Literature DB >> 25972083

Development of a real-time reverse transcription loop-mediated isothermal amplification method for the rapid detection of porcine epidemic diarrhea virus.

Xuewu Yu1,2, Lin Shi3,4, Xiaoping Lv5, Wei Yao6, Minghui Cao7, Hanxun Yu8, Xiurong Wang9, Shimin Zheng10.   

Abstract

BACKGROUND: Porcine epidemic diarrhea (PED) is an acute and highly contagious enteric disease characterized by severe enteritis, vomiting and watery diarrhea in swine. Recently, the outbreak of the epidemic disease has been a serious problem in swine industry. The objective of this study is to develop a rapid, sensitive, and real-time reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for the detection of porcine epidemic diarrhea virus (PEDV) in less equipped laboratories.
RESULTS: The optimal reaction condition of the current real-time RT-LAMP for PEDV was 62 °C for 45 min. It was capable of detecting PEDV from clinical samples and differentiating PEDV from several related porcine viruses, while it did not require additional expensive equipment. The minimum detection limit of the real-time RT-LAMP assay was 0.07PFU per reaction for PEDV RNA, making this assay approximately 100-fold more sensitive than that of one-step RT-PCR. By screening a panel of clinical specimens, the results showed that this method presented a similar sensitivity with real-time RT-PCR and was somewhat sensitive than one-step RT-PCR in detection of clinical samples.
CONCLUSIONS: In this study, we have developed a new real-time RT-LAMP method, which is rapid, sensitive and efficient to detect PEDV.This method holds great promises not only in laboratory detection and discrimination of PEDV but also in large scale field and clinical studies.

Entities:  

Mesh:

Year:  2015        PMID: 25972083      PMCID: PMC4459462          DOI: 10.1186/s12985-015-0297-1

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Background

Porcine epidemic diarrhea (PED) is an acute, highly contagious and devastating enteric disease characterized by severe enteritis, vomiting and watery diarrhea in swine [1]. PED is caused by porcine epidemic diarrhea virus (PEDV), which was firstly identified in Belgium in 1978 [2]. PEDV is an enveloped, single-strand, and positive-sense RNA virus, which belongs to the Coronaviridae family [3]. The PEDV genome is ~28 kb in length and comprised of a 5′ untranslated region (UTR), a 3′ UTR, and at least seven open reading frames (ORFs) that encode four structural proteins [spike (S),envelope (E), membrane (M),and nucleocapsid (N)] and three non-structural proteins(replicase 1a and 1b, and ORF3) [4]. In China, PED was firstly occurred in Shanghai in 1973. So far, PEDV has been observed on most swine breeding farms in most provinces since late 2010 in China [5].The economic losses caused by PEDV infection have been continuous and serious in China [6]. Recently, PEDV has suddenly emerged in the United States and rapidly spread across the country, resulting in high mortality in infected newborn piglets, which have posed serious economic losses to the swine industry in the USA [7, 8]. Rapid diagnosis and timely monitoring of potential PED outbreaks are among the first important steps in the prevention and control of PED. Currently, several conventional methods are available for the detection of PEDV, including virus isolation, fluorescence assay, immune electron microscopy, enzyme-linked immuno- sorbent assay and molecular biological characterization [9]. However, the isolation and identification of viruses require extended periods of time ranging from days to weeks; so this method does not meet the time requirements needed for the prevention of epidemics. Therefore, these rapid, sensitive and specific molecular biological techniques, including RT-PCR and real-time RT-PCR, have played important roles in the rapid detection of PEDV [10]. Nevertheless, all of these techniques require sophisticated instrumentation (such as PCR machines and quantitative fluorescence PCR machines), limiting the effectiveness of these procedures in smaller, under-equipped laboratories. The loop-mediated isothermal amplification (LAMP) technique is a molecular biology method used to amplify specific DNA fragments in vitro [11]. This method only requires a water bath or heating block to amplify large amounts of nucleic acids in 30 ~ 60 minutes without additional expensive equipments [12]. In addition, there is no need to use nucleic acid electrophoresis to assess the result, for the reason that the result can be easily observed in the presence of a fluorescent dye [13]. These characteristics make the LAMP method a simple, fast, effective and practical DNA amplification method, which has been successfully implemented for the detection of avian influenza A viruses [14], porcine reproductive and respiratory syndrome virus [15], foot-and mouth disease virus [16] and PEDV [17]. The PEDV M protein, the most abundant envelope component, is a triple-spanning membrane glycoprotein with a short amino-terminal domain outside of the virus and a long carboxy-terminal domain inside [18]. The M protein plays an important role in the virus-assembly process, and induces antibodies that neutralize the virus in the presence of its complement [19]. In this study, five primer sets were designed based on the conserved regions of the M gene, and a real-time RT-LAMP method was developed for the detection of PEDV.

Results

Primer set screening for real-time RT-LAMP assay

To select the optimal primer set for the real-time RT-LAMP assay, the primer set screening assay was investigated at 63 °C for 45 min using the LA-320C Loopamp real-time turbidimeter (Teramecs, Japan). As show in Fig. 1a, the first primer set was the best one for the real-time RT-LAMP assay of PEDV among the five primer sets. However, in the end of the RT-LAMP amplification reactions, the real-time turbidity of the fifth primer set was somewhat higher than that of other primer sets; and there were no significant difference in the fluorescence intensities of the products among using these five primer sets (Fig. 1b). As a result, the first primer set was used in subsequent studies.
Fig. 1

Primer set selection for the real-time RT-LAMP assay. LAMP products were detected by a real-time turbidity assay using an LA-320c (a) and a fluorescence assay (b)

Primer set selection for the real-time RT-LAMP assay. LAMP products were detected by a real-time turbidity assay using an LA-320c (a) and a fluorescence assay (b)

Optimal temperature for real-time RT-LAMP assay

Using the first primer set, the effect of reaction temperature on the real-time RT-LAMP was investigated. As show in Fig. 2, the best temperature for the real-time RT-LAMP assay of PEDV was at 62 °C. However, in the end of the RT-LAMP amplification reactions, the real-time turbidity of DNAs from the reactions at 60 °C was somewhat higher than that at other reaction temperatures, but which was not determined as the optimal temperature for the real-time RT-LAMP amplifying PEDV M gene.
Fig. 2

Optimization of temperature for the real-time RT-LAMP assay. The same reaction mixtures were incubated at 60, 61, 62, 63, 64, or 65 °C for 1 h, respectively

Optimization of temperature for the real-time RT-LAMP assay. The same reaction mixtures were incubated at 60, 61, 62, 63, 64, or 65 °C for 1 h, respectively

Sensitivity of real-time RT-LAMP

To evaluate the sensitivity of the real-time RT-LAMP assay, the detection limit of the assay was determined by testing 10-fold serial dilutions of the PEDV (LNsy201401), which has a defined median tissue culture infective dose (TCID50). The real-time RT-LAMP sensitivity assay was performed at 62 °C for 60 min. The kinetic analysis of the real-time turbidity revealed that the real-time RT-LAMP assay was able to detect the PEDV at the level of 10−1 TCID50/mL per tube, which equal to a virus titer of 0.07 PFU (Fig. 3a). The assay sensitivity was also confirmed by visual inspection. As shown in Fig. 3b, the clear fluorescence signals were observed at the concentrations ranging from 104.0 to 10−1 TCID50/mL per tube. There were no differences observed in the sensitivity between the real-time turbidity and visual fluorescence detections that were associated with the real-time LAMP assay.
Fig. 3

Comparative sensitivity of real-time RT-LAMP, one-step RT-PCR, and real-time RT-PCR methods. Real-time RT-LAMP, one-step RT-PCR and real-time RT-PCR were performed using viral RNAs at the concentrations ranging from 104.0 to 10−2 TCID50/mL per tube. a and b Detection limit of real-time RT-LAMP. LAMP products were detected using a real-time turbidity assay with an LA-320c (a) and a fluorescence assay (b). c Detection limit for the one-step RT-PCR using the same RNA extracts that were used for real-time RT-LAMP. PCR products were observed in a 1.5 % agarose gel that was stained with ethidium bromide. The lanes from left to right were as follows: lane M, DNA marker DL2000; lanes 1 ~ 7, the one-step RT-PCR results from104.0 to 10−2 TCID50/mL diluted virions; lanes 8, negative control. d Detection limit for real-time RT-PCR using the same RNA extracts that were used for real-time RT-LAMP. PCR products were detected using a real-time fluorescence assay with an ABI7500 system. Line 1–7, the real-time RT-PCR results from104.0 to 10−2 TCID50/mL diluted virions; Line8, negative control

Comparative sensitivity of real-time RT-LAMP, one-step RT-PCR, and real-time RT-PCR methods. Real-time RT-LAMP, one-step RT-PCR and real-time RT-PCR were performed using viral RNAs at the concentrations ranging from 104.0 to 10−2 TCID50/mL per tube. a and b Detection limit of real-time RT-LAMP. LAMP products were detected using a real-time turbidity assay with an LA-320c (a) and a fluorescence assay (b). c Detection limit for the one-step RT-PCR using the same RNA extracts that were used for real-time RT-LAMP. PCR products were observed in a 1.5 % agarose gel that was stained with ethidium bromide. The lanes from left to right were as follows: lane M, DNA marker DL2000; lanes 1 ~ 7, the one-step RT-PCR results from104.0 to 10−2 TCID50/mL diluted virions; lanes 8, negative control. d Detection limit for real-time RT-PCR using the same RNA extracts that were used for real-time RT-LAMP. PCR products were detected using a real-time fluorescence assay with an ABI7500 system. Line 1–7, the real-time RT-PCR results from104.0 to 10−2 TCID50/mL diluted virions; Line8, negative control When the same RNA template was subjected to one-step RT-PCR and real-time RT-PCR, the detection limit of the one-step RT-PCR was 101.0 TCID50/mL per tube, which equal to a virus titer of 7.0 PFU (Fig. 3c); while the detection limit of the real-time RT-PCR was 10−1 TCID50/mL per tube, which equal to a virus titer of 0.07 PFU (Fig. 3d). The results indicated that the sensitivity of the real-time RT-LAMP assay was approximately 100-fold higher than that of one-step RT-PCR, and the real-time RT-LAMP had a similar sensitivity as the real-time RT-PCR. The results suggested that the real-time turbidity of DNAs from the reactions at concentrations ranging from 104.0 to 10−1 TCID50/mL showed high intensities when the reaction was performed for 45 min (Fig. 3a). Therefore, the optimal reaction condition of the current real-time RT-LAMP for PEDV was 62 °C for 45 min.

Specificity of real-time RT-LAMP

Following the optimization of the conditions of the real-time RT-LAMP, several related porcine viruses (including CSFV, PRRSV, TGEV, PRV, SIV(H1N1), PCV2, PPV and PrV) were tested using the real-time RT-LAMP assay to evaluate the primer specificity. PEDV (LNsy201401) was used as the positive control, and the reactions that were performed in the absence of the template were used as negative controls. Only the PEDV was positive, and no LAMP products were detected in the reactions that were performed with RNAs or DNAs harvested from other relevant swine viruses used in this study (Fig. 4a and b). These results indicated that the real-time RT-LAMP assay was specific and can used to specifically amplify PEDV.
Fig. 4

Specificity of real-time RT-LAMP assay for different porcine viruses. Viral RNA or DNA samples were extracted from different porcine viruses. The real-time RT-LAMP reaction was assessed based on visual inspection. aThe channel 1–8 (CH1-CH8) were real-time RT-LAMP results from the templates PEDV, CSFV, PRRSV, TGEV, PRV, SIV(H1N1), PCV2, and negative control , respectively. b The channel from left to right were as follows: CH1, PEDV; CH2, PPV; CH3, PrV; CH4, negative control

Specificity of real-time RT-LAMP assay for different porcine viruses. Viral RNA or DNA samples were extracted from different porcine viruses. The real-time RT-LAMP reaction was assessed based on visual inspection. aThe channel 1–8 (CH1-CH8) were real-time RT-LAMP results from the templates PEDV, CSFV, PRRSV, TGEV, PRV, SIV(H1N1), PCV2, and negative control , respectively. b The channel from left to right were as follows: CH1, PEDV; CH2, PPV; CH3, PrV; CH4, negative control

Detection of PEDV in clinical samples

To evaluate the ability of the real-time RT-LAMP assay to detect PED viruses from clinical samples, 52 clinical samples were collected from ten pig farms in Liaoning province. All samples were tested by real-time RT-LAMP, one-step RT-PCR and real-time RT-PCR simultaneously. As shown in Table 1, real-time RT-LAMP gave 31 positive cases of 52 samples; one-step RT-PCR gave 27 positive cases and real-time RT-PCR gave 30 positive cases. The positive rates detected by real-time RT-LAMP, one-step RT-PCR and real-time RT-PCR were 59.6 % (31/52), 51.9 % (27/52) and 57.8 % (30/52), respectively. The real-time RT-LAMP had a similar sensitivity with real-time RT-PCR and was somewhat sensitive than one-step RT-PCR in detection of PEDV in clinical samples.
Table 1

Detection of PEDV in clinical samples by real-time RT-LAMP, real-time RT-PCR, and one-step RT-PCR

Types of samplesTotal number of samplesPEDV positive samples
RT-PCRreal-time RT-PCRRT-LAMP
Feces37182021
Intestinal contents1591010
Total52273031
Detection of PEDV in clinical samples by real-time RT-LAMP, real-time RT-PCR, and one-step RT-PCR

Discussion

PEDV infection has caused continuous and severe economic loss in China. although inactivated vaccines against PEDV are used in some regions in China [5]. At present, the control of PEDV infection primarily depends on the early identification to prevent the further spread of the virus. Therefore, the development of a simple and rapid diagnostic method for PEDV is extremely significant. Even now, diagnostic methods for detecting PEDV all require high-precision instruments. Therefore, they are unsuitable for detecting PEDV in fields and in less well-equipped laboratories. In this study, a real-time RT-LAMP assay with the PEDV M gene specific primers was successfully developed and optimized. The reaction conditions of the the real-time RT-LAMP were optimized by selecting primers sets and performing the test at different temperatures. Subsequently, its sensitivity was compared with that of one-step RT-PCR. The real-time RT-LAMP assay was able to detect PEDV with a detection limit of 10−1 TCID50/mL, which equals to a virus titer of 0.07 PFU (Fig. 3a). The 104.0 TCID50/mL PEDV had an RNA viral load of 106.846(7.02 × 106) copies. The results showed that the specificity of real-time RT-LAMP for PEDV was approximately 100-fold more sensitive than that of one-step RT-PCR. Moreover, the sensitivity between real-time RT-LAMP and real-time RT-PCR was compared using the same PEDV RNA template. The real-time RT-LAMP had a similar sensitivity with real-time RT-PCR. Four clinical samples were determined to be PEDV negative by one-step RT-PCR, but the real-time RT-LAMP was able to detect them as PEDV positive. The results further suggested that the real-time RT-LAMP assay was slightly more sensitive than one-step RT-PCR for the detection of the PEDV M gene. The developed PEDV M gene real-time RT-LAMP method has a higher sensitivity (10−1 TCID50/mL) than the RT-LAMP method developed for N gene with detection limit 100.75 TCID50/ml, which was determined to be more sensitive than gel-based RT-PCR and ELISA in previous study [17]. The real-time RT-LAMP method developed using this primer set was used to examine PEDV and eight additional porcine pathogens. The viruses such as CSFV, PRRSV, TGEV, PRV, SIV(H1N1), PCV2, PPV or PrV may cause co-infection in pigs; PEDV and TGEV belong to the Group I coronaviruses which are closely related [20]. The results showed that this method specifically amplified only the PEDV M gene sequences without any other porcine virus genes demonstrating that the real-time RT-LAMP possesses a high level of specificity for PEDV. In conclusion, the real-time RT-LAMP method for PEDV established in this study demonstrated a high level of sensitivity and specificity. With the real-time RT-LAMP method, the results can be read visually in the absence of a real-time turbidimeter. The isothermal conditions required for LAMP can be provided with a conventional water bath or heat block, which can be applied in less well-equipped laboratories and fields for rapid detection of PEDV. Thus, compared to the requirements associated with one-step RT-PCR and real-time RT-PCR, the simplicity and affordability of the LAMP assay allow for the most convenient identification of PEDV among the three methods. This method offers a simple, effective, rapid and economical early diagnostic technique for the detection and potential control of PEDV.

Conclusions

We have developed an efficient approach to rapidly detect PEDV. This method holds great promises not only in laboratory detection and discrimination of PEDV but also in large scale field and clinical studies.

Materials and methods

Viruses

PEDV LNsy201401 was isolated from intestinal tissue of piglets; and its M gene was sequenced (TaKaRa, Dalian, China). PEDV was propagated in African green monkey kidney (Vero) cells according to reference with modification [21, 22]. The median tissue culture infective dose per milliliter (TCID50/ml) of PEDV was 105.0. Porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), transmissible gastroenteritis virus (TGEV), porcine rotavirus (PRV), porcine circovirus type 2 (PCV2), porcine parvovirus (PPV), and pseudorabies virus (PrV) were propagated in susceptible cells. Swine influenza virus (SIV, H1N1) was propagated in the allantoic sac and amniotic cavity of 9-day-old specific pathogen-free (SPF) chicken embryos for 48 to 72 hours at 37 °C [23, 24].

Primers

Based on the M gene sequence of PEDV (JX435310), five sets of primers were designed using the Primer Explorer version 4 software (Eiken Chemical Co., Ltd., Tokyo, Japan; http://primerexplorer.jp/elamp4.0.0/index.html) and synthesized by Shanghai Sangon Co., Ltd. A set of primers included two outer primers (forward primer M-F3 and reverse primer M-B3), two inner primers (forward inner primer M-FIP and reverse inner primer M-BIP). For comparative purposes, conventional RT-PCR methods based on N and M genes were both constructed. The developed PEDV N gene conventional RT-PCR method sensitivity was higher, in comoparison to the conventional RT-PCR developed for M gene. Therefore, the pair of primers based on N gene (JQ743655, named P1 and P2) designed to amplify a 428-bp fragment was utilized in further study. The primers and probes used for real-time RT-PCR targeting N gene were listed in Table 2 [25]. The specificity of the primers for real-time RT-LAMP was confirmed against random nucleotide sequences using a BLAST search in GenBank databases located in the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/BLAST/).
Table 2

Sequences of the primers and probe used in this study

ApplicationPrimer nameLength(bp)Primer/probe sequence(5′ to 3′)
Set 1 primers for RT-LAMPM1-F320GGACACATTCTTGGTGGTCT
M1-B320CCAACACGTCCGTAGACAAT
M1-FIP42TGGTGCTCCAAGCACTGGAATGACGCGCTTCTCACTACTTCT
M1-BIP40AAGGTTGCTACTGGCGTACAGGTTGTAGTGGCCTTGGCGA
Set 2 primers for RT-LAMPM2-F318ACAGACGCGCTTCTCACT
M2-B320CCAACACGTCCGTAGACAAT
M2-FIP39AGCGTTACACCAGTTGGTGCTCTTCTGTGATGGGCCGAC
M2-BIP40AAGGTTGCTACTGGCGTACAGGTTGTAGTGGCCTTGGCGA
Set 3 primers for RT-LAMPM3-F319GCGCAGGACACATTCTTGG
M3-B319TTGGCGACTGTGACGAAAT
M3-FIP40GGAATGCAGACCTGTCGGCCTCAATCCTGAAACAGACGCG
M3-BIP41TGGAGCACCAACTGGTGTAACGGTACGCCAGTAGCAACCTT
Set 4 primers for RT-LAMPM4-F318CCGACAGGTCTGCATTCC
M4-B320CCAGTGCCAGATGAAGCATT
M4-FIP42CCTGTACGCCAGTAGCAACCTTGAGCACCAACTGGTGTAACG
M4-BIP41ATTTCGTCACAGTCGCCAAGGCGACTGAACGACCAACACGT
Set 5 primers for RT-LAMPM5-F320AGCTTTCAGGTCAATTGGGT
M5-B320GGAGTGTTAGCGTTACACCA
M5-FIP42TGCGCCACAACCGAATGCTATTCAGCATCCTTATGGCTTGCA
M5-BIP41TCAATCCTGAAACAGACGCGCTTGCTCCAAGCACTGGAATG
RT-PCRP121TTCCCAGCGTAGTTGAGATTG
P221CGAAGTGGCTCTGGATTTGTT
real-time RT-PCRPED-NF24CGCAAAGACTGAACCCACTAATTT
PED-NR24TTGCCTCTGTTGTTACTTGGAGAT
PED-Cy524Cy5-TGTTGCCATTGCCACGACTCCTGC-BHQ3
Sequences of the primers and probe used in this study

RNA extraction

The total RNAs were extracted from the culture supernatants of PEDV, CSFV, PRRSV, TGEV, PRV, SIV(H1N1) using the TRIzol reagent (Invitrogen, CA, USA) and the genomic DNAs of PCV2, PPV and PrV were extracted with the DNAzol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. The extracted RNA or DNA was resuspended in 20 μL of diethylpyrocarbonate water or sterile water.

Real-time RT-LAMP

The real-time RT-LAMP reaction was performed in a final reaction volume of 25 μL by using a Loopamp RNA amplification kit (Eiken Chemical Co. Ltd., Japan) containing 1 μL RNA template, 40 pmol each of inner primers M-FIP and M-BIP, 5 pmol each of outer primers M-F3 and M-B3, 1.4 mM dNTPs mix, 0.8 M betaine, 0.1 % Tween20, 10 mM (NH4)2SO4, 8 mM MgSO4, 10 mM KCl, 20 mM Tris–HCl (pH 8.8), 16 U Bst DNA polymerase (New England Biolabs, USA), 0.125 U AMV (Invitrogen, CarlsBad, CA, USA) and 1 μL fluorescent detection reagent (FD) (Eiken Chemical Co. Ltd., Japan). Amplification reactions were performed at 63 °C for 60 min using either a LA-320C Loopamp real-time turbidimeter (Teramecs, Japan) or in a water bath. The mixtures were heated at 80 °C for 10 min to terminate the reactions. The turbidity of the reaction was measured in real time, and the result was indicated by the graph on the monitor of real-time turbidimeter, verifying the start of the amplification. LAMP products were then evaluated with a fluorescent detection reagent (Eiken Chemical Co., Ltd., Japan). A negative control (a sample devoid of template) was included in each reaction.

Optimization of the real-time RT-LAMP assay

To determine the optimal reaction temperature, the real-time RT-LAMP reaction mixtures were incubated at 60, 61, 62, 63, 64, or 65 °C for 1 h. The optimal reaction time was determined by performing the RT-LAMP real-time sensitivity assay at the optimal temperature.

RT-PCR and real-time RT-PCR

RT-PCR was performed with primers (P1 and P2) specific for the PEDV N gene using a PrimeScript™ one-step RT-PCR kit(Takara, Dalian, China). RT-PCR conditions were optimized. RT-PCR parameters included 50 °C for 30 min, 94 °C for 2 min, 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 40 s, followed by the final extension at 72 °C for 2 min. The RT-PCR products were subjected to electrophoresis on a 1.5 % agarose gel, and the target bands were visualized by staining with ethidium bromide. The real-time RT-PCR was performed with the primers (PED-NF and PED-NR) and the probe (PED-Cy5) specific for the N gene of PEDV, as described previously [20]. The quantitative one-step RT-PCR kit (Invitrogen Life Technologies™, USA) was used for real-time RT-PCR. In brief, real-time RT-PCR was carried out in a 20 μL reaction containing 0.8 μL of ThermoScript™ plus/ Platinum® Taq Enzyme Mix, 10 μL of 2× ThermoScript Reaction Mix (a final concentration of 3 mM MgCl2), 0.5 μL of both PEDV forward and reverse primer, 0.5 μL of PEDV-Cy5 probe, 2 μL of RNA, and 5.7 μL of water. The reaction was carried out in an ABI7500 (Applied Bio systems) under the following conditions: initial reverse transcription at 58 °C for 30 min, followed by initial denaturation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 30 s, and annealing and extension at 60 °C for 1 min. The intensities of the fluorescent dyes in each reaction were read automatically during PCR cycling and optical data were analyzed with 7500 software v2.0.6.

Detection of PEDV in clinical samples by one-step RT-PCR, real-time RT-PCR, and real-time RT-LAMP

In total, fifty-two clinical samples (including feces and intestinal samples) from piglets with signs of severe watery diarrhea, dehydration were collected from ten pig farms in Liaoning province in China between February 2014 and June 2014. The samples were homogenized with phosphate-buffered saline (PBS, pH 7.4) as a 10 % (w/v) suspension and centrifuged for 10 min at 1700× g at 4 °C. The supernatant were collected and stored at −80 °C until used. The supernatant was subjected to RNA extraction with above-mentioned RNA extraction kit. The resulting RNA was used as a template for one-step RT-PCR, real-time RT-PCR and real-time RT-LAMP according to above-mentioned protocols.
  24 in total

1.  Deadly pig virus slips through US borders.

Authors:  Beth Mole
Journal:  Nature       Date:  2013-07-25       Impact factor: 49.962

2.  Summary of current nomenclature, taxonomy, and classification of various microbial agents. Viral taxonomy.

Authors:  M J Miller
Journal:  Clin Infect Dis       Date:  1993-05       Impact factor: 9.079

3.  Sequence determination of the nucleocapsid protein gene of the porcine epidemic diarrhoea virus confirms that this virus is a coronavirus related to human coronavirus 229E and porcine transmissible gastroenteritis virus.

Authors:  A Bridgen; M Duarte; K Tobler; H Laude; M Ackermann
Journal:  J Gen Virol       Date:  1993-09       Impact factor: 3.891

4.  Coronavirus particle assembly: primary structure requirements of the membrane protein.

Authors:  C A de Haan; L Kuo; P S Masters; H Vennema; P J Rottier
Journal:  J Virol       Date:  1998-08       Impact factor: 5.103

5.  A new coronavirus-like particle associated with diarrhea in swine.

Authors:  M B Pensaert; P de Bouck
Journal:  Arch Virol       Date:  1978       Impact factor: 2.574

6.  Propagation of the virus of porcine epidemic diarrhea in cell culture.

Authors:  M Hofmann; R Wyler
Journal:  J Clin Microbiol       Date:  1988-11       Impact factor: 5.948

7.  Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus.

Authors:  J P Dukes; D P King; S Alexandersen
Journal:  Arch Virol       Date:  2006-02-02       Impact factor: 2.574

8.  Quantitation, biological and physicochemical properties of cell culture-adapted porcine epidemic diarrhea coronavirus (PEDV).

Authors:  M Hofmann; R Wyler
Journal:  Vet Microbiol       Date:  1989-06       Impact factor: 3.293

9.  Molecular epidemiology of porcine epidemic diarrhea virus in China.

Authors:  Jianfei Chen; Chengbao Wang; Hongyan Shi; Huaji Qiu; Shengwang Liu; Xiaojin Chen; Zhibang Zhang; Li Feng
Journal:  Arch Virol       Date:  2010-06-11       Impact factor: 2.574

10.  Coronavirus immunogens.

Authors:  L J Saif
Journal:  Vet Microbiol       Date:  1993-11       Impact factor: 3.293

View more
  18 in total

1.  Multiplex detection of six swine viruses on an integrated centrifugal disk using loop-mediated isothermal amplification.

Authors:  Xiangfen Yuan; Jizhou Lv; Xiangmei Lin; Chunyan Zhang; Junhua Deng; Caixia Wang; Xiaopan Fan; Yonggui Wang; Hui Xu; Shaoqiang Wu
Journal:  J Vet Diagn Invest       Date:  2019-04-04       Impact factor: 1.279

Review 2.  Viral Eco-Genomic Tools: Development and Implementation for Aquatic Biomonitoring.

Authors:  Gomaa Mostafa-Hedeab; Abdou Kamal Allayeh; Hany Abdelfattah Elhady; Abozer Y Eledrdery; Mobarak Abu Mraheil; Ahmed Mostafa
Journal:  Int J Environ Res Public Health       Date:  2022-06-23       Impact factor: 4.614

3.  A portable, 3D printed, microfluidic device for multiplexed, real time, molecular detection of the porcine epidemic diarrhea virus, transmissible gastroenteritis virus, and porcine deltacoronavirus at the point of need.

Authors:  Mohamed El-Tholoth; Huiwen Bai; Michael G Mauk; Linda Saif; Haim H Bau
Journal:  Lab Chip       Date:  2021-02-02       Impact factor: 6.799

4.  A simple and rapid identification method for newly emerged porcine Deltacoronavirus with loop-mediated isothermal amplification.

Authors:  Fanfan Zhang; Yu Ye; Deping Song; Nannan Guo; Qi Peng; Anqi Li; Xingrong Zhou; Yanjun Chen; Min Zhang; Dongyan Huang; Yuxin Tang
Journal:  Biol Res       Date:  2017-09-21       Impact factor: 5.612

5.  Development of pooled testing system for porcine epidemic diarrhoea using real-time fluorescent reverse-transcription loop-mediated isothermal amplification assay.

Authors:  Thi Ngan Mai; Van Diep Nguyen; Wataru Yamazaki; Tamaki Okabayashi; Shuya Mitoma; Kosuke Notsu; Yuta Sakai; Ryoji Yamaguchi; Junzo Norimine; Satoshi Sekiguchi
Journal:  BMC Vet Res       Date:  2018-05-29       Impact factor: 2.741

Review 6.  Advances in Diagnostic Approaches for Viral Etiologies of Diarrhea: From the Lab to the Field.

Authors:  Yashpal Singh Malik; Atul Kumar Verma; Naveen Kumar; Nadia Touil; Kumaragurubaran Karthik; Ruchi Tiwari; Durlav Prasad Bora; Kuldeep Dhama; Souvik Ghosh; Maged Gomaa Hemida; Ahmed S Abdel-Moneim; Krisztián Bányai; Anastasia N Vlasova; Nobumichi Kobayashi; Raj Kumar Singh
Journal:  Front Microbiol       Date:  2019-09-13       Impact factor: 5.640

7.  Development of a real-time loop-mediated isothermal amplification assay for detection of porcine circovirus 3.

Authors:  Huanan Wang; Xiangnan Liu; Fanwen Zeng; Tongyuan Zhang; Yuexiao Lian; Miaoli Wu; Li Xiao; Yujun Zhu; Yu Zhang; Meili Chen; Ren Huang; Manlin Luo; Feng Cong; Pengju Guo
Journal:  BMC Vet Res       Date:  2019-08-23       Impact factor: 2.741

8.  Rapid detection of the common avian leukosis virus subgroups by real-time loop-mediated isothermal amplification.

Authors:  Hao Peng; Lili Qin; Yuyu Bi; Peikun Wang; Guangzhen Zou; Jun Li; Yongli Yang; Xingfu Zhong; Ping Wei
Journal:  Virol J       Date:  2015-11-24       Impact factor: 4.099

9.  Reverse Transcription Cross-Priming Amplification-Nucleic Acid Test Strip for Rapid Detection of Porcine Epidemic Diarrhea Virus.

Authors:  Feng-Xue Wang; Dan-Yi Yuan; Ya-Nan Jin; Lin Hu; Zhi-Yong Sun; Qian He; Shi-Hua Zhao; Shu-Bai Zhan; Yong-Jun Wen
Journal:  Sci Rep       Date:  2016-04-19       Impact factor: 4.379

10.  Development of a real time reverse transcription loop-mediated isothermal amplification method (RT-LAMP) for detection of a novel swine acute diarrhea syndrome coronavirus (SADS-CoV).

Authors:  Huanan Wang; Feng Cong; Fanwen Zeng; Yuexiao Lian; Xiangnan Liu; Manlin Luo; Pengju Guo; Jingyun Ma
Journal:  J Virol Methods       Date:  2018-06-21       Impact factor: 2.014

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.