Literature DB >> 25927230

Characterization of Hydrogen Metabolism in the Multicellular Green Alga Volvox carteri.

Adam J Cornish1, Robin Green1, Katrin Gärtner1, Saundra Mason1, Eric L Hegg1.   

Abstract

Hydrogen gas functions as a key component in the metabolism of a wide variety of microorganisms, often acting as either a fermentative end-product or an energy source. The number of organisms reported to utilize hydrogen continues to grow, contributing to and expanding our knowledge of biological hydrogen processes. Here we demonstrate that Volvox carteri f. nagariensis, a multicellular green alga with differentiated cells, evolves H2 both when supplied with an abiotic electron donor and under physiological conditions. The genome of Volvox carteri contains two genes encoding putative [FeFe]-hydrogenases (HYDA1 and HYDA2), and the transcripts for these genes accumulate under anaerobic conditions. The HYDA1 and HYDA2 gene products were cloned, expressed, and purified, and both are functional [FeFe]-hydrogenases. Additionally, within the genome the HYDA1 and HYDA2 genes cluster with two putative genes which encode hydrogenase maturation proteins. This gene cluster resembles operon-like structures found within bacterial genomes and may provide further insight into evolutionary relationships between bacterial and algal [FeFe]-hydrogenase genes.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25927230      PMCID: PMC4416025          DOI: 10.1371/journal.pone.0125324

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Hydrogen is an essential component in the metabolism of a variety of microorganisms [1,2,3]. In biology, the production of H2 is predominantly catalyzed by two classes of enzymes, hydrogenases and nitrogenases [1,4], with hydrogenases also contributing to H2 uptake [2]. Microbes are able to use these enzymes to catalyze the oxidation of H2 and/or the reduction of protons during fermentation [2,5,6,7]. In addition, recent reports suggest that H2 may also play a role in deacidification, enhancing the cell viability of certain microbes in harsh environments [8,9,10]. The complex role of H2 in the life-cycle of autotrophic microorganisms, such as green algae, is linked to both photosynthetic and fermentative processes [11,12], and studies of H2 metabolism in these microbes establish a basis for future metabolic and evolutionary studies of algal species which are currently uncharacterized in biohydrogen production [12,13,14,15,16]. Green algae both evolve and consume H2 using [FeFe]-hydrogenases (EC#1.12.7.2), metalloproteins capable of catalyzing the reduction of protons as well as the oxidation of H2 [5,6,17,18]. Electrons for H2 production can either be channeled from photosynthetic water-splitting or obtained by the fermentation of carbon sources [6,19]. In a variety of green algae, hydrogenases are encoded by two gene paralogs (HYDA1 and HYDA2) that have high sequence similarity. Although the respective physiological functions of each enzyme are still unclear [20,21], there is evidence suggesting that the HYDA1 gene product may contribute more to H2 production in the light [22]. Maturation proteins are required to assemble the catalytic active site, and the corresponding genes (HydE, HydF, and HydG in bacteria—HYDEF and HYDG in green algae) are ubiquitous in the genomes of organisms which utilize [FeFe]-hydrogenase [23]. Although ancestral forms of these genes in green algae were likely acquired by lateral gene transfer during evolution [24,25,26,27], hydrogenase gene clustering has not been noted in sequenced green algal genomes. Despite this lack of clustering, hydrogenase and maturation factor gene expression is tightly co-regulated. In addition, [FeFe]-hydrogenases are irreversibly-inactivated by the presence of O2, and expression of the HYD genes is induced under anaerobiosis [5,14]. The O2-sensitivity of [FeFe]-hydrogenases renders H2 synthesis dependent on micro-aerobic conditions and thus limits production during light-driven oxygenic photosynthesis [15,28,29]. In Chlamydomonas reinhardtii, a model unicellular green alga, this inhibition may be overcome by sulfur deprivation, which limits O2 production by photosystem II while still allowing electrons gained from photosystem I to be coupled to H2 production via chloroplastidic ferredoxins [13]. In addition, anaerobic conditions are quickly established in the dark as respiration depletes O2, thereby allowing carbon stores generated during photosynthesis to be utilized for H2 production [15,30]. Both of these methods allow for channeling of electrons to H2 synthesis. Volvox carteri is a multicellular green alga that is separated from C. reinhardtii by approximately 220 million years of evolution [31]. V. carteri is composed of two cell types, gonidia and somatic, which are embedded within an extracellular matrix [32,33]. Consistent with the high degree of sequence similarity between the genomes of V. carteri and C. reinhardtii [31], these two organisms appear to share a number of similar metabolic processes [34]. V. carteri has been studied for >40 years [35] and H2 production has previously been observed from a Volvox species [36]. Recently, two putative [FeFe]-hydrogenase genes were annotated in the genome of V. carteri [31], which may provide the organism with H2 metabolism similar to that of C. reinhardtii. In this manuscript, we provide the first report of both in vitro and in vivo H2 production in the multicellular green alga, V. carteri f. nagariensis and demonstrate that functional [FeFe]-hydrogenases are encoded by the annotated HYDA genes. Genes coding for the functional hydrogenases and associated maturation factors are arranged in a unique operon-like gene cluster within the V. carteri genome, providing additional evidence for an evolutionary relationship between bacterial and green algal [FeFe]-hydrogenases. Together, these data support a role for H2 in the metabolism of V. carteri and provide a basis for further investigation of the ancestral acquisition of [FeFe]-hydrogenase genes in green algae.

Experimental

Growth Conditions

Unless otherwise noted, V. carteri f. nagariensis EVE [31] cells were grown autotrophically under continuous light (90 μE m-2 s-1) and shaking (100 rpm) without bubbling. All cultures were incubated at 22°C in standard Volvox medium (SVM), a minimal medium modified from Kirk et al. [37] and Yamano et al. [38] and primarily composed of metal salts [0.5 mM Ca(NO3)2 4H2O, 0.16 mM MgSO4 7H2O, 0.16 mM sodium glycerophosphate pentahydrate, 0.67 mM KCl, 3.8 mM glycylglycine, 99.6 nM vitamin B12 (dissolved in 50 mM HEPES (pH 7.8)), 1.02 μM biotin (dissolved in 50 mM HEPES (pH 7.8)), and 6 mL of P-IV Metal Solution (2 mM Na2EDTA 2H2O, 0.36 mM FeCl3 6H2O, 0.21 mM MnCl2 4H2O, 0.037 mM ZnCl2, 0.0084 mM CoCl2 6H2O, 0.018 mM Na2MoO4 H2O) per liter of media]. For physiological H2 production assays, V. carteri cultures were incubated with 20 mM sodium bicarbonate for 72 hours prior to anaerobic acclimation to increase CO2 levels for improved carbon fixation.

Anaerobic Acclimation

To acclimate V. carteri cells to anaerobiosis, a culture of light-adapted cells was centrifuged at 1,000× g for 5 min. The resulting cell pellet was washed three times in an anaerobic chamber (Coy Laboratory Products) with anaerobic media (degassed SVM supplemented with 0.16 mM MgCl2 rather than 0.16 mM MgSO4 to exclude sulfate from the medium). Cell shading is often sufficient to significantly reduce oxygenic photosynthesis in thick cultures of unicellular green alga. However, due to non-homogenous mixing of V. carteri cultures and the low densities of individual cells within spheroids, the vials were wrapped in aluminum foil to establish dark conditions. To prevent the possibility of residual oxygenic photosynthetic activity from stray light, sulfate-depleted medium was also employed to decrease photosystem II activity, a strategy successfully utilized previously in experiments with C. reinhardtii [39,40,41]. The cells were resuspended in degassed media to a final concentration of 75 μg chlorophyll/mL, and 2 mL of this mixture were sealed in a 10 mL air-tight serum vial (Wheaton). The resuspension was shaken for 4 h before further experimentation.

Hydrogen Production Measurements

H2 evolution using an artificial electron donor was measured by incubating 0.1 mL of either aerobically- or anaerobically-acclimated cells (75 μg chlorophyll/mL) with 1.9 mL of H2 evolution assay solution [degassed media, 100 mM sodium dithionite, 10 mM methyl viologen dichloride (MV)] in a sealed 10 mL serum vial at 22°C in the dark with continuous shaking. At various time points, 20 μL of headspace gas were injected into a TRACE GC Ultra Gas Chromatograph (Thermo Scientific) using a 100 μL syringe. The peak at 1.4 min corresponded to H2, and the absolute value of H2 gas was determined by comparison to a standard curve. The resulting values were plotted versus time to monitor the accumulation of H2 in the headspace, and the rates were determined per μg of chlorophyll. Selected previous reports on H2 production in algae have utilized detergents to rupture cells and allow the hydrogenase proteins access to the abiotic electron donors. Initial experiments demonstrated no significant difference upon addition of detergent (data not shown), suggesting that detergent is not essential under our assay conditions.

Cell Separation

All steps for the cell separation were performed anaerobically using a protocol adapted from Nematollahi et al. [42]. Briefly, an anaerobically-acclimated 1 L culture was centrifuged at 1,800× g in air-tight 250 mL centrifuge bottles (Nalgene) for 10 min. The supernatant was discarded and the pellet was resuspended in 30 mL of anaerobic media. The suspension was passed through a 100 μm filter (Genesee Scientific) and the flow-through discarded. The cells were washed off of the filter in 10 mL of anaerobic media and the cells were liberated from the extracellular matrix using a 50 mL glass Dounce homogenizer (Sigma-Aldrich), moving the pestle up and down 10 times. An additional 20 mL of anaerobic media was added to the suspension and the gonidia were allowed to settle for 10 min. The top 20 mL of the suspension enriched in somatic cells was passed successively through 30 μm and 10 μm meshes (Genesee Scientific and Membrane Solutions, respectively). Following passage through the 10 μm mesh, the flow-through contained pure somatic cells as determined by microscopy. The settled cells enriched in gonidia were resuspended in 10 mL of anaerobic media and passed through a 100 μm mesh. The flow-through was then passed through a 30 μm mesh, collecting the cells on the filter. The purified gonidia were washed off of the filter and resuspended in 2 mL of anaerobic media. The homogeneity of the gonidia samples was confirmed by microscopy.

RNA Isolation

To isolate total RNA from V. carteri, cell cultures were centrifuged at 10,000× g for 10 min. The resulting pellets were resuspended in 0.5 mL of TRIzol (Invitrogen) and frozen in liquid nitrogen. The frozen TRIzol/cell mass mixture was crushed using a mortar and pestle, thawed, and resuspended with an additional 0.5 mL of TRIzol. To this suspension, 0.2 mL of chloroform was added, and the mixture was vortexed at top speed at room temperature for 15 min. To pellet cell debris, the suspension was centrifuged at 10,000× g for 15 min at 10°C. The aqueous phase was transferred to a 1.7 mL tube (Denville) containing 0.25 mL of 0.8 M sodium citrate and 1.0 M sodium chloride, and the suspension was gently mixed by inversion. Following the addition of 0.25 mL of isopropanol, the mixture was centrifuged at 10,000× g for 25 min at 10°C. The supernatant was discarded and the RNA pellet washed twice with ice-cold 75% ethanol. The pellet was allowed to dry and was then resuspended in 20 μL of diethylpyrocarbonate-treated water.

RT-PCR

Reverse transcription of mRNA was performed using M-MLV Reverse Transcriptase (Invitrogen), and the cDNA was amplified for 30 cycles via PCR using GoTaq Green Master Mix (Promega) and the primer sets listed in Table 1. Genomic and cDNA sequences of HYDA1, HYDA2, HYDEF, and HYDG can be accessed from the DDBJ/EMBL/GenBank database with the accession numbers XM_002948441, XM_002948437, XM_002948568, and XM_002948439, respectively.
Table 1

List of primers used for cloning and cDNA amplification.

Restriction digest sites are italicized and 6xHis-tag sequences are underlined. Genomic sequences amplified by the cloning primers are in bold.

Cloning Sequence
HYDA1 SenseGCGCGC CCATGG CG CAT CAC CAT CAC CAT CAC GGTGGCGGA ATGGACGAGCTAGACAAGCC
HYDA1 AntisenseGCGCGC AAGCTT TCTACTCGGCCTCGACACCA
HYDA2 SenseGCGCGC CCATGG GA CAT CAC CAT CAC CAT CAC GGAGGCGGT AAGTGCACTTCGGCTGTCC
HYDA2 AntisenseGCGCGC AAGCTT ACTCGGTATCGACGCCC
RT-PCR Sequence
HYDA1 SenseATGGACGAGCTAGACAAGCC
HYDA1 AntisenseTCTACTCGGCCTCGACACCA
HYDA2 SenseTAAGTGCACTTCGGCTGTCC
HYDA2 AntisenseTTACTCGGTATCGACGCC
ACTA SenseATGGCTGAGGAGGGCGAGGT
ACTA AntisenseTTAGAAGCACTTCCGGTGCA

List of primers used for cloning and cDNA amplification.

Restriction digest sites are italicized and 6xHis-tag sequences are underlined. Genomic sequences amplified by the cloning primers are in bold.

Cloning of HYDA1 and HYDA2

The HYDA1 and HYDA2 genes were PCR amplified with PfuTurbo DNA polymerase (Stratagene) from reverse-transcribed cDNA using the primers listed in Table 1. The amplified products were ligated into the SacI/HindIII site of pAC-BAD, a pBAD/D-TOPO (Invitrogen) expression vector (contains a kanamycin-resistant cassette and an l-arabinose inducible promoter) that was modified to remove the N-terminal thioredoxin-tag [43]. To achieve optimal yields of active protein (using a heterologous expression system previously described [43,44]), the constructs were transformed into S. oneidensis MR-1 ΔhydA/ΔhyaB [45] electrocompetent cells as detailed by Ozawa [46] and selected for antibiotic resistance on 50 μg/mL kanamycin sulfate LB plates.

Overexpression, Protein Purification, and Hydrogen Evolution Assay

Cells harboring the pAC-BAD_HYDA1 and pAC-BAD_HYDA2 vectors were induced for gene overexpression and protein synthesis as previously described [43]. Enzymes were purified from S. oneidensis cultures in an anaerobic chamber and assayed for H2 evolution activity as described by Cornish et al. [43].

Results

In vivo and in vitro H2 Evolution

V. carteri is closely related to C. reinhardtii, a green alga with well-described hydrogen metabolism [28,29]. Recent sequencing and annotation of the V. carteri genome [31] uncovered two genes with sequence similarity to algal [FeFe]-hydrogenase genes (HYDA1, HYDA2) (Fig 1) as well as two genes predicted to be necessary for [FeFe]-hydrogenase maturation (HYDEF, HYDG).
Fig 1

Partial multiple sequence alignment of V. carteri and C. reinhardtii HYDA amino acid sequences.

Black boxes denote strictly conserved residues, while regions with high conservation are boxed and are in boldface. The HYDA1 proteins from V. carteri and C. reinhardtii share 74.1% sequence identity, while the HYDA2 proteins share 75.1% sequence identity. Accession numbers for C. reinhardtii HYDA1 and HYDA2 are XP_001693376 and XP_001694503, respectively.

Partial multiple sequence alignment of V. carteri and C. reinhardtii HYDA amino acid sequences.

Black boxes denote strictly conserved residues, while regions with high conservation are boxed and are in boldface. The HYDA1 proteins from V. carteri and C. reinhardtii share 74.1% sequence identity, while the HYDA2 proteins share 75.1% sequence identity. Accession numbers for C. reinhardtii HYDA1 and HYDA2 are XP_001693376 and XP_001694503, respectively. To assess V. carteri for in vivo and in vitro H2 production, a culture of cells was acclimated to anaerobiosis for 4 h in degassed media. Aliquots of anaerobically-acclimated cells were transferred to anaerobic assay vials either containing 2 mL of anaerobic media alone or supplemented with an abiotic electron donor (Na2S2O4) and an electron mediator (MV), and the headspace was tested for H2 accumulation over time (Fig 2A). H2 production could be measured within the first 45 min of incubation with MV/Na2S2O4, eventually achieving an overall integrated production rate of 30.8 nmol H2/mg chlorophyll/s after 3 h. Cells that were not supplemented with MV/Na2S2O4 did not accumulate a significant amount of H2 in the headspace even 48 h after initiating the assay. When oxygen-exposed cells (i.e. aerobic cells) were assayed under similar conditions, no appreciable H2 accumulation was observed over the course of the assay (Fig 2A). These data indicate that, under these conditions, V. carteri requires both anaerobic acclimation and sufficient reducing equivalents to evolve H2.
Fig 2

H2 evolution of V. carteri cells.

Following a four hour acclimation period, cells were incubated in anaerobic media and H production was measured over a three hour period. The final values were normalized on a per mg chlorophyll basis. A) Whole cell cultures were acclimated to aerobiosis or anaerobiosis and were then supplied either with or without an abiotic electron donor system (Supplemented and Unsupplemented, respectively) during H measurement. Error bars denote standard deviation (n ≥ 3). B) Whole cell cultures and isolated cells (somatic and gonidia) were tested for H evolution activity when provided with an abiotic electron donor system (n ≥ 3).

H2 evolution of V. carteri cells.

Following a four hour acclimation period, cells were incubated in anaerobic media and H production was measured over a three hour period. The final values were normalized on a per mg chlorophyll basis. A) Whole cell cultures were acclimated to aerobiosis or anaerobiosis and were then supplied either with or without an abiotic electron donor system (Supplemented and Unsupplemented, respectively) during H measurement. Error bars denote standard deviation (n ≥ 3). B) Whole cell cultures and isolated cells (somatic and gonidia) were tested for H evolution activity when provided with an abiotic electron donor system (n ≥ 3). In nature, green algae are able to ferment endogenous carbon stores to drive in vivo H2 production. However, initially we did not observe appreciable H2 accumulation in V. carteri cells that were anaerobically-acclimated in the absence of Na2SO4/MV and assayed for H2 production. We hypothesized that, under our original growth conditions, fixed carbon levels might be too low to support fermentative H2 production. To allow for sufficient carbon fixation to occur, cultures of V. carteri were supplemented with 20 mM sodium bicarbonate and incubated for 72 hours in the light. The cells were then acclimated to anaerobiosis for four hours and tested for H2 formation using unsupplemented SVM as previously described. During the course of the assay, the cells produced appreciable amounts of H2 under anaerobic, dark conditions (Fig 3). These results demonstrate that the green alga V. carteri is competent for H2 production under physiological conditions.
Fig 3

H2 production of V. carteri cells grown with sodium bicarbonate.

V. carteri cultures were incubated with 20 mM sodium bicarbonate-supplemented anaerobic media for 72 hours in the light, then acclimated to anaerbiosis for 4 hours, and assayed for H production under dark anaerobic conditions for 40 hours. H values were normalized to chlorophyll content. (n≥2). The negative control represents unsupplemented cells incubated in anaerobic media which were treated similarly to the cells supplemented with sodium bicarbonate.

H2 production of V. carteri cells grown with sodium bicarbonate.

V. carteri cultures were incubated with 20 mM sodium bicarbonate-supplemented anaerobic media for 72 hours in the light, then acclimated to anaerbiosis for 4 hours, and assayed for H production under dark anaerobic conditions for 40 hours. H values were normalized to chlorophyll content. (n≥2). The negative control represents unsupplemented cells incubated in anaerobic media which were treated similarly to the cells supplemented with sodium bicarbonate.

Gonidia and Somatic Cell H2 Production

Previous work revealed distinct metabolic differences between the two cell types of V. carteri [42,47]. To investigate the potential different roles in H2 production between the cell types, gonidia and somatic cells were isolated from an anaerobically-acclimated V. carteri culture and assayed for H2 accumulation over a three hour incubation period using the MV/Na2S2O4 electron donor system. H2 evolution rates were roughly similar for the two cell types (Fig 2B) nd were ~30% of the rate observed from whole cell extracts on a per chlorophyll basis. The observed difference in the rates may be due to cellular and plastidic damage from the separation procedure. Overall, no major differences in H2 evolution rates were observed between the two cell types when supplied with an abiotic electron donor.

HYDA Transcript Analysis

We predicted that the putative HYDA genes in V. carteri play a role in H2 production. To test for HYDA expression during anaerobiosis, RNA was collected from both aerobically- and anaerobically-acclimated cells. The RNA was reverse-transcribed and PCR amplified with primers specific to the putative [FeFe]-hydrogenase genes, HYDA1 and HYDA2. Amplification of mRNA for both genes was observed in anaerobic samples, while very little or no transcript could be observed in the aerobic samples when compared to a housekeeping gene, ACTA (accession number XP_002955536) (Fig 4). These results are consistent with the notion that anaerobic expression of HYDA1 and HYDA2 correlates with the H2 production observed in V. carteri.
Fig 4

Analysis of HYDA1 and HYDA2 genes and gene products.

Gene transcript accumulation observed by RT-PCR on a 0.8% agarose TAE gel. Lane 1: HYDA1 gene amplified from anaerobically-grown V. carteri. Lane 2: HYDA1 gene amplified from aerobically-grown V. carteri. Lane 3: HYDA2 gene amplified from anaerobically-grown V. carteri. Lane 4: HYDA2 gene amplified from aerobically-grown V. carteri. Lane 5: ACTA gene amplified from anaerobically-grown V. carteri. Lane 6: ACTA gene amplified from aerobically-grown V. carteri. The ACTA gene is constitutively expressed under both aerobic and anaerobic conditions and has an amplicon of ~1.1 kb. Molecular weight marker sizes are in kilobases.

Analysis of HYDA1 and HYDA2 genes and gene products.

Gene transcript accumulation observed by RT-PCR on a 0.8% agarose TAE gel. Lane 1: HYDA1 gene amplified from anaerobically-grown V. carteri. Lane 2: HYDA1 gene amplified from aerobically-grown V. carteri. Lane 3: HYDA2 gene amplified from anaerobically-grown V. carteri. Lane 4: HYDA2 gene amplified from aerobically-grown V. carteri. Lane 5: ACTA gene amplified from anaerobically-grown V. carteri. Lane 6: ACTA gene amplified from aerobically-grown V. carteri. The ACTA gene is constitutively expressed under both aerobic and anaerobic conditions and has an amplicon of ~1.1 kb. Molecular weight marker sizes are in kilobases.

Hydrogenase Cloning and Characterization

The two putative HYDA genes have high sequence similarity to known green algal hydrogenase genes (Fig 1), suggesting that they code for active H2-producing enzymes. To test this hypothesis, the two genes were amplified from cDNA, cloned into pAC-BAD, and transformed into S. oneidensis ΔhydAΔhyaB cells. Gene expression was induced by the addition of l-arabinose. The N-terminally His-tagged proteins were purified under strict anaerobiosis by nickel-affinity chromatography and the proteins were analyzed by SDS-PAGE. The HYDA1 and HYDA2 proteins were active when supplied with MV/Na2S2O4, and both had similar K m values when measured for MV (2.76 mM and 2.82 mM, respectively). The apparent specific activity for HYDA1 was almost 70-fold greater than for HYDA2 (1,790 nmol H2/mg/s and 26.7 nmol H2/mg/s, respectively). This differs from previously reported values for recombinant C. reinhardtii HYDA1 and HYDA2 specific activities, (2,500 nmol H2/mg/s and 1,900 nmol H2/mg/s, respectively) [48], but is slightly more consistent with the greater than 3.5-fold difference in activity for CpI and CpII of Clostridium pasteurianum (2,060 nmol H2/mg/s and 7,310 nmol/H2/mg/s, respectively) reported by Adams et al. [49].

Gene Cluster Analysis

The two hydrogenase genes and the two assembly factor genes in the V. carteri genome (HYDA1, HYDA2, HYDEF, and HYDG) were found to be in relatively close proximity to one another. The distance between the furthest genes (HYDA1 and HYDA2) is ~57 kb, and the main cluster of genes is within a ~23 kb span (Fig 5). Although green algae are theorized to have obtained their hydrogenase genes via horizontal gene transfer [24,25,26,27]—likely from an operon or operon-like structure—this level of [FeFe]-hydrogenase gene clustering has not been previously observed in the sequenced genomes of other H2-evolving green algae (C. reinhardtii and Chlorella variabilis).
Fig 5

[FeFe]-hydrogenase operon-like gene cluster in V. carteri.

Four genes with sequence similarity to HYDA1, HYDA2, HYDEF, and HYDG are arranged within 60 kb of one another. The gene orientation corresponds to the orientation of each shape. Three additional putative genes are within this region: ACKA (XP_002948613), a phosphate acetyltransferase (XP_002948484), and a predicted gene, Q85 (XP_002948486). These three predicted gene products are not hypothesized to catalyze H production or assist in the assembly of the [FeFe]-hydrogenase active site, and these genes are not found within investigated bacterial [FeFe]-hydrogenase gene clusters.

[FeFe]-hydrogenase operon-like gene cluster in V. carteri.

Four genes with sequence similarity to HYDA1, HYDA2, HYDEF, and HYDG are arranged within 60 kb of one another. The gene orientation corresponds to the orientation of each shape. Three additional putative genes are within this region: ACKA (XP_002948613), a phosphate acetyltransferase (XP_002948484), and a predicted gene, Q85 (XP_002948486). These three predicted gene products are not hypothesized to catalyze H production or assist in the assembly of the [FeFe]-hydrogenase active site, and these genes are not found within investigated bacterial [FeFe]-hydrogenase gene clusters. Previously, phylogenetic analyses by Meuser et al. and D’Adamo et al. identified a clade of green algal [FeFe]-hydrogenase genes nested within several bacterial clades [24,25]. Based on these analyses, this clade of hydrogenase genes demonstrated a clear relationship to bacterial genes, strongly indicating an ancestral horizontal gene transfer event. The presence of the hydrogenase gene cluster in V. carteri could be a remnant of horizontal gene transfer. However, no clustering of [FeFe]-hydrogenase-related genes is observed in the bacterial genomes noted in the clades adjacent to the green algal clade, as observed in the Meuser phylogram [25]. Expanding the search into thermophilic anaerobes, we identified several bacterial genomes which contain gene clusters composed of hydrogenase and hydrogenase maturation genes. In particular, the genomes of Fervidobacterium nodosum, Fervidobacterium pennivorans, and Thermotoga thermarum contain operon-like clusters composed of five hydrogenase genes that cover a <22 kb span (Fig 6, Table 2). It is worth nothing that these clusters demonstrate roughly similar patterns in gene distribution and orientation to each other and the V. carteri gene cluster.
Fig 6

[FeFe]-hydrogenase gene clusters observed in V. carteri, F. nodosum, F. pennivorans, and T. thermarum.

Clusters are all on the same scale, and the putative HYD genes are denoted by color (HYDA sequences, orange and pink; HYDE, green; HYDF, blue; HYDG, purple; HYDEF fusion gene, green-to-blue). The gene orientation corresponds to the orientation of each shape. The coding sequence of the F. nodosum and T. thermarum clusters has been reversed (reading 3’ to 5’) to more closely match the orientation of the V. carteri cluster.

Table 2

Organization and orientation of HYD genes in V. carteri, F. nodosum, F. pennivorans, and T. thermarum.

Position within Genome
Organism HYDA1 HYDA2 HYDE HYDF HYDG HYDEF
Volvox carteri 1,518,602–1,522,252 [+]1,464,508–1,469,778 [+]nana1,508,779–1,513,243 [+]1,498,998–1,508,353 [–]
Fervidobacterium nodosum 244,394–246,154 [+]231,241–233,444 [–]248,475–249,524 [+]252,473–253,684[+]246,822–248,231 [+]na
Fervidobacterium pennivorans 306,807–308,558 [–]308,976–310,742 [–]303,777–304,829 [–]299,644–300,861 [–]305,108–306,517 [–]na
Thermotoga thermarum 90,890–92,872 [–]86,027–87,778 [+]100,467–101,504 [+]101,523–102,773 [+]98,848–100,251 [+]na

[FeFe]-hydrogenase gene clusters observed in V. carteri, F. nodosum, F. pennivorans, and T. thermarum.

Clusters are all on the same scale, and the putative HYD genes are denoted by color (HYDA sequences, orange and pink; HYDE, green; HYDF, blue; HYDG, purple; HYDEF fusion gene, green-to-blue). The gene orientation corresponds to the orientation of each shape. The coding sequence of the F. nodosum and T. thermarum clusters has been reversed (reading 3’ to 5’) to more closely match the orientation of the V. carteri cluster.

Discussion

A variety of green algae have been characterized for their ability to couple energy derived from photosynthesis to the production of H2, especially the model organism C. reinhardtii [15,30,50]. Previous work has demonstrated that a species of Volvox is capable of H2 production [36] to a similar extent as C. reinhardtii, an alga separated V. carteri by ~220 million years of evolution. The recently sequenced V. carteri genome identified two putative [FeFe]-hydrogenase genes [31], prompting us to investigate further the H2 metabolism of this organism. To test the H2 metabolism of V. carteri, algal cell cultures were acclimated to anaerobiosis, while the serum vials were wrapped with aluminum foil, thus eliminating physiological oxygen production and allowing residual oxygen to be removed via respiration. The anaerobic cells were then provided with an electron donor system and H2 accumulation was measured. Under the conditions tested, V. carteri cultures evolved appreciable amounts of H2 when supplied with an exogenous electron source (MV/Na2S2O4) to drive H2 production. Previous work has detailed differences in basic metabolism between somatic and gonidia cells, which may have implications related to anaerobic H2 production [42,47]. To test for differences in H2 metabolism between the two cell types, we separately measured H2 evolution activities of isolated gonidia and somatic cells in the presence of an abiotic electron donor. Although the rates of H2 evolution in each cell type appeared to be similar (Fig 2B), the H2 production rates were normalized based on chlorophyll content. This complicates any direct comparison between gonidia and somatic cells because the amount of photosynthetic machinery does not directly correlate to cell number between the different cell types. Nevertheless, the ability of the isolated cells to generate hydrogen indicates that sufficient hydrogenase machinery is present in both cell types. Initially, V. carteri did not demonstrate physiological H2 production under the conditions tested. Based on the rationale that cellular carbon sequestration was not sufficient to produce significant quantities of H2 during fermentation, algal cultures were supplemented with sodium bicarbonate for 72 hours prior to anaerobic acclimation. In contrast to unsupplemented culture, the sodium-bicarbonate cultures produced demonstrable levels of H2, proving that V. carteri is capable of in vivo H2 metabolism. The measured H2 production reached a maximum of ~3 μmol H2/mg Chl at 10 hours, at which point accumulation ceased in the headspace. This is likely due to exhaustion of the fixed carbon storage and represents the maximum yield of H2 under these experimental fermentative conditions. Under anaerobic conditions, transcript for the hydrogenase homologs HYDA1 and HYDA2 accumulated in V. carteri, and these homologs are likely responsible for the measured in vivo H2 production. In support of this theory, the genes were heterologously-expressed in S. oneidensis MR-1 and the purified proteins demonstrated quantifiable in vitro H2 evolution activity when supplied with an artificial electron donor. The purified proteins have similar K m values to one another, matching previous literature [48], although the specific activities measured for each enzyme were dissimilar. This discrepancy may be due to incomplete maturation of HYDA2 in the S. oneidensis MR-1 expression system or may arise from natural differences in activity, as previously observed by Adams et al. [49]. In addition to similar kinetic values, HYDA1 and HYDA2 also share common structural features with other characterized green algal [FeFe]-hydrogenases. For example, both proteins contain two short sequences not observed in non-algal hydrogenases and also lack the canonical iron-sulfur cluster-containing F-domains [14]. While examining the hydrogenase genes within the V. carteri genome, it was noted that the HYDA1 and HYDA2 genes are within close proximity to genes encoding maturation proteins, HYDEF and HYDG (Fig 5). This level of gene clustering is unique to V. carteri among the three sequenced green algal genomes, although HYDEF and HYDG are proximal to each other in the genomes of both C. reinhardtii and C. variabilis (S1 Fig). Entire gene clusters can be transferred between organisms during DNA transfer events [51,52,53], and these events can also result in gene fusion, reminiscent of the green algal HYDEF fusion [54,55]. [FeFe]-hydrogenase gene clusters, similar to the V. carteri cluster, were also recently reported in the genomes of the photosynthetic heterokonts Nannochloropsis oceanica CCMP1779 [56] and Nannochloropsis gaditana CCMP526 [57]. Thus, the acquisition of [FeFe]-hydrogenase genes in heterokonts and green algae may share an evolutionary history, although the exact origin of the HYD genes is not known [27,58,59]. Together, the presence of these clusters may provide additional tools to investigate the evolutionary history of [FeFe]-hydrogenases. Using the phylogenetic analysis established by Meuser et al. [49] as a starting point, we analyzed the genomes of several bacterial species which contained [FeFe]-hydrogenase genes closely related to the V. carteri genes. Finding that these bacterial genomes did not contain hydrogenase gene clusters, we expanded our search to bacterial genomes not represented in the phylogram by Meuser et al. This search yielded three closely related thermophillic bacterial species (Fervidobacterium nodosum, Fervidobacterium pennivorans, and Thermotoga thermarum) that contained operon-like gene clusters (>22 kb span) within their genomes. It must be noted, however, that distinct differences exist between the V. carteri and bacterial gene clusters, such as the orientation of the genes and the fusion of the HYDE and HYDF genes in V. carteri. It is therefore intriguing that the relative positions of the genes are identical between V. carteri and bacterial clusters, although the bacterial genes, lacking introns, are shorter in length (Table 2 and Fig 6). Despite these differences, the preserved order of the genes between the V. carteri and the bacterial genomes suggests that this clustering may be a remnant of horizontal gene transfer rather than a result of directed gene rearrangements for co-regulation. Examining the operon-like gene clusters between the thermophiles and V. carteri—and assuming direct gene transfer from bacteria to green algae—it is tempting to suggest that both HYDA genes in green algae were obtained during a single horizontal gene transfer event. In contrast, previous evidence from Meuser et al. would instead indicate that the presence of two HYDA genes in V. cateri result from gene duplication, as these genes are reciprocally monophyletic (Meuser et al. 2011). The presence of the gene cluster in V. carteri—with both putatively duplicate hydrogenase genes in close proximity to one another—is puzzling, especially as clustering of these genes is not observed in either C. reinhardtii or C. variabilis. It is interesting to note, however, that genes encoding phosphate acetyltransferase and acetate kinase are in close association with HYDA2 in both the V. carteri and C. reinhardtii genomes, albeit in different orders in the two species (S1 Fig). This clustering of related genes (acetate assimilation proteins are implicated in fermentative H2 production [60]) observed in both species is intriguing, and additional green algal genomes containing hydrogenase genes need to be sequenced to explore the evolutionary history further. In conclusion, herein we provide the first evidence that V. carteri, a complex multicellular eukaryote, is capable of producing H2 under physiological fermentative conditions. We demonstrate that the two [FeFe]-hydrogenase gene products catalyze H2 evolution in vitro, suggesting a role for these two enzymes in V. carteri H2 metabolism. A previously unreported gene cluster within the V. carteri genome encodes these hydrogenases, as well as the essential maturation machinery. This cluster may share a relationship to similar gene clusters found in thermophillic bacteria, providing new avenues in studying the evolutionary origins of [FeFe]-hydrogenases.

Representation of HYD genes in the Volvox carteri, Chlamydomonas reinhardtii, and Chlorella variabilis sequenced genomes.

The gene orientation corresponds to the orientation of each shape. The HYDEF and HYDG genes are within close proximity with one another in all three genomes, while the HYDA1 and HYDA2 genes are only associated with other HYD genes in the V. carteri genome. (PDF) Click here for additional data file.
  60 in total

Review 1.  Classification and phylogeny of hydrogenases.

Authors:  P M Vignais; B Billoud; J Meyer
Journal:  FEMS Microbiol Rev       Date:  2001-08       Impact factor: 16.408

2.  Evolutionary significance of an algal gene encoding an [FeFe]-hydrogenase with F-domain homology and hydrogenase activity in Chlorella variabilis NC64A.

Authors:  Jonathan E Meuser; Eric S Boyd; Gennady Ananyev; Devin Karns; Randor Radakovits; U M Narayana Murthy; Maria L Ghirardi; G Charles Dismukes; John W Peters; Matthew C Posewitz
Journal:  Planta       Date:  2011-06-05       Impact factor: 4.116

Review 3.  Alternative photosynthetic electron transport pathways during anaerobiosis in the green alga Chlamydomonas reinhardtii.

Authors:  Anja Hemschemeier; Thomas Happe
Journal:  Biochim Biophys Acta       Date:  2011-03-01

Review 4.  Pathogenicity islands and the evolution of microbes.

Authors:  J Hacker; J B Kaper
Journal:  Annu Rev Microbiol       Date:  2000       Impact factor: 15.500

5.  Hydrogen metabolism of green algae: discovery and early research - a tribute to Hans Gaffron and his coworkers.

Authors:  Peter H Homann
Journal:  Photosynth Res       Date:  2003       Impact factor: 3.573

6.  Genetic disruption of both Chlamydomonas reinhardtii [FeFe]-hydrogenases: Insight into the role of HYDA2 in H₂ production.

Authors:  Jonathan E Meuser; Sarah D'Adamo; Robert E Jinkerson; Florence Mus; Wenqiang Yang; Maria L Ghirardi; Michael Seibert; Arthur R Grossman; Matthew C Posewitz
Journal:  Biochem Biophys Res Commun       Date:  2011-12-08       Impact factor: 3.575

Review 7.  Photobiological hydrogen-producing systems.

Authors:  Maria Lucia Ghirardi; Alexandra Dubini; Jianping Yu; Pin-Ching Maness
Journal:  Chem Soc Rev       Date:  2008-10-22       Impact factor: 54.564

8.  Functional studies of [FeFe] hydrogenase maturation in an Escherichia coli biosynthetic system.

Authors:  Paul W King; Matthew C Posewitz; Maria L Ghirardi; Michael Seibert
Journal:  J Bacteriol       Date:  2006-03       Impact factor: 3.490

9.  Photoautotrophic hydrogen production by eukaryotic microalgae under aerobic conditions.

Authors:  Jae-Hoon Hwang; Hyun-Chul Kim; Jeong-A Choi; R A I Abou-Shanab; Brian A Dempsey; John M Regan; Jung Rae Kim; Hocheol Song; In-Hyun Nam; Su-Nam Kim; Woojung Lee; Donghee Park; Yongje Kim; Jaeyoung Choi; Min-Kyu Ji; Woosik Jung; Byong-Hun Jeon
Journal:  Nat Commun       Date:  2014       Impact factor: 14.919

10.  Horizontal transfer of the nitrogen fixation gene cluster in the cyanobacterium Microcoleus chthonoplastes.

Authors:  Henk Bolhuis; Ina Severin; Veronique Confurius-Guns; Ute I A Wollenzien; Lucas J Stal
Journal:  ISME J       Date:  2009-09-10       Impact factor: 10.302

View more
  3 in total

1.  Adaptation to life on land at high O2 via transition from ferredoxin-to NADH-dependent redox balance.

Authors:  S B Gould; S G Garg; M Handrich; S Nelson-Sathi; N Gruenheit; A G M Tielens; W F Martin
Journal:  Proc Biol Sci       Date:  2019-08-21       Impact factor: 5.349

2.  Colocality to Cofunctionality: Eukaryotic Gene Neighborhoods as a Resource for Function Discovery.

Authors:  Fatima Foflonker; Crysten E Blaby-Haas
Journal:  Mol Biol Evol       Date:  2021-01-23       Impact factor: 16.240

Review 3.  Fantastic [FeFe]-Hydrogenases and Where to Find Them.

Authors:  Simone Morra
Journal:  Front Microbiol       Date:  2022-03-02       Impact factor: 5.640

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.