longer period compared with group C. The titers against A/H3N2 were unchanged between both groups, and those against B were significantly lower in group F than in group C, although few subjects had seroprotective titers against A/H3N2 and B. These results suggest that administration of the formula containing prebiotics and fermented milk products may maintain antibody titers for longer periods through the improvement of intestinal microbiota.

Entities:  

Keywords:  Bifidobacterium; enterally fed patients; hemagglutination inhibition test; seroprotective rate

Year:  2015        PMID: 26096655      PMCID: PMC4491666          DOI: 10.3390/ph8020351

Source DB:  PubMed          Journal:  Pharmaceuticals (Basel)        ISSN: 1424-8247


1. Introduction

The elderly are generally known to be at greater risk of infectious diseases, as their immune responses are less vigorous than in younger adults. Influenza causes morbidity and mortality, particularly among older adults [1]. Influenza vaccination protects against influenza virus infection, reducing the risks of death and hospitalization associated with serious complications, such as pneumonia [2,3], however, the age-related decline of immune functions also reduces the responses of elderly patients to the influenza vaccine [4]. Taking these studies into consideration, it is very important to enhance the vaccine responses in the elderly. Prebiotics and probiotics have been investigated for their usefulness in a range of clinical areas [5,6], including prevention of influenza virus infection [7]. For example, Vos et al. have suggested that consumption of dietary oligosaccharides, such as galacto-oligosaccharide (GOS), may augment systemic Th1-dependent immune responses in a murine vaccination model through the enhancement of a proportion of fecal bifidobacteria and lactobacilli [8]. Influenza-vaccinated healthy elderly subjects who consumed milk fermented with Lactobacillus had enhanced antibody titers against the virus [9]. On the other hand, a new type of prebiotic, known as bifidogenic growth stimulator (BGS), is a product of milk whey protein fermented by Propionibacterium freudenreichii ET-3 isolated from Swiss cheese. BGS was shown to selectively stimulate the growth of a Bifidobacterium spp. without a growth stimulating effect on other intestinal bacteria [10,11]. In our previous intervention study, we examined the effects of simultaneous administration of BGS, GOS, and an enteral formula containing fermented milk products on the intestinal microflora and acquired immunity after influenza vaccination in enterally fed elderly patients [12]. These results suggested that simultaneous administration of these three nutrients might improve the intestinal microflora, contributing to longer-term maintenance of enhanced antibody titers against vaccines. However, in our previous study, serum nutritional indices such as total protein (TP) and albumin (Alb) were significantly higher in the intervention group than the control group during study period [12]. Antibody responses to vaccine antigens are reduced in the undernourished elderly population. The antibody responses to influenza vaccination in hospitalized elderly patients were related to nutritional indices such as serum albumin levels [13]. Therefore, in this randomized controlled trial, we examined the effects of an enteral formula containing two different types of prebiotics, BGS and GOS, and fermented milk products on the intestinal microflora and antibody titers after influenza vaccination in enterally fed elderly patients with no differences in baseline blood nutritional indices.

2. Experimental Section

2.1. Enteral Formula and Prebiotics

Two types of enteral formula, a standard enteral formula (Meibalance®; Meiji Co., Ltd., Tokyo, Japan) and a study formula containing prebiotics and fermented milk products (YH-Flore; Meiji Co., Ltd.) were used. Both types of formulae were cow-milk based. The standard formula contained casein and whey proteins. The study formula contained two different types of prebiotics, BGS (1.65 μg/100 kcal as 1,4-dihydroxy-2-naphthoic acid (DHNA), the active substance of BGS) and GOS (0.4 g/100 kcal), and pasteurized milk products fermented by Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus. The study formula contained essentially the same nutrients as the standard formula, with the exceptions of selenium, manganese, vitamin A, and vitamin C (Table 1).
Table 1

Nutrients in the standard and study enteral formulae.

NutrientsIngredientsUnitsAmount per 100 kcal
Standard FormulaStudy Formula
PrebioticsBGS (DHNA) *μg-1.65
Galacto-oligosaccharideg-0.4
MacronutrientsProteing4.04.0
Fatg2.82.8
Carbohydrateg14.514.4
Fiberg1.01.5
VitaminsAμgRE **60114
Dμg0.50.5
Emg3.03.0
Kμg5.01.8
B1mg0.150.15
B2mg0.20.2
Niacinmg1.61.6
B6mg0.30.3
B12μg0.60.6
Folic acidμg5050
Biotinμg157.5
Pantothenic acidmg0.60.6
Cmg1650
ElectrolytesNamg110100
Kmg100100
Camg6080
Mgmg2020
Pmg6085
Clmg140110
MineralsFemg1.01.0
Znmg0.801.0
Cumg0.080.05
Mnmg0.230.01
Crμg3.02.4
Moμg2.52.9
Seμg3.56.0
Iμg1512.7

* Study formula contains BGS (1.65 μg/100 kcal as 1,4-dihydroxy-2-naphthoic acid (DHNA), the active substance of BGS). ** RE, retinol equivalents.

Nutrients in the standard and study enteral formulae. * Study formula contains BGS (1.65 μg/100 kcal as 1,4-dihydroxy-2-naphthoic acid (DHNA), the active substance of BGS). ** RE, retinol equivalents.

2.2. Study Design and Participants

This study was an open-label, randomized, controlled trial that was carried out according to the Helsinki Declaration. This study was registered under the UMIN identifier NO. UMIN000013593. The study protocol was approved by the ethical committees of the Fukushimura Hospital and Meiji Co., Ltd. In this study, written informed consent was obtained from all subjects or their relatives. The patients’ anonymity has been preserved. Elderly patients (> 60 years old) on enteral nutrition hospitalized at Fukushimura Hospital were enrolled as subjects. The exclusion criteria were patients with type 1 diabetes, type 2 diabetes, chronic kidney disease, severe infection, autoimmune disease, immunodeficiency, hepatic failure, cow's milk allergy, soybean allergy, or gastrointestinal disorders such as diarrhea. Thirty-two elderly subjects or their relatives consented. At the start of this study (week 0), subjects were randomly assigned to a control group (group C: 16 subjects) or an intervention group (group F: 16 subjects). The standard enteral formula and the study enteral formula were used for the control and intervention groups, respectively. These formulae were administered to elderly patients by percutaneous endoscopic gastrostomy (PEG) during the 14-week intervention period from November 2010 to February 2011. Following the intervention period, standard formula was enterally fed in both groups for a 4-week follow-up period from February 2011 to March 2011. During the 14-week intervention period, four subjects in group C and four subjects in group F dropped out of because of transition from enteral nutrition to parenteral nutrition. Overall, 12 subjects in each group completed the study. Two subjects (one subject in each group) were excluded from the analysis of antibody titers because they were vaccinated on a different schedule from the study design. The influenza vaccine was administered subjects in each group at week 4 of this study. Stool samples were collected at weeks 0, 4, 8, 12, and 18. Blood samples were collected at weeks 0, 4, 6, 8, 12, and 18.

2.3. Antibody Titers against Influenza Vaccine Antigens

The influenza vaccine was administered subcutaneously in the upper arm of subjects at week 4. Viral strains of the vaccine were A/California/7/2009 (A/H1N1), A/Victoria/210/2009 (A/H3N2), and B/Brisbane/60/2008 (B). The hemagglutinin content of each strain was ≥ 30 μg/strain. Biochemical markers were measured. Plasma antibody titers against A/H1N1, A/H3N2, and B were measured by the hemagglutination inhibition test (HI test). An HI antibody titer ≥ 40 was regarded as seroprotective [14,15]. Subjects who were seroprotected before vaccination (at week 4) were excluded from the analysis of the seroprotective rate (%) and HI antibody titers after vaccination. Analysis of the seroprotective rate and HI antibody titers were performed in the subjects who were seronegative (titer < 40) before vaccination (at week 4). The seroprotective rate (%) was calculated as follows: Seroprotective rate (%) = 100 × (Number of seroprotected subjects)/(Number of seronegative subjects before vaccination)

2.4. Biochemical Indices

Serum nutrition indices, such as total protein (TP) and albumin (Alb), were assayed by the biuret and bromocresol green (BCG) methods, respectively. Prealbumin (p-Alb) and transferrin (Tf) levels were measured by the N-assay TIA prealbumin NITTOBO (Nittobo Medical, Tokyo, Japan) and N-Assay TIA Tf-H NITTOBO (Nittobo Medical), respectively. Total cholesterol and LDL-cholesterol levels were measured by N-Assay L T-CHO-H NITTOBO (Nittobo Medical) and Cholestest LDL (Sekisui Medical, Tokyo, Japan), respectively. All measurements were performed by the Tousan Labo Center (Toyohashi, Aichi, Japan).

2.5. Microbiota

We have measured seven major kinds of bacteria and total bacteria in feces. Bacterial counts were determined by real-time PCR (described below). The collected stool samples were quickly stored at −20 °C. Fecal bacteria gene analysis was performed as described below; fecal microbial DNA was extracted from stool samples using the QIAamp DNA stool mini kit (Qiagen, Tokyo, Japan) and multi-beads shocker (Yasui Kikai Inc., Osaka, Japan). In addition, counts were determined for each bacterium, Bifidobacterium, Bacteroides, Clostridium coccoides, Clostridium leptum [16], Lactobacillus [17], Enterobacteriaceae [18], Enterococcus and total bacteria [19] with the ABI 7300 real-time PCR system (Applied Biosystems, Tokyo, Japan) using QuantiTect SYBR Green PCR kit (Qiagen) and published primer base sequences and reaction conditions. The primers used to enumerate the target bacterial groups in the fecal samples are shown in Table 2. The amplification program consisted of one cycle of reverse transcriptase denaturing at 95 °C for 15 min, followed by 40–55 cycles of denaturation at 94 °C for 15 s, annealing at each temperature (Table 2) for 30 s, and extension at 72 °C for 30 s. The fluorescent products were detected at the end of the extension step of each cycle. The measured count of each bacteria per 1 g feces was log-transformed [log10 (count/g of feces)].
Table 2

Primer sets used in this study.

Target Organism Sequence (5' to 3')Annealing
Temperature (°C)
BifidobacteriumForwardCTCCTGGAAACGGGTGG60
ReverseGGTGTTCTTCCCGATATCTACA
LactobacillusForwardCTTGTACACACCGCCCGTCA57
ReverseCTCAAAACTAAACAAAGTTTC
BacteroidesForwardATAGCCTTTCGAAAGRAAGAT50
ReverseCCAGTATCAACTGCAATTTTA
C. coccoidesForwardAAATGACGGTACCTGACTAA50
ReverseCTTTGAGTTTCATTCTTGCGAA
C. leptumForwardGCACAAGCAGTGGAGT50
ReverseCTTCCTCCGTTTTGTCAA
EnterobacteriaceaeForwardCATTGACGTTACCCGCAGAAGAAGC58
ReverseCTCTACGAGACTCAAGCTTGC
EnterococcusForwardCCCTTATTGTTAGTTGCCATCATT56
ReverseACTCGTTGTACTTCCCATTGT
Total bacteriaForwardACTCCTACGGGAGGCAGCAGT60
ReverseGTATTACCGCGGCTGCTGGCAC
Primer sets used in this study.

2.6. Data Analysis

For demographic and anthropometric characteristics, nutrient intakes, biochemical indices, and intestinal microbiota, the Student’s t-test of equal variance or the Welch test of unequal variance was applied for comparison between the two groups. Antibody titers were measured by the HI test, and significant differences between the two groups were analyzed by the Mann–Whitney U test. Analysis after vaccination was performed using the Friedman test. Statistically significant differences in the seroprotective rates between the two groups were investigated by Fischer’s exact probability test. Differences of p < 0.05 were considered to be significant.

3. Results

3.1. Safety of Formulae

There were no important harmful or unintended effects observed in groups C or F during the study period.

3.2. Demographic and Anthropometric Characteristics, Nutrient Intakes and Blood Biochemical Indices of Subjects

The clinical characteristics of the subjects are shown in Table 3. No significant differences in sex, age, weight, or BMI were observed between groups C and F. Energy, protein, fat, and carbohydrate intakes per day were similar between both groups (Table 3).
Table 3

Characteristics and nutrient intakes of subjects at the start of the study.

CharacteristicsGroup CGroup FP value
Number of subjects1212-
Male/Female6/65/7N.S.
Age (years)80.7 ± 10.179.9 ± 9.5N.S.
Weight (kg)43.0 ± 5.741.9 ± 8.0N.S.
BMI17.8 ± 2.517.6 ± 3.3N.S.
Nutrient intakes
Energy (kcal/kg/day)23.5 ± 3.024.5 ± 5.6N.S.
Protein (g/kg/day)0.9 ± 0.11.0 ± 0.2N.S.
Fat (g/kg/day)0.7 ± 0.10.7 ± 0.2N.S.
Carbohydrate (g/kg/day)3.4 ± 0.43.5 ± 0.8N.S.

Values are presented as means ± standard deviation.

Characteristics and nutrient intakes of subjects at the start of the study. Values are presented as means ± standard deviation. Table 4 shows the levels of the blood biochemical markers. There were no significant differences in TP, p-Alb, Tf, total cholesterol (TC), LDL-cholesterol (LDL-c) levels, or immunoglobulin between the two dietary groups during the study period. A significant difference in Alb levels was observed between the two dietary groups at week 12.
Table 4

Biochemical indices of subjects (n = 12).

Biochemical IndicesGroupWeek 0Week 4Week 6Week 8Week 12
IgG (g/dL)Group C1.7 ± 0.61.7 ± 0.51.8 ± 0.51.8 ± 0.51.8 ± 0.5
Group F1.6 ± 0.51.6 ± 0.41.6 ± 0.41.6 ± 0.51.6 ± 0.5
IgA (mg/dL)Group C372 ± 139373 ± 140390 ± 143384 ± 146401 ± 153
Group F415 ± 139400 ± 107401 ± 110404 ± 131415 ± 118
IgM (mg/dL)Group C95.5 ± 46.696.3 ± 50.699.2 ± 51.5102.0 ± 50.3103.4 ± 54.8
Group F80.4 ± 36.180.8 ± 38.877.1 ± 36.082.3 ± 36.285.5 ± 33.0
Albumin (g/dL)Group C3.2 ± 0.43.2 ± 0.43.3 ± 0.33.3 ± 0.33.1 ± 0.4
Group F3.3 ± 0.33.5 ± 0.43.4 ± 0.33.4 ± 0.33.4 ± 0.2 *
Total protein (g/dL)Group C6.6 ± 0.56.7 ± 0.56.8 ± 0.76.8 ± 0.76.9 ± 0.6
Group F6.6 ± 0.97.0 ± 0.66.7 ± 0.56.6 ± 0.77.2 ± 0.6
Prealbmin (mg/dL)Group C18.9 ± 5.018.1 ± 6.417.9 ± 4.919.5 ± 6.219.2 ± 5.8
Group F18.8 ± 4.918.9 ± 7.519.1 ± 6.220.1 ± 5.122.1 ± 5.6
Transferrin (mg/dL)Group C213 ± 40207 ± 45217 ± 43223 ± 49222 ± 41
Group F205 ± 35205 ± 33208 ± 28221 ± 22227 ± 32
Total cholesterolGroup C188 ± 39189 ± 45189 ± 37190 ± 39190 ± 37
(mg/dL)Group F188 ± 40211 ± 35203 ± 40207 ± 37219 ± 42
LDL-cholesterolGroup C115 ± 30118 ± 34114 ± 30118 ± 33123 ± 31
(mg/dL)Group F111 ± 28129 ± 22116 ± 29123 ± 29134 ± 29

Values are presented as means ± standard deviation. * Significant differences between groups C and F (p < 0.05).

Biochemical indices of subjects (n = 12). Values are presented as means ± standard deviation. * Significant differences between groups C and F (p < 0.05). Biochemical indices at the follow-up period (week 18) were similar between both groups (data not shown).

3.3. Microbiota

Fecal bacterial counts [log10 (counts/g of feces)] are shown in Table 5. There were no significant differences between the two groups at week 0 in the counts of seven major kinds of fecal bacteria or total bacteria. Bifidobacterium counts in group F increased gradually and were significantly higher than those in group C at weeks 8 and 12. The differences in Bifidobacterium counts between two groups remained statistically significant at the 4-week follow-up (week 18).
Table 5

Fecal bacterial counts in groups C and F.

BacteriaGroupWeek 0Week 4Week 8Week 12Week 18
BifidobacteriumGroup C4.4 ± 3.42.9 ± 3.73.4 ± 3.34.4 ± 2.24.0 ± 2.1
Group F5.6 ± 2.76.1 ± 3.96.9 ± 3.5 *8.0 ± 2.6 *6.6 ± 2.5 *
LactobacillusGroup C5.9 ± 2.65.9 ± 3.15.9 ± 3.15.7 ± 3.04.9 ± 3.3
Group F5.9 ± 3.36.4 ± 2.85.9 ± 2.96.6 ± 3.07.0 ± 2.0
BacteroidesGroup C10.4 ± 0.510.6 ± 0.49.9 ± 0.810.4 ± 0.510.5 ± 0.6
Group F10.0 ± 0.710.8 ± 0.610.3 ± 1.110.1 ± 1.010.3 ±0.6
C. coccoidesGroup C10.8 ± 0.310.9 ± 0.310.7 ± 0.510.9 ± 0.210.9 ± 0.3
Group F10.8 ± 0.410.8 ± 0.310.7 ± 0.410.6 ± 0.4*10.8 ± 0.3
C. leptumGroup C10.4 ± 0.210.3 ± 0.210.3 ± 0.410.4 ± 0.210.3 ± 0.5
Group F10.0 ± 0.910.2 ± 0.310.1 ± 0.410.2 ± 0.410.4 ± 0.2
EnterobacteriaceaeGroup C8.3 ± 0.98.1 ± 1.07.5 ± 1.67.7 ± 1.47.4 ± 1.6
Group F8.0 ± 1.38.7 ± 1.48.5 ± 1.18.2 ± 1.38.0 ± 1.3
EnterococcusGroup C6.3 ± 1.36.0 ± 1.46.1 ± 1.36.7 ± 1.46.4 ± 1.3
Group F7.0 ± 0.96.7 ± 1.16.6 ± 1.16.8 ± 1.16.8 ± 1.7
Total bacteriaGroup C11.4 ± 0.211.4 ± 0.211.2 ± 0.411.5 ± 0.211.4 ± 0.3
Group F11.4 ± 0.311.6 ± 0.211.4 ± 0.311.5 ± 0.311.5 ± 0.1

Values are presented as means (log10 count/g of feces) ± standard deviation. * Significant differences between groups C and F (p < 0.05).

Although there was little difference in the average C. coccoides counts between groups C and F, at week 12 C. coccoides counts in group F were significantly lower than in group C. There were no significant differences between the two groups during the study period in any other fecal or total bacterial counts. All other fecal bacterial counts, except for Bifidobacterium, were similar between both groups at the 4-week follow-up (week 18). Fecal bacterial counts in groups C and F. Values are presented as means (log10 count/g of feces) ± standard deviation. * Significant differences between groups C and F (p < 0.05).

3.4. Antibody Titers against Influenza Vaccine

The number of patients who achieved seroprotective antibody titers, the seroprotective rate (%) and the HI antibody titers are shown in Table 6. Influenza vaccines were administered at week 4 in each group.
Table 6

The number (rate (%)) of seroprotective patients (upper number) and antibody titers (lower number).

AntigenGroupThe Number (Rate (%)) of seroprotective patients (HI ≥ 40) HI antibody titers
Week 0Week 4 vaccinationWeek 6Week 8Week 12
A/H1N1Group C0 (0%) 6.8 ± 4.60 (0%) 6.8 ± 4.64 (36%) 31.4 ± 45.1 1 (9%) 25.5 ± 45.11 (9%) 24.1 ± 45.5
Group F0 (0%) 7.7 ± 4.70 (0%) 6.4 ± 2.35 (45%) 45.9 ± 58.1 5 (45%) 31.4 ± 27.8 2 (18%) 21.4 ± 22.0
A/H3N2Group C0 (0%) 6.8 ± 4.60 (0%) 6.8 ± 4.61 (9%) 13.6 ± 10.7 1 (9%) 14.1 ± 10.4 1 (9%) 12.7 ± 10.6
Group F0 (0%) 10.5 ± 6.50 (0%) 10.0 ± 6.71 (9%) 14.5 ± 10.82 (18%) 15.9 ± 13.61 (9%) 14.5 ± 10.8
BGroup C0 (0%) 11.7 ± 6.60 (0%) 10.6 ± 5.82 (22%) 17.8 ± 13.02 (22%) 17.8 ± 13.01 (11%) 13.9 ± 10.5
Group F0 (0%) 8.0 ± 4.80 (0%) 8.5 ± 6.31 (10%) 13.5 ± 23.5 *1 (10%) 14.0 ± 23.3 *1 (10%) 10.0 ± 10.8

The upper number is number of subjects with a seroprotective antibody titer and the seroprotective rate (%) which is presented within parenthesis. The lower number is mean ± SD of the HI antibody titers. Analysis of the number (rate (%)) of seroprotective patients and HI antibody titers were performed in the seronegative subjects (the titer < 40) before vaccination (at week 4). Because there were three subjects (group C: two subjects; group F: one subject) with seroprotective antibody titers against B antigen (the titer ≥ 40) before vaccination, these subjects were excluded from analysis of the number (rate (%)) of seroprotective patients and HI antibody titers against B antigen. No subjects had seroprotective HI antibody titers against A/H1N1 or A/H3N2 antigen before vaccination. Seroprotective rate (%) was calculated as follows: Seroprotective rate (%) = 100 × (Number of seroprotected subjects)/(Number of seronegative subjects before vaccination). * Significant differences between groups C and F (p < 0.05). † Significant differences compared with week 4 in each group (p < 0.05).

Analysis of the number of seroprotective patients, the seroprotective rate (%) and HI antibody titers were performed in the subjects who were seronegative (titer < 40) before vaccination. Since there were three subjects (group C: two subjects; group F: one subject) with seroprotective antibody titers against the B antigen (titer ≥ 40) before vaccination, these subjects were excluded from analysis of the number of seroprotective patients, the seroprotective rate, and HI antibody titers against the B antigen. No subjects had seroprotective antibody titers against the A/H1N1 or A/H3N2 antigens before vaccination. The number (rate (%)) of seroprotective patients (upper number) and antibody titers (lower number). The upper number is number of subjects with a seroprotective antibody titer and the seroprotective rate (%) which is presented within parenthesis. The lower number is mean ± SD of the HI antibody titers. Analysis of the number (rate (%)) of seroprotective patients and HI antibody titers were performed in the seronegative subjects (the titer < 40) before vaccination (at week 4). Because there were three subjects (group C: two subjects; group F: one subject) with seroprotective antibody titers against B antigen (the titer ≥ 40) before vaccination, these subjects were excluded from analysis of the number (rate (%)) of seroprotective patients and HI antibody titers against B antigen. No subjects had seroprotective HI antibody titers against A/H1N1 or A/H3N2 antigen before vaccination. Seroprotective rate (%) was calculated as follows: Seroprotective rate (%) = 100 × (Number of seroprotected subjects)/(Number of seronegative subjects before vaccination). * Significant differences between groups C and F (p < 0.05). † Significant differences compared with week 4 in each group (p < 0.05). The upper number in Table 6 shows the number of subjects with seroprotective antibody titers and seroprotective rate (%) which is presented within parenthesis. Although few subjects with seroprotective antibody titers against A/H3N2 and B after vaccination were found in either group in this study, the number of those with seroprotective titers against A/H1N1 antigen increased at week 6. The increased number of subjects with seroprotective titers against A/H1N1 antigens in group F was maintained at week 8, whereas the number of those with seroprotective titers in group C decreased rapidly at week 8. There were no significant differences in the number of patients with the seroprotective titers against A/H1N1, A/H3N2, or B antigens between the two groups. Changes in specific HI antibody titers against the influenza vaccine are shown in Table 6 (lower numbers). The HI antibody titers against the A/H1N1 antigens in group F increased significantly at weeks 6 and 8 compared with those at week 4 (the time of vaccination). In contrast, the antibody titers against the A/H1N1 antigens in group C were augmented significantly at week 6 compared with those at vaccination, but not at week 8. There were no significant differences in the antibody titers against A/H1N1 antigens between the two groups. The antibody titer to B antigen was significantly lower for group F subjects than group C subjects at weeks 6 and 8.

4. Discussion

We examined the effects of an enteral formula containing two different types of prebiotics, BGS and GOS, and fermented milk products on intestinal microbiota and immunological response after influenza vaccination in enterally fed elderly patients in a randomized, controlled trial. Our results revealed that enteral administration of the study formula containing prebiotics and fermented milk products may improve intestinal microbiota and may contribute to maintenance of antibody titers against influenza viral A/H1N1 antigen for longer periods in elderly patients, without any change in blood nutritional indices. The study formula contains almost the same nutrients as the standard formula, except for selenium, manganese, vitamin A and vitamin C (Table 1). The previous study in institutionalized elderly subjects showed that the simultaneous administration of micronutrients, such as selenium, manganese, vitamin A and vitamin C, did not increase the antibody response after influenza vaccination [20]. A different study of elderly subjects also suggested that the consumption of vitamin C had no effect on HI antibody titers against influenza vaccine antigens [21]. No consistent associations were found between vitamin C levels and immune responses to vaccine antigens in undernourished children [22]. Together, these results suggest that the differences in selenium, manganese, vitamin A, and vitamin C levels in formula given to subjects in groups C and F most likely did not affect antibody titers against influenza vaccine in our study. We measured the counts of seven types of fecal bacteria in elderly patients administered formula by PEG. These bacterial counts observed in this study were almost the same as previous reports, except for Bifidobacterium [16,18,23,24]. The mean Bifidobacterium counts in this study in groups C (4.4 ± 3.4) and F (5.6 ± 2.7) (Table 5) at week 0 were about 1/10,000 of those (9.5 ± 0.1) [18] and (9.6 ± 0.5) [23] from previous studies of healthy elderly subjects. In addition, the standard deviations of Bifidobacterium counts in groups C and F were larger than those in reported previous studies in healthy elderly subjects [18,23]. These findings indicate that the individual variation of fecal Bifidobacterium counts in elderly patients administered formula by PEG was larger than those in the healthy elderly population. In this study, enteral administration of the study formula containing prebiotics and fermented milk products significantly increased fecal Bifidobacterium counts. Therefore, our results suggest that enteral feeding of the study formula may improve microbial imbalance, termed dysbiosis, in enterally fed patients. Except for Bifidobacterium, there were few significant differences between the two groups regarding the bacterial counts. Though C. coccoides counts were significantly decreased in group F at week 12 (p < 0.05), there was little difference in the average value between the two dietary groups. In addition, there were no significant differences in C. coccoides counts in groups C and F at week 12 compared with week 0 (p > 0.05). These results suggest that administration of the study formula does not affect intestinal C. coccoides counts. Administration of prebiotics such as GOS is effective in increasing the population of bifidobacteria [25]. A new type of prebiotics, BGS, was also found to stimulate growth of bifidobacteria in the colon [11,26]. In fact, BGS intake was effective to increase the detection rate of fecal bifidobacteria and improved the fecal properties in enterally fed elderly patients [11]. Although probiotics are generally defined as live microbial feed supplements, heat-killed Lactobacillus administration also exhibits a stimulatory effect on bifidobacteria [27]. Therefore, the three nutritional ingredients of the study formula, namely, BGS, GOS, and heat-treated milk products fermented by L. delbrueckii subsp. bulgaricus and S. thermophilus, may additively or synergistically improve the imbalance of microflora in enterally fed elderly patients. Few subjects in this study attained seroprotective titers against A/H3N2 and B antigens after influenza vaccination in either experimental group, though antibody titers against A/H1N1 were enhanced. On the other hand, our previous results showed that HI antibody titers against A/H1N1 and A/H3N2 antigens were increased after vaccination with little enhancement of titers against B antigens [12]. There were differences in antibody responses to the A/H3N2 antigen between our previous study and our present study. Influenza vaccines used in both studies contained different influenza A/H3N2 strain antigens, A/Hiroshima/52/2005 in our previous study and A/Victoria/210/2009 in our present study. A consecutive four-year study in influenza-vaccinated healthy elderly subjects suggested that antibody responses to the A/H3N2 antigen changed due to the use of influenza vaccines containing different influenza A/H3N2 strain antigens [28]. Therefore, the difference of A/H3N2 strain between both studies may have affected the HI antibody responses. In our present study, influenza vaccination augmented the seroprotective rates and HI antibody titers against A/H1N1 antigens in both groups. The HI antibody titers in group F against the A/H1N1 antigens increased significantly at weeks 6 and 8 compared with the baseline, though in group C the antibody titers against the A/H1N1 antigens increased significantly at week 6 only. The seroprotective rate also increased at weeks 6 and 8 in group F, whereas an augmented seroprotective rate in group C was observed at week 6 only. These results indicated that the enteral administration of the study formula containing prebiotics and fermented milk products maintained enhanced antibody titers for longer periods in elderly individuals. In undernourished elderly persons, vaccines may induce a lower level of protection than in well-nourished persons [13]. Although, in this study, there were significant differences in Alb levels between the two dietary groups at week 12, no differences in serum Alb levels between the two dietary groups were found at weeks 6 and 8. Therefore, increased serum Alb levels at week 12 in group F are considered not to affect the augmented antibody titers at weeks 6 and 8 after influenza vaccination. In addition, daily intake of energy, protein, fat and carbohydrates, and serum levels of nutrition indices (TP, p-Alb, and Tf) during study period were similar in groups C and F. These results demonstrated that differences in the nutritional status of subjects in both groups did not affect immune responses after vaccination. Influenza is a leading cause of hospitalization and death for individuals over 75 years of age [29]. Influenza vaccination protects against influenza illness and reduces the risk of death and hospitalization associated with serious complications, such as pneumonia [2,3]. Our results showed that enteral intake of the study formula containing two types of prebiotics and fermented milk products may maintain augmented HI antibody titers against influenza vaccine antigens during longer periods in elderly patients. These results suggest that the administration of formula containing two types of prebiotics and fermented milk products may reduce the risk of death and hospitalization caused by influenza virus infection among the elderly vaccinated against influenza. The limitation of this study is that the intervention was conducted only among elderly patients administered formula by PEG, suggesting it is hard to apply the results from the present study to a healthy subjects. The strengths of our study include the use of the enteral formula containing prebiotics and heat-treated fermented milk products. Severely immunodeficient subjects may be at risk from treatment with live probiotic microorganisms [30] and therefore the use of prebiotics or nonviable bacteria would be a safer alternative.

5. Conclusions

Our results show that enteral administration of the study formula containing two types of prebiotics and fermented milk products may improve intestinal microbiota and that enteral administration of the study formula may maintain antibody titers against influenza viral A/H1N1 antigens during longer periods in elderly patients. Interestingly, in a study in infants, who are in general as vulnerable as the elderly, consumption of fermented formula and increased antibody responses after vaccination correlated with fecal Bifidobacterium levels [31]. Especially, when taking this past study into consideration, our results suggest that administration of the study formula maintains antibody titers against influenza viral A/H1N1 antigens for longer periods through the improvement of intestinal microflora.
  29 in total

1.  Role of humoral and cell-mediated immunity in protection from influenza disease after immunization of healthy elderly.

Authors:  Donna M Murasko; Erica D Bernstein; Elizabeth M Gardner; Peter Gross; Gary Munk; Sandra Dran; Elias Abrutyn
Journal:  Exp Gerontol       Date:  2002 Jan-Mar       Impact factor: 4.032

2.  The prebiotic effects of biscuits containing partially hydrolysed guar gum and fructo-oligosaccharides--a human volunteer study.

Authors:  K M Tuohy; S Kolida; A M Lustenberger; G R Gibson
Journal:  Br J Nutr       Date:  2001-09       Impact factor: 3.718

3.  A PCR-based method for identification of lactobacilli at the genus level.

Authors:  Ségolène Dubernet; Nathalie Desmasures; Micheline Guéguen
Journal:  FEMS Microbiol Lett       Date:  2002-09-10       Impact factor: 2.742

Review 4.  Use of some pre-, pro- and synbiotics in critically ill patients.

Authors:  Stig Bengmark
Journal:  Best Pract Res Clin Gastroenterol       Date:  2003-10       Impact factor: 3.043

Review 5.  Nutrition and immunity in the elderly: modification of immune responses with nutritional treatments.

Authors:  B M Lesourd
Journal:  Am J Clin Nutr       Date:  1997-08       Impact factor: 7.045

6.  Testing the feasibility and initial effects of iron and vitamin C to enhance nursing home residents' immune status following an influenza vaccine.

Authors:  Neva L Crogan; Donna Velasquez; Mary Jo Gagan
Journal:  Geriatr Nurs       Date:  2005 May-Jun       Impact factor: 2.361

7.  Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces.

Authors:  Takahiro Matsuki; Koichi Watanabe; Junji Fujimoto; Toshihiko Takada; Ryuichiro Tanaka
Journal:  Appl Environ Microbiol       Date:  2004-12       Impact factor: 4.792

8.  Can a short period of micronutrient supplementation in older institutionalized people improve response to influenza vaccine? A randomized, controlled trial.

Authors:  Stephen J Allsup; Alan Shenkin; Margot A Gosney; Stephen Taylor; William Taylor; Margaret Hammond; Maria C Zambon
Journal:  J Am Geriatr Soc       Date:  2004-01       Impact factor: 5.562

Review 9.  Characteristic of milk whey culture with Propionibacterium freudenreichii ET-3 and its application to the inflammatory bowel disease therapy.

Authors:  M Uchida; O Mogami; K Matsueda
Journal:  Inflammopharmacology       Date:  2007-06       Impact factor: 4.473

10.  Immunogenicity of a standard trivalent influenza vaccine in patients on long-term hemodialysis: an open-label trial.

Authors:  Johan Scharpé; Willy E Peetermans; Johan Vanwalleghem; Bart Maes; Bert Bammens; Kathleen Claes; André D Osterhaus; Yves Vanrenterghem; Pieter Evenepoel
Journal:  Am J Kidney Dis       Date:  2009-04-01       Impact factor: 8.860

View more
  9 in total

Review 1.  Microbiota and the Response to Vaccines Against Respiratory Virus.

Authors:  João I B Gonçalves; Thiago J Borges; Ana Paula Duarte de Souza
Journal:  Front Immunol       Date:  2022-05-06       Impact factor: 8.786

Review 2.  Gut Microbial Changes, Interactions, and Their Implications on Human Lifecycle: An Ageing Perspective.

Authors:  Ravichandra Vemuri; Rohit Gundamaraju; Madhur D Shastri; Shakti Dhar Shukla; Krishnakumar Kalpurath; Madeleine Ball; Stephen Tristram; Esaki M Shankar; Kiran Ahuja; Rajaraman Eri
Journal:  Biomed Res Int       Date:  2018-02-26       Impact factor: 3.411

Review 3.  Exploring the Effect of Probiotics, Prebiotics, and Postbiotics in Strengthening Immune Activity in the Elderly.

Authors:  Hiroyasu Akatsu
Journal:  Vaccines (Basel)       Date:  2021-02-08

4.  Oligosaccharide equine feed supplement, Immulix, has minor impact on vaccine responses in mice.

Authors:  Ida Wang Henriksen; Josue Leonardo Castro Mejia; Caroline Martha Junker Mentzel; Frederikke Lindenberg; Axel Kornerup Hansen
Journal:  Sci Rep       Date:  2022-01-12       Impact factor: 4.379

Review 5.  Ingestion, Immunity, and Infection: Nutrition and Viral Respiratory Tract Infections.

Authors:  Coen Govers; Philip C Calder; Huub F J Savelkoul; Ruud Albers; R J Joost van Neerven
Journal:  Front Immunol       Date:  2022-02-28       Impact factor: 7.561

6.  Effect of a Prebiotic Formulation on Frailty Syndrome: A Randomized, Double-Blind Clinical Trial.

Authors:  Cristina Buigues; Julio Fernández-Garrido; Leo Pruimboom; Aldert J Hoogland; Rut Navarro-Martínez; Mary Martínez-Martínez; Yolanda Verdejo; Mari Carmen Mascarós; Carlos Peris; Omar Cauli
Journal:  Int J Mol Sci       Date:  2016-06-14       Impact factor: 5.923

Review 7.  The influence of prebiotic or probiotic supplementation on antibody titers after influenza vaccination: a systematic review and meta-analysis of randomized controlled trials.

Authors:  Wei-Te Lei; Chien-Yu Lin; Tzu-Lin Yeh; Pei-Ching Shih; Shu-Jung Liu; Chao-Hsu Lin; Jui-Ming Liu
Journal:  Drug Des Devel Ther       Date:  2018-01-25       Impact factor: 4.162

Review 8.  Effect of Probiotics and Prebiotics on Immune Response to Influenza Vaccination in Adults: A Systematic Review and Meta-Analysis of Randomized Controlled Trials.

Authors:  Wei-Te Lei; Pei-Ching Shih; Shu-Jung Liu; Chien-Yu Lin; Tzu-Lin Yeh
Journal:  Nutrients       Date:  2017-10-27       Impact factor: 5.717

9.  Impact of Age, Caloric Restriction, and Influenza Infection on Mouse Gut Microbiome: An Exploratory Study of the Role of Age-Related Microbiome Changes on Influenza Responses.

Authors:  Jenna M Bartley; Xin Zhou; George A Kuchel; George M Weinstock; Laura Haynes
Journal:  Front Immunol       Date:  2017-09-20       Impact factor: 7.561

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.