Literature DB >> 26063239

Substantial reprogramming of the Eutrema salsugineum (Thellungiella salsuginea) transcriptome in response to UV and silver nitrate challenge.

Stefanie Mucha1, Dirk Walther2, Teresa M Müller3, Dirk K Hincha4, Erich Glawischnig5.   

Abstract

BACKGROUND: Cruciferous plants synthesize a large variety of tryptophan-derived phytoalexins in response to pathogen infection, UV irradiation, or high dosages of heavy metals. The major phytoalexins of Eutrema salsugineum (Thellungiella salsuginea), which has recently been established as an extremophile model plant, are probably derivatives of indole glucosinolates, in contrast to Arabidopsis, which synthesizes characteristic camalexin from the glucosinolate precursor indole-3-acetaldoxime.
RESULTS: The transcriptional response of E. salsugineum to UV irradiation and AgNO3 was monitored by RNAseq and microarray analysis. Most transcripts (respectively 70% and 78%) were significantly differentially regulated and a large overlap between the two treatments was observed (54% of total). While core genes of the biosynthesis of aliphatic glucosinolates were repressed, tryptophan and indole glucosinolate biosynthetic genes, as well as defence-related WRKY transcription factors, were consistently upregulated. The putative Eutrema WRKY33 ortholog was functionally tested and shown to complement camalexin deficiency in Atwrky33 mutant.
CONCLUSIONS: In E. salsugineum, UV irradiation or heavy metal application resulted in substantial transcriptional reprogramming. Consistently induced genes of indole glucosinolate biosynthesis and modification will serve as candidate genes for the biosynthesis of Eutrema-specific phytoalexins.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26063239      PMCID: PMC4464140          DOI: 10.1186/s12870-015-0506-5

Source DB:  PubMed          Journal:  BMC Plant Biol        ISSN: 1471-2229            Impact factor:   4.215


Background

The synthesis of bioactive compounds for adaptation to abiotic stress conditions and for defence against herbivores and pathogen infections is a fundamental survival strategy of plants. The biosynthesis of phytoalexins, which contain an indole moiety substituted with additional ring systems or side chains, often containing sulphur and nitrogen, is characteristic for cruciferous plants [1]. The individual structures are very diverse even among different Brassica cultivars. In Arabidopsis thaliana, a variety of compounds are synthesized from the intermediate indole-3-acetonitrile (IAN) in response to pathogen infection or heavy metal stress [2,3] with camalexin as the most prominent metabolite. The camalexin biosynthetic pathway from tryptophan and glutathione and its role in defence against a number of fungal pathogens has been investigated in detail [4]. Phytoalexin biosynthesis is induced upon pathogen infection, but also under harsh abiotic conditions, such as high dosages of heavy metal ions or UV light, which lead to the generation of reactive oxygen species and ultimately to programmed cell death. For studies on plant metabolism, abiotic stress treatments provide the advantage that no interference of pathogen metabolism, which is often strain specific [5], has to be taken into account. Eutrema salsugineum has been established recently as an alternative model system for crucifers in addition to Arabidopsis, because of its high tolerance of various abiotic stresses [6]. The E. salsugineum genome sequence [7,8], as well as a reference transcriptome, [9] are available and additional transcriptomics data were published recently [8,10]. E. salsugineum is also referred to as Thellungiella salsuginea. The ecotype Shandong analysed in this study was initially assigned as T. halophila and this species name was used in a number of publications [11-13]. Consequently, gene and transcript sequences isolated from Shandong ecotype have been deposited under the species names T. halophila, T. salsuginea and E. salsugineum. According to work by Koch and German [14], the species name T. salsuginea is acceptable, but E. salsugineum, which we refer to in this manuscript, is preferred. Within the Brassicaceae, Eutrema and Arabidopsis are rather distantly related and their last common ancestor is estimated to have lived 43 million years ago [8]. Still, large stretches of syntenic regions were identified in the genomes, allowing clear assignment of putative orthologs [7,8]. At the protein level, for the number of best hit pairs between Eutrema and Arabidopsis a peak at 85% amino acid sequence identity was determined [8]. Eutrema and Arabidopsis have developed a diversified spectrum of defence compounds, such as glucosinolates [11,15,16] and indolic phytoalexins. In Arabidopsis, these phytoalexins are predominantly synthesized from the intermediate indole-3-acetaldoxime [2,17], while the characteristic Eutrema phytoalexins are most likely derivatives of 1-methoxy-indole glucosinolate [18]. The identification of biosynthetic genes for presumably glucosinolate-derived (Eutrema) and glucosinolate-independent (Arabidopsis) phytoalexins will build the basis for metabolic engineering studies of indolic phytoalexins and for establishment of a model for phytoalexin evolution in the Brassicaceae. In this work, we analysed the transcriptional reprogramming of E. salsugineum in response to abiotic stress conditions, which lead to the accumulation of phytoalexins. We show that genes of tryptophan and indole glucosinolate biosynthesis and modification are highly upregulated providing candidates for phytoalexin biosynthesis. Also the Eutrema ortholog of WRKY33, a key regulator of Arabidopsis phytoalexin induction, was highly upregulated, even though known WRKY33 target genes, such as CYP71B15 [19] are apparently missing in E. salsugineum.

Results and Discussion

Induction of phytoalexin biosynthesis in response to UV light and silver nitrate spraying

The biosynthesis of phytoalexins by Brassicaceae species is induced by pathogen infection, but also specific abiotic stress treatments, such as high dosages of heavy metals and UV light. Applying abiotic stressors provides the advantage of a high degree of experimental reproducibility and excludes the modulation of plant defence reactions and metabolism by the pathogen. Induction of phytoalexin biosynthesis by the heavy metal salt CuCl and UV treatment was previously established by Pedras and coworkers [12,13]. Here, wasalexin induction was confirmed for 10-week old E. salsugineum (Shandong) leaves in response to UVC light, silver nitrate application, and Botrytis cinerea infection (Additional file 1: Figure S1). In Arabidopsis, expression of camalexin biosynthetic genes is coregulated with expression of ASA1, encoding the committing enzyme of tryptophan biosynthesis. We therefore assumed that also in E. salsugineum tryptophan biosynthesis is upregulated under phytoalexin inducing conditions, which we later confirmed (see below). Quantitative RT-PCR was used to determine the induction kinetics of EsASA1 (Figure 1). For both treatments, transcript levels were highly elevated 7.5 h and 10 h after the onset of induction. Therefore, for transcriptomics analysis 8 h induction was selected.
Figure 1

RT-qPCR analysis. Time course of expression after treatment with UV light (A) and AgNO3 (B). EsASA1 (Thhalv10013041m), EsIGMT5 (Thhalv10018739m), EsPEN2 (Thhalv10001354m), EsBGLU18-1 (Thhalv10011384m), EsBGLU18-2 (Thhalv10011385m), and EsWRKY33 (Thhalv10016542m), were analysed. The expression levels, relative to the mean for 0 h, were determined by RT-qPCR, normalized to the geometric mean of three reference genes (EsActin1, EsYLS8 and EsPP2AA2). Values are means of three independent experiments ± SE.

RT-qPCR analysis. Time course of expression after treatment with UV light (A) and AgNO3 (B). EsASA1 (Thhalv10013041m), EsIGMT5 (Thhalv10018739m), EsPEN2 (Thhalv10001354m), EsBGLU18-1 (Thhalv10011384m), EsBGLU18-2 (Thhalv10011385m), and EsWRKY33 (Thhalv10016542m), were analysed. The expression levels, relative to the mean for 0 h, were determined by RT-qPCR, normalized to the geometric mean of three reference genes (EsActin1, EsYLS8 and EsPP2AA2). Values are means of three independent experiments ± SE.

The Eutrema transcriptome in response to UV light and heavy metal stress

RNA was isolated from non-treated leaves and from leaves treated with either AgNO3 or UV light. cDNA libraries were prepared and approximately 33 Mio to 45 Mio 50 bp reads per library were obtained by Illumina sequencing. Reads were mapped to the JGI genome [8]. For each cDNA library, approx. 75% of total transcript models were covered (Table 1) and a large overlap between treatments was observed (Additional file 2: Figure S2). Transcript models were analysed for read-counts in the different samples and annotated for best hit in the Arabidopsis thaliana genome (Additional file 3: Table S1).
Table 1

RNAseq metrics and alignments

n.i. UV AgNO 3 B.c.
readstotal fragments33,445,68245,326,70333,278,11035,924,995
uncounted8,100,89322,525,5737,470,86312,091,407
counted25,344,78922,801,13025,807,24723,833,588
- uniquely17,567,42614,322,99019,065,87516,287,764
- non-specific7,777,3638,478,1406,741,3727,545,824
transcriptshit (reads > 0)23,23723,73023,98523,655
uniquely hit21,58921,87522,21622,048
(% of total)(73,7%)(74,7%)(75,9%)(75,3%)

Reads were mapped to the JGI genome (Yang et al., [8]), 29284 reference transcripts (2 mismatches allowed); uncounted/counted: number of unmapped/mapped reads; uniquely: number of uniquely mapped reads; non-specific: number of reads with multiple locations in the reference.

RNAseq metrics and alignments Reads were mapped to the JGI genome (Yang et al., [8]), 29284 reference transcripts (2 mismatches allowed); uncounted/counted: number of unmapped/mapped reads; uniquely: number of uniquely mapped reads; non-specific: number of reads with multiple locations in the reference. Similarly, we have analysed the transcriptome 48 h after infection of plants with B. cinerea (Additional file 3: Table S1). 3139 transcripts were identified as more than 2-fold upregulated with respect to untreated leaves. Of this set, 56% and 61% were also upregulated more than 2-fold after UV and AgNO3 treatment, respectively, indicating overlapping responses to the abiotic and biotic stressors. However, as transcriptional changes in response to UV light and AgNO3 were much more pronounced, we focussed on these treatments for further analysis. Microarray analysis of four biological replicates was conducted with Agilent arrays based on the design by Lee et al. [9]. Statistically robust differential regulation was observed for the majority of transcripts (Additional file 4: Table S2). Of a total of 42562 oligonucleotide probes, signal intensities of 11930 (28%) and 15384 (36%) probes were significantly (t-test FDR corrected p < 0.01) elevated, while signal intensities of 11562 (27%) and 11879 (28%) probes were significantly reduced in response to UV light and AgNO3, respectively. These array data were compared with the RNAseq data, which in addition provide information about absolute expression levels. A correlation analysis with the log2 fold-change values obtained by the two methods in response to UV and AgNO3 is shown in Additional file 5: Figure S3. We matched RNAseq and array data based on the comparison of array probe and transcript model sequences and omitted those probes from further analysis for which no match was found. Duplicated genes with highly homologous sequences were sometimes indistinguishable on array level (e.g. TsCYP79B2, see below). Here, the more highly abundant transcript from the RNAseq analysis was chosen for the matched dataset. Log2 fold-change values based on RNAseq and array analyses were correlated (r = 0.66 for UV light, r = 0.65 for AgNO3). For further analysis, we worked with a set of 14,706 genes, for which both array and RNAseq data are available (Additional file 6: Table S3). Correlations of log2 fold-change values in response to UV and AgNO3 treatment obtained by microarray hybridization are shown in Figure 2. For a large proportion of these transcripts (88%), significant changes in abundance were detected in response to UV or AgNO3 treatment (Figure 2). 4502 (31%) transcripts were upregulated, 3433 (23%) downregulated in response to both treatments, indicating substantial overlap in metabolic and regulatory responses.
Figure 2

Global analysis of transcriptomics data. The set of 14,706 genes, for which RNAseq and array data could be matched, was analysed for significant (FDR P <0.05) transcriptional changes (array data) in response to UV light and AgNO3. A large overlap in response to the two stressors was observed.

Global analysis of transcriptomics data. The set of 14,706 genes, for which RNAseq and array data could be matched, was analysed for significant (FDR P <0.05) transcriptional changes (array data) in response to UV light and AgNO3. A large overlap in response to the two stressors was observed. Figure 3 shows a Mapman [20] representation of log2-fold transcriptional changes, in response to UV light (Figure 3A) and AgNO3 (Figure 3B), based on array data. Strongly repressed processes include photosynthesis and starch synthesis. The tricarboxylic acid cycle, providing precursors of aromatic amino acid and the biosynthesis of cell wall precursors are induced on the level of transcript abundance, consistent with plant defence reactions.
Figure 3

Mapman visualisation of transcript abundance changes for metabolic genes. Metabolism overview for microarray data. A: UV versus not induced (n.i.). B: AgNO3 versus n.i.. Red indicates downregulated, blue upregulated genes. The colour code indicates log2-fold changes in expression.

Mapman visualisation of transcript abundance changes for metabolic genes. Metabolism overview for microarray data. A: UV versus not induced (n.i.). B: AgNO3 versus n.i.. Red indicates downregulated, blue upregulated genes. The colour code indicates log2-fold changes in expression.

Transcriptional changes induced upon both UV and heavy metal stress

Transcripts that were strongly and consistently upregulated in response to both UV light and AgNO3 include a number of genes that encode enzymes involved in biosynthesis or modification of hormones and signalling compounds. This indicated that reprogramming the hormone balance is one of the key elements in the adaptation of Eutrema to high dosages of UV light or heavy metals. Genes upregulated most strongly in response to both stressors include EsSOT12 and, based on NGS data, EsST2a/EsSOT1 (Additional file 3: Table S1 and Additional file 6: Table S3). The corresponding Arabidopsis orthologs encode a sulfotransferase, which sulphonates salicylic acid, thereby positively regulating salicylic acid accumulation [21], and a sulfotransferase, which sulphonates hydroxyjasmonic acid [22]. SOT12 is also strongly induced in A. thaliana seedlings in response to UVB light [23]. Furthermore, we observed that genes encoding Eutrema orthologs of 1-amino-cyclopropane-1-carboxylate synthase 2 (ethylene biosynthesis) and cis-zeatin O-β-D-glucosyltransferase (UGT85A1, cytokinin metabolism) [24] were highly upregulated in response to both UV light and AgNO3. Other induced processes are senescence and regulation of cell death. Here, examples of highly upregulated genes include the Eutrema orthologs of AtDLAH [25] and AtBAP2, an inhibitor of programmed cell death [26]. We observed significant transcriptional reprogramming of phenylpropanoid metabolism. Genes of the core phenylpropanoid biosynthetic pathway, i.e. E. salsugineum orthologs putatively encoding phenylalanine ammonia-lyase 1 and 2, cinnamate-4-hydroxylase, cinnamoyl CoA reductase, and cinnamyl alcohol dehydrogenase were upregulated in response to UV and AgNO3. The E. salsugineum ortholog of TT4, encoding naringenine chalcone synthase, was strongly downregulated. Interestingly, in Arabidopsis strong TT4 upregulation was observed in response to UV light [27]. Whether this is due to experimental differences, such as plant age or UV wavelength or reflects a species-specific difference in adaptation with respect to the phenylpropanoids that are synthesized remains to be investigated. Further, fundamental changes in the transcript abundance of genes encoding enzymes involved in the biosynthesis of defence-related secondary metabolites were observed, which are discussed in detail below. A number of genes have been functionally associated with the halophytic lifestyle of E. salsugineum. These include the sodium transporter EsHKT1 [28] and EsERF1 [29], which are also strongly and significantly upregulated under both AgNO3 and UV treatment (Additional file 6: Table S3). Arabidopsis ERF1 is an integrator of different abiotic and biotic stress responses [30]. For other genes associated with salt tolerance, such as SOS1 and iron superoxide dismutase this was not observed [31]. We have surveyed transcriptional changes in response to AgNO3 and UV in E. salsugineum for similarity to changes in response to drought or cold [32]. There was a clear overlap among downregulated genes, which are mainly related to photosynthesis. A common pattern among upregulated genes was not observed (Additional file 7: Figure S4A). Apparently, the responses of E. salsugineum to drought/cold and to UV/heavy metal stresses differ substantially. The effect of silver treatment on the Arabidopsis transcriptome was investigated previously by Kaveh and coworkers [33]. The number of significantly upregulated genes was much lower than in our work on Eutrema, probably due to differences in the experimental setup. Only for a few genes, the corresponding orthologs were identified in both studies, including the orthologs of the β-glucosidase genes 18 and 46. Recently, genes were identified in A. thaliana which are upregulated in response to both B. cinerea infection and oxidative stress [34]. For 115 out of these 175 transcripts, corresponding E. salsuginea orthologs were identified here. Strikingly, for a large fraction of these genes (76; 66%), including e.g. EsCYP79B3 and EsCYP83B1 (see below), we observed upregulation by both UV and AgNO3 treatments (Additional file 7: Figure S4B). Possibly, all these processes lead to the generation of reactive oxygen species, inducing transcriptional reactions that are largely conserved between Arabidopsis and Eutrema.

Tryptophan biosynthetic genes

In Brassicaceae, tryptophan is a precursor of indole glucosinolates and indolic phytoalexins [4], which constitute the major tryptophan sinks. As cellular tryptophan concentrations are low in Arabidopsis leaves, tryptophan biosynthesis is strongly coregulated with the biosynthesis of camalexin [35,36]. Here, we observed significant and strong increases in transcript levels associated with the tryptophan biosynthetic pathway in response to UV light and AgNO3 (Table 2). This includes genes encoding tryptophan synthase β (TSB) type 1 isoforms, while the ortholog of TSBtype2, of which the biological function is unknown [37], is significantly downregulated in response to UV light.
Table 2

Analysis of transcript abundance changes of genes associated with the biosynthesis of defence-related metabolites

Transcript ID Best Ath hit Gene symbol Annotation UV Ag + Fold change log2 (UV/n.i.) FDR-p-value test Fold change log2 (Ag/n.i.) FDR-p-value test RNAseq Unique reads
n.i. UV AgNO3
Tryptophan biosynthesis
Thhalv10013041mAT5G05730.1ASA1,TRP5,WEI2anthranilate synthase alpha subunit 1upup4,830,0005,310,0004312081528637
Thhalv10010558mAT3G54640.1TRP3,TSA1tryptophan synthase alpha chainupup4,340,0003,760,00026499729692
Thhalv10013439mAT4G27070.1TSB2tryptophan synthase beta-subunit 2upup4,070,0003,130,00071031532355
Thhalv10025097mAT4G27070.1TSB2tryptophan synthase beta-subunit 2upup3,370,0002,470,000218774815464
Thhalv10013857mAT5G17990.1PAT1,TRP1tryptophan biosynthesis 1upup2,260,0003,260,00022207268
Thhalv10014630mAT4G27070.1TSB2tryptophan synthase beta-subunit 2upup1,670,0021,110,00223517
Thhalv10002557mAT2G04400.1IGPSindole-3-glycerol phosphate synthaseupup1,160,0001,400,00068465298538
Thhalv10016377mAT2G29690.1ASA2anthranilate synthase 2down−0,200,356−0,430,004482436449
Thhalv10027732mAT5G38530.1TSBtype2tryptophan synthase beta type 2down−1,470,000−1,400,0008764071012
Biosynthesis of aliphatic glucosinolates
Thhalv10023453mAT1G62570.1FMO GS-OX4glucosinolate S-oxygenase 4upup4,120,0013,920,00124381477570
Thhalv10007582mAT1G12140.1FMO GS-OX5glucosinolate S-oxygenase 5upup2,120,0001,480,00060411021077
Thhalv10018813mAT1G74090.1ATST5B,SOT18desulfo-glucosinolate sulfotransf. 182,120,0001,750,0001133461175
Thhalv10007073mAT1G18500.1IPMS1,MAML-4methylthioalkylmalate synthase-like 40,310,0840,320,165169518152672
Thhalv10004037mAT5G23010.1IMS3,MAM1methylthioalkylmalate synthase 1down−0,600,055−2,920,0005114
Thhalv10017125mAT2G43100.1ATLEUD1,IPMI2isopropylmalate isomerase 2down−0,970,002−1,220,003655462942
Thhalv10013695mAT5G14200.1IMD1isopropylmalate dehydrogenase 1downdown−1,970,000−1,910,0001667266779
Thhalv10028851mAT4G12030.2BASS5,BAT5bile acid transporter 5downdown−2,050,007−4,560,0001132
Thhalv10024982mAT4G13770.1CYP83A1,REF2cytochrome P450 83A1downdown−2,790,000−3,970,0002091915692903
Thhalv10007301mAT1G16410.1CYP79F1cytochrome P450 79 F1downdown−2,920,005−5,720,0001571211012740
Thhalv10013952mAT5G07690.1MYB29myb domain protein 29downdown−3,220,002−4,350,000342138061
Thhalv10004406mAT5G61420.2MYB28,HAG1myb domain protein 28downdown−5,600,000−6,100,0014271010
Indole and general glucosinolate biosynthesis
Thhalv10007957mAT1G21100.1IGMT1O-methyltransferase family proteinupup5,970,0004,540,001165102346500
Thhalv10000114mAT2G22330.1CYP79B3cytochrome P450 79B3upup5,920,0005,050,0001676854205
Thhalv10008152mAT1G18570.1AtMYB51,HIG1myb domain protein 51upup5,680,0004,310,000164130937845
Thhalv10024861mAT4G39950.1CYP79B2cytochrome P450 79B2upup5,060,0005,380,0002542476330609
Thhalv10007964mAT1G21120.1IGMT2O-methyltransferase family proteinupup4,930,0002,700,00143490099298
Thhalv10018795mAT1G74100.1ATST5A,SOT16sulfotransferase 16upup4,540,0004,450,0006652688929842
Thhalv10024979mAT4G37410.1CYP81F4cytochrome P450 81 F4upup4,520,0005,270,0003002171748198
Thhalv10008073mAT1G18590.1ATST5C,SOT17sulfotransferase 17upup4,070,0002,590,00287786514339
Thhalv10026067mAT4G30530.1GGP1gammaglutamyl peptidase 1upup3,310,0003,550,00053156652898213
Thhalv10001994mAT2G20610.1SUR1,ALF1,RTY1superroot1upup3,220,0002,480,000142823
Thhalv10018739mAT1G76790.1IGMT5O-methyltransferase family proteinupup2,630,0013,030,00017474205794252
Thhalv10007574mAT1G24100.1UGT74B1UDP-glucosyl transferase 74B1upup2,440,0002,150,000106264085926
Thhalv10024981mAT4G37430.1CYP81F1cytochrome P450 81 F1up1,990,0024,940,00013184393
Thhalv10004064mAT4G31500.1CYP83B1,SUR2cytochrome P450 83B1upup1,700,0012,060,00028415191696397
Thhalv10027443mAT4G37400.1CYP81F3cytochrome P450 81 F3up−3,970,0001,140,04359544
Phenylpropanoid biosynthesis
Thhalv10025563mAT4G34230.1CAD5cinnamyl alcohol dehydrogenase 5upup4,900,0004,920,0005901491511374
Thhalv10016314mAT2G37040.1PAL1PHE ammonia lyase 1upup4,540,0004,320,00056394391953026
Thhalv10010153mAT3G53260.1ATPAL2,PAL2PHE ammonia lyase 2upup4,470,0004,080,00055162494229448
Thhalv10016545mAT2G30490.1C4H,CYP73A5cinnamate-4-hydroxylaseupup4,470,0003,920,00034654091424286
Thhalv10018849mAT1G80820.1CCR2cinnamoyl coa reductaseupup4,380,0003,950,000927966118
Thhalv10016544mAT2G30490.1CYP73A5,REF3cinnamate-4-hydroxylaseupup4,340,0004,280,00020053516505
Thhalv10020406mAT3G21230.14CL54-coumarate:CoA ligase 5upup2,860,0001,300,000160961882
Thhalv10001440mAT2G43820.1SGT1,UGT74F2UDP-glucosyltransferase 74 F2upup2,580,0014,450,0009811001193
Thhalv10004662mAT5G08640.1FLS1flavonol synthase 1upup2,410,0030,800,02652416498
Thhalv10016538mAT2G40890.1CYP98A3cytochrome P450, 98A32,320,0012,100,0001482847699
Thhalv10011357mAT1G51680.34CL14-coumarate:CoA ligase 1upup1,850,0021,350,00087530712269
Thhalv10010658mAT3G55120.1A11,CFI,TT5Chalcone-flavanone isomeraseupup1,760,0012,040,000112352573
Thhalv10024928mAT4G36220.1CYP84A1,FAH1ferulic acid 5-hydroxylase 1upup1,510,0021,830,000506455738972
Thhalv10026028mAT4G34050.1CCoAOMT1SAM-dependent methyltransferaseup0,990,0100,040,77985130933791
Thhalv10000324mAT3G21230.14CL54-coumarate:CoA ligase 5up0,850,0210,750,0012816240
Thhalv10008111mAT1G15950.1CCR1cinnamoyl coa reductase 1up0,760,0080,150,447423586375
Thhalv10000513mAT3G21230.14CL54-coumarate:CoA ligase 50,270,533−0,030,9572117339
Thhalv10018769mAT1G72680.1CAD1cinnamyl-alcohol dehydrogenasedown−0,150,461−0,230,050859635666
Thhalv10022462mAT1G65060.14CL34-coumarate:CoA ligase 3down−0,250,141−0,550,0041132315
Thhalv10020439mAT3G21230.14CL54-coumarate:CoA ligase 5downdown−0,830,015−0,930,004910214484
Thhalv10027317mAT4G36220.1CYP84A1,FAH1ferulic acid 5-hydroxylase 1−0,980,338−1,380,170113
Thhalv10013289mAT5G07990.1CYP75B1,TT7cytochrome P450, 75B1−1,260,080−1,160,0844233
Thhalv10004668mAT5G08640.1ATFLS1,FLS,FLS1flavonol synthase 1downdown−1,430,005−2,380,0021371741
Thhalv10005442mAT1G43620.1TT15,UGT80B1UDP-Glycosyltransferase 80B1downup−1,720,0000,340,00810618274174
Thhalv10014054mAT5G08640.1FLS1flavonol synthase 1down−2,670,000−2,920,001171119
Thhalv10013745mAT5G13930.1CHS,TT4Chalcone and stilbene synth. Fam.downdown−4,040,000−3,320,00521411200
Analysis of transcript abundance changes of genes associated with the biosynthesis of defence-related metabolites

Glucosinolate biosynthesis and modification

Members of the order Brassicales synthesize glucosinolates from non-polar amino acids as major defence compounds against herbivores and pathogens. In Arabidopsis thaliana, almost exclusively methionine-derived aliphatic and tryptophan-derived indole glucosinolates are found. Their biosynthetic pathways are known in great detail [38]. In Eutrema salsugineum Shandong, the short chain aliphatic allyl-2-phenylethyl-, 3-methylsulfinylpropyl-, and 3-methylthiopropylglucosinolate, the very-long-chain aliphatic 10-methylsulfinyldecylglucosinolate, as well as 3-indolylmethyl- and 1-methoxy-3-indolylmethylglucosinolate were identified as major compounds [11] (E. salsugineum denoted in this publication as T. halophila). According to labelling experiments, 1-methoxy-3-indolylmethylglucosinolate is likely to be a biosynthetic intermediate of the phytoalexins 1-methoxybrassinin and wasalexin A and B [18]. For all defined steps of the core aliphatic and indole glucosinolate biosynthetic pathways, putative orthologs of the genes encoding the corresponding enzymes were found in Eutrema salsugineum, based on homology and synteny to A. thaliana. Some additional duplication events or losses of tandem copies were detected. In contrast to the tandem duplicates CYP79F1 and CYP79F2 in A. thaliana, only one copy, designated as EsCYP79F1 was found in E. salsugineum, suggesting that this single gene is essential for the biosynthesis of aliphatic glucosinolates. A putative CYP79A2 [39] ortholog was found, which is expressed at very low levels (0, 0, and 1 reads in n.i., UV, and AgNO3 samples, respectively) consistent with the apparent absence of phenylalanine-derived glucosinolates [11]. E. salsugineum contains three CYP79B genes due to a recent duplication of CYP79B2 leading to two transcripts hybridizing to the same array probe and generating proteins with 98.6% identity of their amino acid sequences. These two duplicates strongly differ in expression level based on RNAseq data (254, 24763 and 30609, versus 0, 3, and 5 reads in n.i., UV, and AgNO3 samples, respectively). In response to UV light and AgNO3, the core genes of indole glucosinolate biosynthesis are strongly upregulated, consistent with the proposed role of 1-methoxy-3-indolylmethylglucosinolate as precursor of the characteristic Eutrema phytoalexins (Table 2). Also, the ortholog of MYB51/HIG1, encoding a master regulator of indole glucosinolate biosynthesis in Arabidopsis [40], is consistently induced. Strikingly, in response to these stressors, transcripts encoding indole glucosinolate biosynthetic genes, such as EsCYP83B1 and EsGGP1 are among the most highly abundant, according to our RNAseq data, indicating an important metabolic response. In Arabidopsis, a time course experiment has been performed for UV response [41]. We surveyed these data for the responses of orthologs of E. salsugineum genes we analysed by RT-qPCR (Figure 1). Moderate upregulation with respect to 0 h, peaking at 3 h for AtASA1 (5.0-fold) and AtPEN2 (2.0-fold), and at 6 h for AtIGMT5 (3.6-fold) and AtBGLU18 (3.3-fold) was observed. More generally, we surveyed these data for core indole glucosinolate biosynthetic genes and again observed only modest transcript induction 6 h after UV treatment (less than 5-fold upregulation of CYP83B1, SUR1, GGP1, SOT16 and UGT74B1). In contrast, the camalexin biosynthetic genes CYP71B15 and CYP71A13 were induced approximately 121-fold and 66-fold, respectively [41]. These differential responses are consistent with the proposed phytoalexin biosynthetic pathways in the two species. In Arabidopsis, unmodified indole glucosinolate is methoxylated in response to pathogen infection, involving members of the CYP81F family and indole glucosinolate methyl transferases (IGMTs) [42]. E. salsugineum contains five CYP81F members, due to an additional gene copy in the CYP81F1/3/4 cluster. For three of these genes, microarray and RNAseq data were obtained and matched. Based on its expression pattern, EsCYP81F4 (Thhalv10024979m) is a candidate gene for catalysing N-hydroxylation of 3-indolylmethylglucosinolate in the biosynthesis of Eutrema phytoalexins. EsCYP81F3 (Thhalv10027443m) was induced by AgNO3 but not by UV light. Also, EsIGMT5, highly expressed in response to stress treatment (Table 2, Figure 1), is a candidate for involvement in the biosynthesis of N-methoxylated indolic compounds. In response to pathogen infection, in Arabidopsis indole glucosinolates are degraded to bioactive compounds by the β-glucosidase PEN2 (BGLU26) [43,44]. We hypothesize that β-glucosidases are also involved in the biosynthesis of Eutrema phytoalexins. A number of β-glucosidase-encoding genes were significantly upregulated in response to AgNO3 and UV challenge (Table 3), including EsPEN2 (Thhalv10001354m), EsBGLU18-1 (Thhalv10011384m), and EsBGLU18-2 (Thhalv10011385m). The time course of induction of these genes was monitored by quantitative RT-PCR and strong induction responses to AgNO3 and UV treatment were confirmed (Figure 1). In conclusion, the Eutrema orthologs of PEN2 (BGLU26) and BGLU18 are candidates for an involvement in phytoalexin biosynthesis.
Table 3

Analysis of transcript abundance changes of genes encoding β-glucosidases

Transcript ID Best Ath hit Gene symbol UV Ag + Fold change log2 (UV/n.i.) FDR-p-value test Fold change log2 (Ag/n.i.) FDR-p-value test RNAseq Unique reads
n.i. UV AgNO3
Thhalv10006515mAT4G27830.1BGLU10up1,800,001−1,560,0003306
Thhalv10006510mAT4G27830.1BGLU10up1,420,000−1,940,00040389105
Thhalv10005908mAT4G27830.1BGLU10down−2,080,000−1,850,000217127587
Thhalv10001447mAT2G44450.1BGLU15upup1,140,0032,080,00022029
Thhalv10011384mAT1G52400.1BGLU18downup−5,320,0000,470,00048232272195299
Thhalv10011385mAT1G52400.1BGLU18−7,870,0000,410,279261246
Thhalv10020508mAT3G09260.1BGLU23,PYK10up0,180,6501,200,04519106861
Thhalv10020496mAT3G03640.1BGLU25,GLUCup−0,130,5821,460,0014158111634
Thhalv10001354mAT2G44490.1BGLU26,PEN2upup1,940,0001,700,00024011111721129
Thhalv10002501mAT4G22100.1BGLU3−1,190,036−0,220,547220542
Thhalv10004297mAT4G22100.1BGLU3downdown−1,300,000−2,000,0001138
Thhalv10028552mAT4G22100.1BGLU3−1,850,000−1,190,0008589170
Thhalv10002493mAT4G22100.1BGLU3down−2,570,000−1,310,00110092571
Thhalv10005858mAT3G60140.1BGLU30,SRG2up0,500,5666,190,000518344
Thhalv10018387mAT5G24550.1BGLU32upup5,960,0006,620,0007293145152650
Thhalv10002474mAT5G26000.1BGLU38,TGG1−0,370,529−0,380,598702
Thhalv10004165mAT5G26000.1BGLU38,TGG1−0,680,303−0,730,3751112
Thhalv10003954mAT5G26000.1BGLU38,TGG1−1,290,085−0,880,2196010
Thhalv10007404mAT1G26560.1BGLU40upup2,110,0002,540,0001676521015
Thhalv10027734mAT5G36890.1BGLU42down−1,090,0000,240,001773351731
Thhalv10020536mAT3G18080.1BGLU441,810,0021,010,006853
Thhalv10023411mAT1G61820.1BGLU46upup2,810,0057,020,0001157964
Analysis of transcript abundance changes of genes encoding β-glucosidases In response to UV light and AgNO3, most genes involved in aliphatic glucosinolate biosynthesis were strongly downregulated, with the exception of the putative orthologs of flavin-containing monooxygenase (FMO) genes encoding glucosinolate S-oxygenases (Table 2), probably resulting in a metabolic shift towards indolic and oxidized aliphatic glucosinolates. Based on homology and chromosomal position Thhalv10008073m is orthologous to AtSOT17/AtST5c (At1g18590), encoding a sulfotransferase with a preference for aliphatic desulfoglucosinolates as substrates [45,46]. Here, we observed strong transcriptional upregulation of EsSOT17 (Thhalv10008073m) in response to UV irradiation and AgNO3 treatment, similar to genes involved in indole glucosinolate biosynthesis. We speculate that in the two species the two orthologs have acquired different substrate specificities and that the Eutrema gene functions in indole glucosinolate biosynthesis. The two other confirmed desulfoglucosinolate sulfotransferases AtSOT18/AtST5b and AtSOT16/AtST5a have probably retained their function in aliphatic and indole glucosinolate biosynthesis, respectively.

WRKY transcription factors

In Arabidopsis, WRKY transcription factors play an essential role in the regulation of phytoalexin responses. Our data show that also in Eutrema several WRKY genes are upregulated, including the orthologs of WRKY40, WRKY75, WRKY33, WRKY6, WRKY51 and WRKY18 (Table 4). WRKY18 and WRKY40 are central regulators of indole glucosinolate modification in response to pathogens [47]. WRKY6 is associated with both senescence- and defence-related processes [48] and WRKY75, besides its role in phosphate acquisition [49], is also linked to senescence and pathogen defence [50,51]. WRKY51 plays a role in modulation of salicylate- and jasmonate signalling in defence [52]. In summary, these transcriptional changes indicate that also in Eutrema WRKYs are crucial for induced metabolic defence.
Table 4

Analysis of transcript abundance changes of genes encoding WRKY transcription factors

Transcript ID Best Ath hit WRKY UV Ag + Fold change log2 (UV/n.i.) FDR-p-value test Fold change log2 (Ag/n.i.) FDR-p-value test RNAseq Unique reads
n.i. UV AgNO3
Thhalv10002516mAT2G04880.21downdown−0,160,026−0,390,0001707989
Thhalv10012829mAT5G56270.12up0,350,1440,370,014742649786
Thhalv10004015mAT2G03340.13−0,270,315−0,020,923746866648
Thhalv10007428mAT1G13960.14upup2,270,0002,560,000148215562016
Thhalv10023390mAT1G62300.16upup4,840,0005,030,0008377229852
Thhalv10025630mAT4G24240.17−0,250,122−0,210,241384161260
Thhalv10025646mAT4G31550.111upup1,930,0013,530,0001207003144
Thhalv10000270mAT2G23320.115upup4,430,0003,380,00075749092951
Thhalv10001165mAT5G45050.216−0,220,6410,640,116596317825082
Thhalv10000242mAT2G24570.117upup1,640,0012,400,00030010892481
Thhalv10025785mAT4G31800.118upup2,150,0023,610,00017315822793
Thhalv10024810mAT4G26640.220down−0,170,133−0,380,029646333300
Thhalv10013115mAT4G26640.220down−1,460,0350,400,637367124210
Thhalv10016852mAT2G30590.121up0,690,0030,400,0018127
Thhalv10028843mAT4G01250.122upup2,880,0004,370,000750211
Thhalv10016764mAT2G30250.125upup1,790,0012,060,00023911821844
Thhalv10017017mAT2G30250.125upup1,550,0102,220,00022120136
Thhalv10013872mAT5G52830.127down0,720,036−1,290,005482710
Thhalv10025799mAT4G23550.1291,710,009−0,420,428181623
Thhalv10025126mAT4G30935.132down−0,170,244−0,330,0491203391285
Thhalv10016542mAT2G38470.133upup5,310,0004,370,0003251543311838
Thhalv10021115mAT3G04670.139up1,140,0011,980,000169143195
Thhalv10018925mAT1G80840.140upup6,440,0004,500,0002373987919
Thhalv10028794mAT4G11070.141upup4,240,0003,220,00064685
Thhalv10001568mAT2G46400.146upup3,150,0004,010,000729252639
Thhalv10005029mAT5G26170.150up0,170,6801,300,005416793
Thhalv10004930mAT5G64810.151upup4,290,0004,300,0005515201853
Thhalv10016713mAT2G40750.154upup1,270,0052,380,00040718403229
Thhalv10017926mAT2G40740.155upup6,270,0004,450,00031241411
Thhalv10018976mAT1G69310.1570,120,5590,280,173410196249
Thhalv10000288mAT2G25000.160downdown−2,140,000−0,700,002993790
Thhalv10006157mAT3G58710.169up−0,520,1621,540,0013448194
Thhalv10006146mAT3G56400.170upup1,660,0024,400,000216252512004
Thhalv10013146mAT5G15130.172up0,300,4503,540,0001125
Thhalv10014943mAT5G13080.175upup6,260,0007,020,000910761311
Analysis of transcript abundance changes of genes encoding WRKY transcription factors

EsWRKY33 complements camalexin deficiency in an Arabidopsis WRKY mutant

In Arabidopsis, WRKY33 is an essential regulator of camalexin biosynthesis and directly binds to the promoter of CYP71B15 (PAD3) [19]. Accordingly, its expression is induced by Pathogen-associated molecular patterns (PAMPs) and it is important for resistance against necrotrophic fungal pathogens [53-56]. Camalexin has not been detected in Eutrema and it does not contain a clear ortholog of CYP71B15. The closest CYP71B15 homolog in E. salsugineum shares only 66.7% identical amino acids. Nevertheless, EsWRKY33 is strongly upregulated upon phytoalexin inducing conditions (Figure 1; Table 4). We investigated whether EsWRKY33 can functionally replace AtWRKY33 as a positive regulator of camalexin biosynthesis and expressed EsWRKY33 in the Arabidopsis wrky33-1 mutant [54]. While in wrky33 leaves camalexin levels were significantly reduced in relation to wild type, wild type levels were restored in the complementing line (Figure 4). This indicates that even though Eutrema does not synthesize camalexin, EsWRKY33 can act as a positive regulator of camalexin biosynthesis in Arabidopsis.
Figure 4

Complementation of camalexin deficiency in Arabidopsis wrky33 knockout mutant by EsWRKY33 expression. All plants were induced by UV light and analysed 20 h after the onset of induction. Mean and standard deviation is depicted. Different letters above the bars indicate significantly different amounts of camalexin in the respective samples, as determined by one-way ANOVA (Bonferrfoni; p < 0.05); n = 11.

Complementation of camalexin deficiency in Arabidopsis wrky33 knockout mutant by EsWRKY33 expression. All plants were induced by UV light and analysed 20 h after the onset of induction. Mean and standard deviation is depicted. Different letters above the bars indicate significantly different amounts of camalexin in the respective samples, as determined by one-way ANOVA (Bonferrfoni; p < 0.05); n = 11.

Conclusions

In E. salsugineum, UV irradiation or heavy metal application resulted in substantial transcriptional reprogramming consistent with the induction of defence responses. Photosynthesis and starch synthesis were transcriptionally downregulated, while processes providing precursors for aromatic defence metabolites and cell wall compounds were transcriptionally induced. Strikingly, a shift in expression is observed from orthologs of genes for the biosynthesis of aliphatic glucosinolates, probably functioning primarily in insect defence, to orthologs of genes for the biosynthesis of indole glucosinolates, serving as precursors of phytoalexins. WRKY33 is an essential regulator of the camalexin biosynthetic gene CYP71B15 (PAD3) [19], for which there is probably no functional homolog in E. salsugineum, consistent with the absence of camalexin in this species [12]. Nevertheless, there is a putative Eutrema WRKY33 ortholog, which is strongly upregulated under phytoalexin inducing conditions. EsWRKY33 was functionally tested and shown to complement camalexin deficiency in an Atwrky33 mutant. We hypothesize that regulatory mechanisms for phytoalexin induction are conserved among members of the Brassicaceae, while the individual chemical structures have strongly diversified.

Methods

Plant growth conditions and stress treatments

After 10 days (E. salsugineum) or two days (A. thaliana) of stratification at 6°C, plants were grown in a growth chamber at a 12/12 h photoperiod at a light intensity of 80 to 100 μmol m−2 s−1 at 21°C and 40% relative humidity. For stress treatment leaves were sprayed with 5 mM AgNO3 or placed under a UV lamp (Desaga UVVIS, λ = 254 nm, 8 W) at a distance of 20 cm and radiated for 2 h. For Botrytis cinerea infection a spore suspension (strain B05.10, 2 × 105 spores per ml) was sprayed on the leaf surface.

RNA isolation, cDNA preparation and RT-qPCR

RNA extraction, cDNA synthesis and RT-qPCR, performed with the SYBRGreen/Light Cycler system (Roche), has been described previously [57]. The following primers were used: AtActin1: 5′TGGAACTGGAATGGTTAAGGCTGG3′ and 5′TCTCCAGAGTCGAGCACAATACCG3′ AtGAPC: 5′GCACCTTTCCGACAGCCTTG3′ and 5′ATTAGGATCGGAATCAACGG3′ EsActin1: 5′TGGAACTGGAATGGTTAAGGCTGG3′ and 5′TCTCCAGAGTCGAGCACAATACCG3′ EsYLS8: 5′GCGATTCTGGCTGAGGAAGA3′ and 5′CTTCCTTGCACCACGGTAGA3′ EsPP2AA2: 5′TGCTGAAGATAGGCACTGGA3′ and 5′CATTGAATTTGATGTTGGGAAC3′ EsASA1: 5′ATGTCTAGCGTTGGTCGTTATAGCG3′ and 5′CTTGACCACAGCCTCCTTGTACTCT3′ EsIGMT5: 5′AGTGCCAAGTCGTTGATGGT3′ and 5′TTGATACCCTTGATGTTTGGA3′ EsBGLU18-1: 5′AGAGGACCTTGGAGACCTTC3′ and 5′AGTTCTTCCCTCACTAACTTGGA3′ EsBGLU18-2: 5′CCTACTCGTGCTCTACTGGA3′ and 5′TCCCGGCTTAAGGAAATCAGA3′ EsPEN2: 5′CCAACAGGACTCAGAAACGT3′ and 5′GCAGTGACAACGAACAAGCT3′ EsWRKY33: 5′TATCCATTCACAGGAACAACAGAG3′ and 5′GGATGGTTATGGCTTCCCTT3′. Expression values of candidate genes were normalized to the geometric mean of three reference genes [58] (EsActin1, EsYELLOW-LEAF-SPECIFIC GENE 8 (EsYLS8), and EsPROTEIN PHOSPHATASE 2A SUBUNIT A2 (EsPP2AA2)). Expression level of EsWRKY33 in the A. thaliana background was normalized to AtActin1 and AtGAPC.

RNAseq setup and analysis

Total RNA was isolated from three biological replicates of either control leaves or from leaves treated either with UV light for 2 h followed by 6 h recovery, leaves sprayed with 5 mM AgNO3 and incubated 8 h, or 48 h after infection of plants with B. cinerea, using the NucleoSpin® RNA II Kit (Machery-Nagel). Single-end cDNA libraries were prepared and sequenced using Illumina HiSeq 2000 technology at LGC Genomics [59] to obtain 50 bp reads. Demultiplexing was done using Illumina’s CASAVA software [60]. Reads were adapter-clipped and reads shorter than 20 bases were discarded. Read quality was assessed using FASTQC [61]. Table 1 lists the resulting number of reads used for analyses. CLC Genomics workbench Version 6.5.1 [62] was used for RNAseq analysis including mapping to the Eutrema reference transcriptome [9] using default settings, allowing for at most two mismatches and a maximum of 10 transcript hits per read and generation of RPKM value statistic. Differential gene expression was detected using Fisher exact tests based on mapped read counts and with FDR-based correction for multiple testing errors [63]. Fold changes were computed using RPKM-values.

Microarray setup and statistical analysis

For each treatment, four biological replicates were investigated, generated from pooled tissues of 4 plants. Total RNA was extracted with NucleoSpin® RNA II Kit (Machery-Nagel). After DNase treatment, concentration and quality of extracted RNA was measured photometrically and with a Bioanalyzer (Agilent Technologies, Santa Clara, CA). Samples were hybridized to Agilent 8 × 60 k microarrays by OakLabs GmbH [64]. The arrays contain 42,562 oligonucleotide probes and are based on the recently developed Agilent 4 × 44 k Eutrema array [9]. Raw hybridization signals were quantile-normalized and log-base-2 transformed. Differential gene expression was assessed using ANOVA across all conditions and repeats and t-test statistic for pairwise comparisons with FDR-multiple testing correction [63]. Differential gene expression was mapped to metabolic pathways using the MAPMAN software [20].

RNAseq and microarray data match, functional annotation/candidate orthologs in Arabidopsis thaliana

Mapping of array probe identifiers to reference transcriptome identifiers was based on sequence matches using BLASTN with an E-value cutoff of 1E-05. Candidate ortholog genes in Arabidopsis thaliana were identified as best sequence identity hits using BLASTN with the same cutoff. The set of representative Arabidopsis transcripts available from TAIR10 [65] was used.

Generation of WRKY33 complementation lines

EsWRKY33 (Thhalv10016542m) coding sequence was amplified from cDNA (E. salsugineum leaves, 5 h after UV treatment) using the primer pair 5′GGCTTAAUATGGCTGCTTCTTCTCTTC3′ and 3′GGTTTAAUTCACGACAAAAACGAATCAAA5′ and cloned into pCAMBIA330035Su via USER technology [66]. After confirmation of the correct cDNA sequence, Agrobacterium-mediated transformation of Arabidopsis wrky33-1 knockout mutant (SALK_006603; [54]) was performed via floral-dipping, and successful transformants were confirmed by BASTA resistance of the seedlings and by PCR analysis. Primary transformants were analysed for EsWRKY33 expression by RT-qPCR. One low (#1, 0.48 ± 0.26 fg/fg AtActin1, 0.11 ± 0.09 fg/fg GAPC) and one high (#2, 16.2 ± 7.8 fg/fg AtActin1, 2.8 ± 1.7 fg/fg GAPC) expression line was selected for phenotype analysis.

Metabolite analysis

Camalexin formation was induced in six-week old A. thaliana plants by treatment with UV (see above). Camalexin was isolated 20 h after the onset of induction and quantified applying HPLC with fluorescence detection as described [67]. For monitoring wasalexin A formation, E. salsugineum leaves were treated with either UV light for 2 h followed by 22 h incubation, sprayed with 5 mM AgNO3 and incubated 24 h, or sprayed with B. cinerea spore suspension and incubated 48 h. Plant material was frozen in liquid nitrogen. Leaves were ground and 900 μl methanol were added. The samples were incubated at room temperature for 30 min under agitation, centrifuged for 15 min at 14,000 rpm and the supernatant was transferred to a new tube. To increase the yield of metabolites the extraction was repeated once and supernatants were combined. The solvent was evaporated completely (SA-Speed Concentrator, H.Saur Laborbedarf) and metabolites were dissolved in 400 μl 100% methanol. Quantification of Wasalexin A was done via reverse-phase HPLC (Göhler Multohigh100 RP-18, 5 μm, 250mmx4mm; flow rate: 1 ml/min; solvents: acetonitrile and 0.3% formic acid in H2O; 20% acetonitrile for 2 min, followed by a 17 min linear gradient to 70% acetonitrile and then 3 min to 100% acetonitrile). The peaks at 20.2 min and 21.5 min (ODmax: 362 nm) were identified as Wasalexin B and Wasalexin A, respectively by comparison with authentic standard with respect to retention time and UV spectrum.

Availability of supporting data

All curated supporting data are included as additional files. The raw RNAseq data have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) database under the accession number SRP048695. Microarray data was deposited at Gene Expression Omnibus (GEO) database under the accession numbers GSM1530883 to GSM1530894 (platform accession GPL19319).
  60 in total

1.  Genome-wide analysis of gene expression reveals function of the bZIP transcription factor HY5 in the UV-B response of Arabidopsis.

Authors:  Roman Ulm; Alexander Baumann; Attila Oravecz; Zoltán Máté; Eva Adám; Edward J Oakeley; Eberhard Schäfer; Ferenc Nagy
Journal:  Proc Natl Acad Sci U S A       Date:  2004-01-22       Impact factor: 11.205

2.  A comparative study of the early osmotic, ionic, redox and hormonal signaling response in leaves and roots of two halophytes and a glycophyte to salinity.

Authors:  Hasna Ellouzi; Karim Ben Hamed; Iker Hernández; Jana Cela; Maren Müller; Christian Magné; Chedly Abdelly; Sergi Munné-Bosch
Journal:  Planta       Date:  2014-08-26       Impact factor: 4.116

3.  Plants contain two distinct classes of functional tryptophan synthase beta proteins.

Authors:  Ruohe Yin; Monika Frey; Alfons Gierl; Erich Glawischnig
Journal:  Phytochemistry       Date:  2010-08-09       Impact factor: 4.072

4.  Secondary metabolites influence Arabidopsis/Botrytis interactions: variation in host production and pathogen sensitivity.

Authors:  Daniel J Kliebenstein; Heather C Rowe; Katherine J Denby
Journal:  Plant J       Date:  2005-10       Impact factor: 6.417

5.  Desulfoglucosinolate sulfotransferases from Arabidopsis thaliana catalyze the final step in the biosynthesis of the glucosinolate core structure.

Authors:  Markus Piotrowski; Andreas Schemenewitz; Anna Lopukhina; Axel Müller; Tim Janowitz; Elmar W Weiler; Claudia Oecking
Journal:  J Biol Chem       Date:  2004-09-09       Impact factor: 5.157

6.  Camalexin is synthesized from indole-3-acetaldoxime, a key branching point between primary and secondary metabolism in Arabidopsis.

Authors:  Erich Glawischnig; Bjarne Gram Hansen; Carl Erik Olsen; Barbara Ann Halkier
Journal:  Proc Natl Acad Sci U S A       Date:  2004-05-17       Impact factor: 11.205

7.  Evidence for a positive regulatory role of strawberry (Fragaria x ananassa) Fa WRKY1 and Arabidopsis At WRKY75 proteins in resistance.

Authors:  Sonia Encinas-Villarejo; Ana M Maldonado; Francisco Amil-Ruiz; Berta de los Santos; Fernando Romero; Fernando Pliego-Alfaro; Juan Muñoz-Blanco; José L Caballero
Journal:  J Exp Bot       Date:  2009-05-21       Impact factor: 6.992

8.  Role of HKT1 in Thellungiella salsuginea, a model extremophile plant.

Authors:  Akhtar Ali; Hyeong Cheol Park; Rashid Aman; Zahir Ali; Dae-Jin Yun
Journal:  Plant Signal Behav       Date:  2013-06-10

9.  Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments.

Authors:  Hussam H Nour-Eldin; Bjarne G Hansen; Morten H H Nørholm; Jacob K Jensen; Barbara A Halkier
Journal:  Nucleic Acids Res       Date:  2006-09-25       Impact factor: 16.971

10.  Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.

Authors:  Jo Vandesompele; Katleen De Preter; Filip Pattyn; Bruce Poppe; Nadine Van Roy; Anne De Paepe; Frank Speleman
Journal:  Genome Biol       Date:  2002-06-18       Impact factor: 13.583

View more
  7 in total

1.  How a Mangrove Tree Can Help to Improve the Salt Tolerance of Arabidopsis and Rice.

Authors:  Marc Somssich
Journal:  Plant Physiol       Date:  2020-12       Impact factor: 8.340

2.  Molecular characterization of Brassica napus stress related transcription factors, BnMYB44 and BnVIP1, selected based on comparative analysis of Arabidopsis thaliana and Eutrema salsugineum transcriptomes.

Authors:  Roohollah Shamloo-Dashtpagerdi; Hooman Razi; Esmaeil Ebrahimie; Ali Niazi
Journal:  Mol Biol Rep       Date:  2018-07-23       Impact factor: 2.316

3.  WRKY12 represses GSH1 expression to negatively regulate cadmium tolerance in Arabidopsis.

Authors:  Yangyang Han; Tingting Fan; Xiangyu Zhu; Xi Wu; Jian Ouyang; Li Jiang; Shuqing Cao
Journal:  Plant Mol Biol       Date:  2019-01-07       Impact factor: 4.076

4.  The role of MYB34, MYB51 and MYB122 in the regulation of camalexin biosynthesis in Arabidopsis thaliana.

Authors:  Henning Frerigmann; Erich Glawischnig; Tamara Gigolashvili
Journal:  Front Plant Sci       Date:  2015-08-25       Impact factor: 5.753

Review 5.  Lipid remodelling: Unravelling the response to cold stress in Arabidopsis and its extremophile relative Eutrema salsugineum.

Authors:  Cristina Barrero-Sicilia; Susana Silvestre; Richard P Haslam; Louise V Michaelson
Journal:  Plant Sci       Date:  2017-07-27       Impact factor: 4.729

6.  Beneficial Effects of Salt on Halophyte Growth: Morphology, Cells, and Genes.

Authors:  Fang Yuan; Yanyu Xu; Bingying Leng; Baoshan Wang
Journal:  Open Life Sci       Date:  2019-06-24       Impact factor: 0.938

7.  Genome-wide analysis of WRKY gene family in the sesame genome and identification of the WRKY genes involved in responses to abiotic stresses.

Authors:  Donghua Li; Pan Liu; Jingyin Yu; Linhai Wang; Komivi Dossa; Yanxin Zhang; Rong Zhou; Xin Wei; Xiurong Zhang
Journal:  BMC Plant Biol       Date:  2017-09-11       Impact factor: 4.215

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.