| Literature DB >> 26048695 |
Ni Tien1, Yun-Ju Sung, Yi-Chih Chang, Bang-Jau You, Michelle Liang, Yun-Ping Lim, Wen-Yu Ho, Hsiu-Shen Lin, Mao-Wang Ho, Chen-Mao Ho, Chao-Chin Chang, Yu-Ching Lan.
Abstract
Brucellosis is a bacterial zoonotic disease which can be easy to misdiagnose in clinical microbiology laboratories. In the present study, we have tried to improve the current clinical method for detecting Brucella spp. and its antibiotic characteristics. Our method begins with detecting the clinical isolate through traditional biochemical methods and automatic identification systems. Then, we move on to editing the sequence for BLAST allows us to compare 16s rRNA sequences with sequences from other species, allowing the gene level to be determined. Next, the phylogenetic analysis of multiple genetic loci is able to determine the evolutionary relationships between our bacteria strain and those from other locations. Finally, an anti-microbial susceptibility test hones in on the level of antibacterial activity that the bacteria displays. Employing these four steps in concert is extremely effective in identifying rare bacteria. Thus, when attempting to determine the identity of rare bacteria such as Brucella, utilizing these four steps from our research should be highly effective and ultimately prevent further identification errors and misdiagnoses. The standards we have suggested to identify rare bacteria strains is applicable not only to Brucella, but also to other rarely encountered bacteria.Entities:
Year: 2015 PMID: 26048695 PMCID: PMC4502044 DOI: 10.7603/s40681-015-0009-6
Source DB: PubMed Journal: Biomedicine (Taipei) ISSN: 2211-8020
Oligonucleotide sequences used for the amplification and sequencing of four genetic loci.
| Locus | Function | Primer sequences | Length (bp) |
|---|---|---|---|
|
| 3-phosphoshikimate 1-carboxyvinyltransferase | 5’ GACCATCGACGTGCCGGG 3’ 5’ YCATCAKGCCCATGAATTC 3’ | 565 |
|
| glucokinase | 5’ TATGGAAMAGATCGGCGG 3’ 5’ GGGCCTTGTCCTCGAAGG 3’ | 475 |
|
| chaperone protein | 5’ CGTCTGGTCGAATATCTGG 3’ 5’ GCGTTTCAATGCCGAGCGA 3’ | 470 |
|
| DNA gyrase B subunit | 5’ ATGATTTCATCCGATCAGGT 3’ 5’ CTGTGCCGTTGCATTGTC 3’ | 469 |
Fig. 1Tigecycline MICs results were determined by the E test.
Susceptibility testing results were determined via disk diffusion method.
| Antibiotics | Concentration (µg/ml) | Inhibitory zone (mm) |
|---|---|---|
| Tetracycline | 30 | 28 |
| Streptomycin | 10 | 30 |
| 300 | 40 | |
| Rifampin | 5 | 21 |
| Trimethoprim-sulfamethoxazole | 1.25/23.75 | 22 |