Karina Picazarri1, Kumiko Nakada-Tsukui1, Kumiko Tsuboi1, Eri Miyamoto1,2, Naoko Watanabe2, Eiryo Kawakami1,3, Tomoyoshi Nozaki1,4. 1. Department of Parasitology, National Institute of Infectious Diseases, Tokyo, Japan. 2. Department of Biomolecular Science, Faculty of Science, Toho University, Chiba, Japan. 3. Laboratory for Disease Systems Modeling, RIKEN Center for integrative Medical Sciences, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa, Japan. 4. Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Japan.
Abstract
Autophagy is one of two major bulk protein degradation systems and is conserved throughout eukaryotes. The protozoan Entamoeba histolytica, which is a human intestinal parasite, possesses a restricted set of autophagy-related (Atg) proteins compared with other eukaryotes and thus represents a suitable model organism for studying the minimal essential components and ancestral functions of autophagy. E. histolytica possesses two conjugation systems: Atg8 and Atg5/12, although a gene encoding Atg12 is missing in the genome. Atg8 is considered to be the central and authentic marker of autophagosomes, but recent studies have demonstrated that Atg8 is not exclusively involved in autophagy per se, but other fundamental mechanisms of vesicular traffic. To investigate this question in E. histolytica, we studied on Atg8 during the proliferative stage. Atg8 was constitutively expressed in both laboratory-maintained and recently established clinical isolates and appeared to be lipid-modified in logarithmic growth phase, suggesting a role of Atg8 in non-stress and proliferative conditions. These findings are in contrast to those for Entamoeba invadens, in which autophagy is markedly induced during an early phase of differentiation from the trophozoite into the cyst. The repression of Atg8 gene expression in En. histolytica by antisense small RNA-mediated transcriptional gene silencing resulted in growth retardation, delayed endocytosis and reduced acidification of endosomes and phagosomes. Taken together, these results suggest that Atg8 and the Atg8 conjugation pathway have some roles in the biogenesis of endosomes and phagosomes in this primitive eukaryote.
Autophagy is one of two major bulk protein degradation systems and is conserved throughout eukaryotes. The protozoan Entamoeba histolytica, which is a human intestinal parasite, possesses a restricted set of autophagy-related (Atg) proteins compared with other eukaryotes and thus represents a suitable model organism for studying the minimal essential components and ancestral functions of autophagy. E. histolytica possesses two conjugation systems: Atg8 and Atg5/12, although a gene encoding Atg12 is missing in the genome. Atg8 is considered to be the central and authentic marker of autophagosomes, but recent studies have demonstrated that Atg8 is not exclusively involved in autophagy per se, but other fundamental mechanisms of vesicular traffic. To investigate this question in E. histolytica, we studied on Atg8 during the proliferative stage. Atg8 was constitutively expressed in both laboratory-maintained and recently established clinical isolates and appeared to be lipid-modified in logarithmic growth phase, suggesting a role of Atg8 in non-stress and proliferative conditions. These findings are in contrast to those for Entamoeba invadens, in which autophagy is markedly induced during an early phase of differentiation from the trophozoite into the cyst. The repression of Atg8 gene expression in En. histolytica by antisense small RNA-mediated transcriptional gene silencing resulted in growth retardation, delayed endocytosis and reduced acidification of endosomes and phagosomes. Taken together, these results suggest that Atg8 and the Atg8 conjugation pathway have some roles in the biogenesis of endosomes and phagosomes in this primitive eukaryote.
Autophagy is widely conserved in eukaryotes and has many physiological functions, including nutrient scavenging, cell development, tumorigenesis, defence against intracellular pathogens, degradation of ubiquitinated protein aggregates and organelle removal (Takeshige et al., 1992; Tsukada and Ohsumi, 1993; Komatsu and Ichimura, 2010; Mehrpour et al., 2010; Wang and Levine, 2010; Mizushima and Komatsu, 2011; Mizushima et al., 2011; Loos et al., 2013). For this reason, the molecular mechanisms of autophagy are being actively studied in a number of model organisms. In free‐living and parasitic protists, genetic and functional analyses have revealed that majority of autophagy‐related (Atg) proteins are conserved, but some components are occasionally missing or present as multiple copies and may play lineage‐specific roles (Brennand et al., 2011; Duszenko et al., 2011). Atg3, 4, 7 and 8, which are involved in one of the two ubiquitin‐like conjugation systems, are highly conserved in all eukaryotic ‘supergroups’ (Keeling et al., 2005) and, Atg8, in particular, is considered to be a reliable marker for autophagosomes as it is localized to isolation membrane and remains associated with autophagosomes during a course of authophagosome maturation (Kabeya et al., 2000).Starvation‐induced autophagy was demonstrated in a number of protists including Tetrahymena, Trypanosoma cruzi, Trypanosoma brucei, Leishmania major, Toxoplasma gondii, Plasmodium falciparum and Trichomonas vaginalis (Nilsson, 1984; Kaneda et al., 1991; Benchimol, 1999; Alvarez et al., 2008; Williams et al., 2009; Besteiro et al., 2011; Li et al., 2012; Tomlins et al., 2013). It has also been shown that autophagy plays a role in differentiation in L. major, Try. brucei, Try. cruzi, Tox. gondii, Acanthamoeba castellanii and Entamoeba invadens (Besteiro et al., 2006; Alvarez et al., 2008; Picazarri et al., 2008a; Besteiro et al., 2011; Moon et al., 2011; Li et al., 2012) and in organelle removal and maintenance in Tetrahymena thermophila, Try. brucei, Tox. gondii, Pl. falciparum, and Tri. vaginalis (Kaneda et al., 1991; Benchimol, 1999; Herman et al., 2008; Besteiro et al., 2011; Liu and Yao, 2012; Tomlins et al., 2013). In the slime mold Dictyostelium discoideum, it has been shown that autophagy is indispensable for starvation‐induced cell differentiation to the multicellular stage (Otto et al., 2003; Calvo‐Garrido and Escalante, 2010). Unlike the protists described earlier, there are at least three exceptional organisms known to apparently lack the Atg8 conjugation system, Giardia lamblia, Cyanidioschyzon merolae and Encephalitozoon cuniculi from Excavata, Archaeplastida and Opisthokonta respectively (Keeling et al., 2005; Duszenko et al., 2011).Entamoeba histolytica is a unicellular protozoan parasite that causes amoebic colitis, dysentery and liver abscesses and annually infects approximately 50 million inhabitants of endemic areas, resulting in an estimated 40 000–110 000 deaths (WHO, 1997). The membrane‐trafficking system in this organism appears to be as complex as that in higher eukaryotes, based on the extreme diversity of Rab small GTPases present in the genome (104 rab genes; Saito‐Nakano et al., 2005; Nakada‐Tsukui et al., 2010). Thus, En. histolytica poses a primitive eukaryotic model to study diversity and evolution of membrane‐trafficking mechanisms (Dacks and Field, 2007; Field et al., 2011). Recent genome surveys have shown that nearly all of the major Atg proteins required for autophagy in yeast are conserved in En. histolytica, except for Atg 2, 12, 13 and 14 (Nakatogawa et al., 2009; Brennand et al., 2011; Duszenko et al., 2011), suggesting that the Atg8 conjugation system is conserved, but that the Atg5/Atg12 conjugation system may not be functional or highly diverged.In the related reptilian species En. invadens, Atg8‐associated autophagosome‐like vesicles/vacuoles are constitutively (i.e. even under non‐starving conditions) present during the logarithmic growth of trophozoites and during developmental transition from the trophozoite to the dormant cyst stage (Picazarri et al., 2008a). However, exact roles of Atg genes and proteins are not well understood in this primitive eukaryotic lineage. In the present study, we investigated whether the Atg8 conjugation system is specifically involved in autophagy in En. histolytica or if it also plays more general and diverse roles in vesicular trafficking. We demonstrated the roles of Atg8 in En. histolytica by examining a strain in which Atg8 expression was repressed by small antisense RNA‐mediated transcriptional gene silencing.
Results and discussion
Two isotypes of Atg8 are constitutively and ubiquitously expressed and lipid conjugated in En
. histolytica
The En. histolytica genome contains two atg8 genes, Ehatg8a and Ehatg8b, which are 94% identical in their encoded amino acid sequences and located on different positions in the genome (EHI_130660 and EHI_172140). Because flanking sequences including neighbouring genes are totally different, Ehatg8a and Ehatg8b are not allelic variants. The EhAtg8b isotype contains five additional amino acids (MDPTF) that are not found in EhAtg8a in the amino‐terminal region. In addition, these proteins differ by seven other residues: Met6Pro, Glu7Ile, Ser8Asn, Asn49Ser, Glu52Asn, Asp63Gly and Val66Ile (the amino acid in EhAtg8a, the amino acid position and the amino acid in EhAtg8b are shown in this order; amino acid positions correspond to EhAtg8b).Immunoblot analysis of trophozoite lysates using a polyclonal EhAtg8 antibody raised against recombinant EhAtg8a revealed four bands ranging in size from 14 to 15 kDa (Fig. 1A). The two upper and two lower bands were also detected in the 100 000× g soluble protein and pellet fractions and appeared to correspond to the size of the cytosolic and membrane‐associated forms, respectively, of EhAtg8a and EhAtg8b. The calculated molecular masses of the EhAtg8a and EhAtg8b isotypes are 14.2 and 14.7 kDa respectively. These data suggest that the two upper and two lower bands in the lysate correspond to non‐modified cytosolic and phospholipid‐modified membrane‐anchored Atg8 isotypes respectively. The expression of both isotypes of the EhAtg8 gene was confirmed by reverse transcriptase polymerase chain reaction (RT‐PCR) and digestion of the amplified fragments with VspI, which recognizes only the EhAtg8b amplicon (Fig. S2). EhAtg8s does not have transmembrane domain and the carboxyl‐terminal glycine residue known to conjugate to lipids is conserved in EhAtg8s. It is considered that EhAtg8s are also modified with lipids.
Figure 1
Immunoblot analysis and cellular localization of Atg8 in E
ntamoeba histolytica trophozoites.
A. Cellular distribution of Atg8. Trophozoites of the HM‐1 strain were harvested after 2 days of passage, lysed by mechanical homogenization and centrifuged at 100 000× g to separate the supernatant and pellet fractions. The obtained fractions (5 μg) were subjected to immunoblot analysis using anti‐EhAtg8 (top) or anti‐EhNifS (cytosolic control) antibodies. P, pellet; S, supernatant; W, whole lysate. Unmodified (‘EhAtg8’) and lipid‐modified forms (‘EhAtg8‐L’) are indicated.
B. Immunoblot analysis of EhAtg8 during axenic cultivation. Trophozoites were cultured axenically in BI‐S‐33 medium for 1, 2, 3, 4 or 5 days (lanes 1–5, respectively). Approximately 5 μg of the whole cell lysate was separated by SDS‐PAGE, blotted, reacted with anti‐EhAtg8 antibody and developed by chemiluminescence. Arrows indicate unmodified (two top bands) and lipid‐modified (two bottom bands) EhAtg8.
C. Localization of EhAtg8 in En. histolytica trophozoites. Trophozoites in steady state were fixed and stained for EhAtg8. Bar, 10 μm.
D. Localization of EhAtg8 with FITC‐dextran (endosomes) and LysoTracker Red (lysosomes). En. histolytica trophozoites were co‐cultured with 2 mg mL−1 FITC‐dextran for 60 min or LysoTracker Red stain and then fixed. Cells were stained for EhAtg8 using anti‐EhAtg8 polyclonal antibody. Bars, 10 μm.
Immunoblot analysis and cellular localization of Atg8 in E
ntamoeba histolytica trophozoites.A. Cellular distribution of Atg8. Trophozoites of the HM‐1 strain were harvested after 2 days of passage, lysed by mechanical homogenization and centrifuged at 100 000× g to separate the supernatant and pellet fractions. The obtained fractions (5 μg) were subjected to immunoblot analysis using anti‐EhAtg8 (top) or anti‐EhNifS (cytosolic control) antibodies. P, pellet; S, supernatant; W, whole lysate. Unmodified (‘EhAtg8’) and lipid‐modified forms (‘EhAtg8‐L’) are indicated.B. Immunoblot analysis of EhAtg8 during axenic cultivation. Trophozoites were cultured axenically in BI‐S‐33 medium for 1, 2, 3, 4 or 5 days (lanes 1–5, respectively). Approximately 5 μg of the whole cell lysate was separated by SDS‐PAGE, blotted, reacted with anti‐EhAtg8 antibody and developed by chemiluminescence. Arrows indicate unmodified (two top bands) and lipid‐modified (two bottom bands) EhAtg8.C. Localization of EhAtg8 in En. histolytica trophozoites. Trophozoites in steady state were fixed and stained for EhAtg8. Bar, 10 μm.D. Localization of EhAtg8 with FITC‐dextran (endosomes) and LysoTracker Red (lysosomes). En. histolytica trophozoites were co‐cultured with 2 mg mL−1 FITC‐dextran for 60 min or LysoTracker Red stain and then fixed. Cells were stained for EhAtg8 using anti‐EhAtg8 polyclonal antibody. Bars, 10 μm.We next examined if the expression or distribution of EhAtg8 changed during the in vitro culture of trophozoites by performing immunoblot analysis with anti‐EhAtg8 antibody and strain as a reference. EhAtg8 was constitutively expressed in En. histolytica HM‐1:IMSS cl 6 strain (HM‐1) irrespective of growth phase (Fig. 1B). The 14.2‐ and 14.7‐kDa bands corresponding to membrane‐associated EhAtg8a and b, respectively, were predominantly observed at all examined time points (days 1–5). After 4 days of cultivation, the intensity of the two bands increased by ∼ 60%, as determined by densitometric scanning of immunoblots and comparison with EhNifS protein as a reference (Fig. 1B). Immunofluorescence assay also showed that Atg8 was constitutively expressed at all time points (data not shown) and localized throughout the cytoplasm to vesicular/vacuolar and dot‐like structures (Fig. 1C), which were similar to the Atg8‐associated structures previously observed in En. invadens (Picazarri et al., 2008a). Localization of EhAtg8 to endosomes and lysosomes was also examined, but was hardly observed (Fig. 1D). Together, these data suggest that Atg8 plays a role in En. histolytica in nutrient‐rich, in vitro culture conditions and increases slightly in concentration after 4 days of cultivation.We next verified if Atg8 is also present as two isotypes and lipid‐modified in clinical isolates of En. histolytica. Immunoblot assays showed that all eight clinical isolates showed a similar pattern of Atg8 staining with anti‐EhAtg8 antibody as the HM‐1 reference strain (Fig. S3), suggesting that EhAtg8 is also constitutively expressed and lipidated in proliferating trophozoites of all clinical isolates tested.
Multiplication of Atg8 isotypes in E
ntamoeba and other organisms
Atg8 family proteins have two domains, an amino‐terminal helical domain (NHD) and a carboxyl‐terminal ubiquitin‐like domain (ULD) (Paz et al., 2000; Coyle et al., 2002; Sugawara et al., 2004; Nakatogawa et al., 2007). The NHD consists of two alpha helices, which are located at amino acid 1–24 in yeastAtg8. The amino‐terminal region containing the five amino acid extensions and three amino acid substitutions unique to EhAtg8b are located within the NHD, while four amino acid substitutions are found within the ULD. As the NHD may play a role in the membrane fusion activity of Atg8 (Weidberg et al., 2011), the heterogeneity in this domain between the two EhAtg8 isotypes may affect the fusion activity and localization of Atg8 to membranes. Other Entamoeba species, including Entamoeba dispar and Entamoeba moshkovskii, also have two Atg8 genes (Fig. S1A). In En. invadens and Entamoeba nuttalli, we identified a protein related to Atg8a, but failed to detect a homolog of Atg8b. Among the four amino acid substitutions in the ULD of EhAtg8b, the Asp58Gly substitution is of particular interest because Asp58 is highly conserved among all Atg8 homologues in Entamoeba and a wide range of other organisms, including yeast, humanGABARAP, D. discoideum, Tet. thermophila and Try. brucei, suggesting that EhAtg8b may have a unique function (Fig. S1B). However, it remains unknown whether the amino acid differences between the two EhAtg8 isotypes influence membrane fusion activity.Among protists that have the Atg8 conjugation system, evidence for expansion of Atg8 gene paralogs has been found in L. major and Paramecium tetraurelia, but not in related species, for example, Trypanosoma or Tetrahymena. L. major possesses 25 Atg8 genes. It was shown that the subgroup of L. major Atg8 are not involved in macroautophagy but involved in endocytosis and exocytosis (Krishnamurthy et al., 2005; Williams et al., 2009). This illustrates a case of gene multiplication and functional diversification of Atg8 (Furuta et al., 2002; Baisamy et al., 2009; Popovic et al., 2012).
Atg8 is not modulated during starvation
We further examined if expression, lipid modifications and localization of EhAtg8 are induced during starvation. Immunoblotting analysis of lysates from amoebas subjected to glucose deprivation and osmolarity shock using 47% low‐glucose (LG) medium, which is known to induce encystation in En. invadens (Sanchez et al., 1994; Picazarri et al., 2008a), did not detect any marked changes in either the amount or patterns of EhAtg8 expression (data not shown). These results indicate that these environmental changes do not alter expression, modifications and localization of EhAtg8. In En. invadens, lipid‐modified Atg8 proteins have a role in encystation (Picazarri et al., 2008a). Because laboratory En. histolytica strains do not encyst in vitro in general, we could not directly test if EhAtg8 is also involved in the encystation. Thus, we cannot conclude that the lipid‐anchored membrane‐associated form of Atg8 plays an analogous role in En. invadens and En. histolytica.
Repression of A
tg8 gene expression impairs growth
To better understand the role of Atg8 in En. histolytica, we created a transformant line (Atg8gs) in which EhAtg8 expression was repressed by gene silencing (Bracha et al., 2006; Mi‐ichi et al., 2011; Nakada‐Tsukui et al., 2012). Immunoblot analysis confirmed > 95% repression of EhAtg8 expression in the Atg8gs transformant compared with the parental G3 strain transformed with an empty vector (Fig. 2A). Indirect immunofluorescence analysis of the Atg8gs line confirmed that the formation of Atg8‐associated structure was abolished (Fig. 2B). These data indicate that expression of both Ehatg8a and b genes was repressed by gene silencing.
Figure 2
Phenotypes caused by repression of Atg8 expression in the EhAtg8‐gene silenced strain.
A. Immunoblot analysis of Atg8. Trophozoites of the EhAtg8‐gene silenced transformant (Atg8gs) and a control transformant containing empty vector (pSAP2) were harvested after reaching semi‐confluency. Approximately 10 μg of whole lysate was separated by SDS‐PAGE, blotted onto nitrocellulose membrane and reacted with anti‐EhAtg8 or anti‐EhNifS antibody. The reacted bands were developed with chemiluminescence.
B. Immunofluorescence images of EhAtg8‐associated structures in the parental strain (G3) and pSAP2 and Atg8gs transformants. Representative images with maximal projection are shown.
C. Growth kinetics of pSAP2 and Atg8gs transformants in axenic culture. Axenic cultures were initiated at 2.3 × 103 trophozoites per ml and the cell density was measured at the indicated time points in triplicate. Bars indicate standard deviations. The data shown are a representative result of three independent experiments. Asterisks indicate P ≤ 0.001.
Phenotypes caused by repression of Atg8 expression in the EhAtg8‐gene silenced strain.A. Immunoblot analysis of Atg8. Trophozoites of the EhAtg8‐gene silenced transformant (Atg8gs) and a control transformant containing empty vector (pSAP2) were harvested after reaching semi‐confluency. Approximately 10 μg of whole lysate was separated by SDS‐PAGE, blotted onto nitrocellulose membrane and reacted with anti‐EhAtg8 or anti‐EhNifS antibody. The reacted bands were developed with chemiluminescence.B. Immunofluorescence images of EhAtg8‐associated structures in the parental strain (G3) and pSAP2 and Atg8gs transformants. Representative images with maximal projection are shown.C. Growth kinetics of pSAP2 and Atg8gs transformants in axenic culture. Axenic cultures were initiated at 2.3 × 103 trophozoites per ml and the cell density was measured at the indicated time points in triplicate. Bars indicate standard deviations. The data shown are a representative result of three independent experiments. Asterisks indicate P ≤ 0.001.To examine if Atg8 plays a role in proliferation, as was previously suggested for En. invadens (Picazarri et al., 2008a), the growth kinetics of the Atg8gs and control transformants were compared in axenic BI‐S‐33 medium (Fig. 2C). The growth of the Atg8gs transformant showed a significant reduction of 43–47% after 144 h of culture when compared with the control transformant (P ≤ 0.001). To test if the growth retardation was due to nutrient starvation, the culture medium was replaced daily to provide an excess amount of nutrients, including free lipids, amino acids and nucleic acids. However, the medium replenishment did not rescue the growth retardation of the Atg8gs transformant (data not shown). Together, these data suggest that Atg8 may be involved in a fundamental cellular process(es), such as the incorporation, scavenging and intracellular trafficking of nutrients.
Atg8 gene silencing inhibits incorporation of a fluid‐phase marker and acidification of endosomes and phagosomes
To test the possibility that growth retardation caused by Ehatg8 gene silencing was due to defect in nutrient uptake and/or degradation, the endocytic rate of the fluid‐phase marker fluorescein isothiocyanate (FITC)‐dextran and acidification of the compartment containing FITC‐dextran was measured. The EhAtg8gs strain showed reduced endocytosis of FITC‐dextran (Fig. 3A). After 2 and 3 h of cocultivation with FITC‐dextran, EhAtg8gs showed approximately 20% and 15% decreases, respectively, in the amount of incorporated FITC when compared with the pSAP2 control strain (P ≤ 0.001, Fig. 3A). The percentage of FITC‐dextran incorporated in the acidified compartments, that is, late endosomes and lysosomes, was also estimated based on the spectral changes of FITC in response to low pH (Meza and Clarke, 2004; Mitra et al., 2005; 2006). After 30 to 120 min of endocytosis, the percentage of acidified endosomes containing incorporated FITC‐dextran was significantly lower (16–31%) in the Atg8gs strain compared with the control (P < 0.05; Fig. 3B). At 180 min of endocytosis, however, the difference in the percentage of acidified endosomes containing incorporated FITC‐dextran between the Atg8gs and control strains decreased (Fig. 3B). This can be explained by two possible reasons: first, there are multiple pathways for lysosome biogenesis, that is biosynthetic and endocytic pathways, as previously suggested (Saftig and Klumperman, 2009) and at the later time point, Atg8‐independent pathway compensated the defect and led to the acidification of endosomes in the Atg8gs strain. Second, in the wild‐type strain, neutralization of some endosomes already occurred at 180 min of endocytosis. These two concurrent events probably masked the defect in the endosome acidification in Atg8gs strain. Altogether, these data suggest that Atg8 plays a role in fluid‐phase endocytosis and the acidification of endosomes.
Figure 3
Atg8 suppression delayed endocytosis and endosome acidification. Trophozoites of the pSAP2 and Atg8gs transformants were incubated with 2 mg ml−1 FITC‐dextran for 15, 30, 60, 120 and 180 min and then harvested. Endocytosis efficiency is shown as the percentage of incorporated FITC‐dextran relative to the fluorescence intensity measured at the neutral pH for the control pSAP2 transformant after 180 min.
A. Total fluorescence signal measured in whole cell lysates (at neutral pH) of pSAP2 and Atg8gs strains. The fluorescence signal of the lysate of the control (pSAP2) cells incubated with FITC‐dextran for 180 min was set as 100%. The average values of three independent experiments are shown. Note that the fluorescence intensity indicates the total amount of incorporated FITC‐dextran.
B. The percentage of acidified endosomes in pSAP2 and Atg8gs transformants. The percentage of acidified endosomes at each time point was calculated using the following equation: percentage of acidified endosomes equals [(fluorescent signal from the whole lysate) minus (fluorescent signal from the cell suspension)] divided by (fluorescent signal from the whole lysate). **P < 0.001; *P < 0.05 by Student's t‐test.
Atg8 suppression delayed endocytosis and endosome acidification. Trophozoites of the pSAP2 and Atg8gs transformants were incubated with 2 mg ml−1 FITC‐dextran for 15, 30, 60, 120 and 180 min and then harvested. Endocytosis efficiency is shown as the percentage of incorporated FITC‐dextran relative to the fluorescence intensity measured at the neutral pH for the control pSAP2 transformant after 180 min.A. Total fluorescence signal measured in whole cell lysates (at neutral pH) of pSAP2 and Atg8gs strains. The fluorescence signal of the lysate of the control (pSAP2) cells incubated with FITC‐dextran for 180 min was set as 100%. The average values of three independent experiments are shown. Note that the fluorescence intensity indicates the total amount of incorporated FITC‐dextran.B. The percentage of acidified endosomes in pSAP2 and Atg8gs transformants. The percentage of acidified endosomes at each time point was calculated using the following equation: percentage of acidified endosomes equals [(fluorescent signal from the whole lysate) minus (fluorescent signal from the cell suspension)] divided by (fluorescent signal from the whole lysate). **P < 0.001; *P < 0.05 by Student's t‐test.We further examined whether EhAtg8 is also involved in the acidification of phagosomes. EhAtg8gs and control strains were co‐incubated with Escherichia coli cells conjugated with pHrodo, which is a fluorogenic dye responsive to acidification, and intracellular fluorescence was analysed. The fluorescent signal attributable to Es. coli cells in acidified compartments was markedly lower in the Atg8gs strain compared with the control at all examined time points and the difference reached the level of significance after 30 and 60 min of co‐cultivation (P < 0.04 and P < 0.02 respectively; Fig. 4A). In contrast, the rate of phagocytosis of tetramethylrhodamine isothiocyanate (TRITC)‐labelled Es. coli and carboxylated beads was only marginally affected in the Atg8gs strain (Fig. 4B and C). The localization of EhAtg8 during phagocytosis was also examined using CellTracker Blue‐loaded Chinese hamster ovary (CHO) cells (Fig. 5). The percentage of EhAtg8 localization to phagosomes was 50, 23 and 9.6% after 10, 30 and 60 min of co‐cultivation with CHO cells respectively. EhAtg8 was often (77%, n = 31) associated with the phagocytic cup at the initiation of ingestion (Fig. 6 and Fig. S5). Together, these data suggest that EhAtg8 is involved in the early phase of phagocytosis and phagosome maturation, more specifically in the acidification of phagosomes.
Figure 4
Atg8 suppression delayed phagosome acidification, but not phagocytosis.
Trophozoites of the pSAP2 and Atg8gs transformants were co‐cultured with pHrodo‐labelled Es. coli (A), TRITC‐labelled Es. coli (B) or Nile Red‐labelled carboxylate‐modified FluoSphere microspheres (C) for the indicated time. The percentage of trophozoites that ingested stained cells and/or microspheres was determined by flow cytometry (FACS) and the percentage of fluorescence phagosomes are shown. **P < 0.02; *P < 0.04 by Student's t‐test.
Figure 5
Localization of Atg8 on the phagosome membrane.
A. Entamoeba histolytica trophozoites of strain HM‐1 were co‐cultured with CellTracker Blue‐loaded CHO cells for the indicated times, fixed and then reacted with anti‐EhAtg8 antibody and Alexa‐568 conjugated anti‐rabbit IgG secondary antibody. Arrows indicate phagosomes with EhAtg8.
B. Percentage of phagosomes associated with EhAtg8. At 10, 30 or 60 min after co‐cultivation, phagosomes were counted (approximately 40, 100 or 180 phagosomes, respectively) and the percentage of phagosomes that were associated with EhAtg8 was calculated. The average values of three independent experiments are shown.
Figure 6
Recruitment of Vps26 and Atg8 to phagosomes and the phagocytic cups. Entamoeba histolytica trophozoites of pSAP2 and Atg8gs transformants were co‐cultured with CellTracker Blue‐loaded CHO cells for the indicated times, fixed and then reacted with anti‐EhAtg8 and anti‐EhVps26 antibodies labelled with Alexa Fluor 488 or Alexa Fluor 546 by ZENON rabbit IgG labelling kit.
A. Localization of Atg8 and Vps26 in En. histolytica pSAP2 control trophozoites. One representative cell was shown (see Fig. S5 for additional cells). White arrow indicates Atg8‐positive, Vps26‐negative, unclosed phagocytic cup and white arrowheads indicate Vps26‐associated, but Atg8‐negative phagosomes.
B. The percentage of phagosomes associated with EhAtg8 (open bars) or Vps26 (filled bars). At 10, 30 or 60 min after co‐cultivation, phagosomes were examined and the percentage of phagosomes that were associated withEhAtg8 and EhVps26 was calculated. Atg8 association was not determined in Atg8gs strains (ND). Averages of three independent experiments are shown.
Atg8 suppression delayed phagosome acidification, but not phagocytosis.Trophozoites of the pSAP2 and Atg8gs transformants were co‐cultured with pHrodo‐labelled Es. coli (A), TRITC‐labelled Es. coli (B) or Nile Red‐labelled carboxylate‐modified FluoSphere microspheres (C) for the indicated time. The percentage of trophozoites that ingested stained cells and/or microspheres was determined by flow cytometry (FACS) and the percentage of fluorescence phagosomes are shown. **P < 0.02; *P < 0.04 by Student's t‐test.Localization of Atg8 on the phagosome membrane.A. Entamoeba histolytica trophozoites of strain HM‐1 were co‐cultured with CellTracker Blue‐loaded CHO cells for the indicated times, fixed and then reacted with anti‐EhAtg8 antibody and Alexa‐568 conjugated anti‐rabbit IgG secondary antibody. Arrows indicate phagosomes with EhAtg8.B. Percentage of phagosomes associated with EhAtg8. At 10, 30 or 60 min after co‐cultivation, phagosomes were counted (approximately 40, 100 or 180 phagosomes, respectively) and the percentage of phagosomes that were associated with EhAtg8 was calculated. The average values of three independent experiments are shown.Recruitment of Vps26 and Atg8 to phagosomes and the phagocytic cups. Entamoeba histolytica trophozoites of pSAP2 and Atg8gs transformants were co‐cultured with CellTracker Blue‐loaded CHO cells for the indicated times, fixed and then reacted with anti‐EhAtg8 and anti‐EhVps26 antibodies labelled with Alexa Fluor 488 or Alexa Fluor 546 by ZENON rabbit IgG labelling kit.A. Localization of Atg8 and Vps26 in En. histolytica pSAP2 control trophozoites. One representative cell was shown (see Fig. S5 for additional cells). White arrow indicates Atg8‐positive, Vps26‐negative, unclosed phagocytic cup and white arrowheads indicate Vps26‐associated, but Atg8‐negative phagosomes.B. The percentage of phagosomes associated with EhAtg8 (open bars) or Vps26 (filled bars). At 10, 30 or 60 min after co‐cultivation, phagosomes were examined and the percentage of phagosomes that were associated withEhAtg8 and EhVps26 was calculated. Atg8 association was not determined in Atg8gs strains (ND). Averages of three independent experiments are shown.
Initial recruitment of Rab7A/ vacuolar protein sorting 26 (Vps26) to CHO cell‐containing phagosomes is not affected by Atg8 repression
The observed inhibition of the endosome and phagosome acidification was possibly caused by a defect in the recruitment of machinery needed for maturation of endosomes/phagosomes. To see the effect of Atg8gs on the recruitment of the key factor(s) of endosome/lysosome acidification, we examined the recruitment of Vps26 to phagosomes in pSAP2 and Atg8gs transformants (Fig. 6). Vps26 is a component of the retromer complex, the downstream effector of Rab7A small GTPase, and well colocalized with Rab7A. It has been previously shown that Rab7A and Vps26 are the major regulator of acidification of endosomes, lysosomes and phagosomes and also of the transport of cysteine proteases (Nakada‐Tsukui et al., 2005). It has been previously shown that during erythrophagocytosis, Rab7A is recruited to phagosomes at the late time point (30 min), via pre‐phagosomal vacuoles, which are associated with both Rab5 and Rab7A and formed at early time points (5–10 min) prior to full maturation of phagosomes (Saito‐Nakano et al., 2004). Vps26 well colocalizes with Rab7A (Saito‐Nakano et al., 2004; Nakada‐Tsukui et al., 2005) and is recruited to phagosomes at around 30 min.Slightly different from the previous observation on erythrophagocytosis (Saito‐Nakano et al., 2004), Vps26 was recruited to the phagocytic cups and phagosomes during ingestion of CHO cells at as early as 10 min in the control cells (pSAP2 strain with G3 background). When the unclosed phagocytic cups were examined in pSAP2 strain at 10 min, approximately 83% of them (30 of 36) were associated with Atg8, but only 28% (9 of 36) were associated with Vps26 (data not shown; typical image is shown in Fig. 6A). On the other hand, when enclosed phagosomes were examined in pSAP2 strain at 10 min, approximately 60% or 70% of them were associated with Atg8 or Vps26 respectively (Fig. 6B). These data are consistent with the premise that the recruitment of Atg8 precedes that of Vps26. The percentage of enclosed phagosomes associated with Vps26 was comparable between pSAP2 and Atg8gs (Fig. 6B). These data suggest that although Atg8 is recruited to the phagocytic cup prior to Vps26, the presence of Atg8 is not prerequisite for further recruitment of Vps26. Furthermore, the defect in phagosome acidification caused by Atg8gs is not due to interference with the Rab7A/Vps26‐dependent pathway. Taken together, Atg8 is involved in the initial phase of phagosome acidification in a Rab7A/Vps26‐independent fashion.
Role of Atg8 in endosome and phagosome maturation in En
. histolytica
A recent genome survey of 20 protists, including D. discoideum, Acanthamoeba spp., L. major, Try. brucei, Try. cruzi, Tox. gondii, Pl. falciparum and Plasmodium berghei, revealed that Atg genes are highly conserved among protozoa (Duszenko et al., 2011). Among parasitic protozoa, molecular mechanisms of autophagy have been well studied in the trypanosomatid and apicomplexan parasites L. major, Try. brucei, Try. cruzi and Tox. gondii (Besteiro et al., 2006; 2011; Alvarez et al., 2008; Koopmann et al., 2009; Li et al., 2012). In these parasites, autophagy is important for stage conversion and is also likely involved in organelle removal during stage transition. Despite the conservation of core Atg genes of the Atg8 conjugation system, however, their roles in individual protozoa need to be experimentally validated. As shown here, EhAtg8 is apparently involved in lysosome/phagosome acidification and is less likely to play a role in stress responses, such as nutrient starvation. This finding was unexpected because Atg8 in En. invadens was previously demonstrated to be involved in stage conversion, which is closely associated with stress responses (Picazarri et al., 2008a). Numerous molecules play a role in phagocytosis and phagosome maturation in En. histolytica and include Rab small GTPases, the retromer complex, CaBP1, CaBP3, EhFP4, phosphatidylinositol 3‐phosphate (PtdIns3P) and phosphatidylinositol 4‐phosphate (PtdIns4P). Among them, Rab small GTPases, the retromer complex, PtdIns3P and PtdIns4P are considered to be involved in phagosome maturation (Saito‐Nakano et al., 2004; 2007; Marion et al., 2005; Nakada‐Tsukui et al., 2005; 2009; 2010; 2012; Okada et al., 2005; Okada et al., 2006; Jain et al., 2008; Somlata et al., 2011). PtdIns3P is also a key molecule that determines the site of Atg8 lipidation via the recruitment of the Atg5‐Atg12 : Atg16L complex in mammalian cells (Fujita et al., 2008). It was also suggested that PtdIns3P plays a pivotal role in the generation of light chain 3 (LC3)‐associated phagosomes, in which PtdIns3P synthesis occurs before LC3 recruitment, based on the results of live‐cell imaging of entosis in mammals and apoptotic degradation of Q neuroblast lineage cells in Caenorhabditis elegans (Florey et al., 2011; Li et al., 2012). We previously reported that PtdIns3P is generated or recruited on phagosomal membranes during the phagocytic cup formation and in the very early phase of phagocytosis in En. histolytica (Nakada‐Tsukui et al., 2009). Specifically, the percentage of PtdIns3P‐associated phagosomes (69 ± 6.7, 51 ± 4.5 and 27 ± 5.7% after 10, 30 and 60 min of co‐cultivation with CHO cells, respectively; Nakada‐Tsukui et al., 2009) was found to be higher than that of Atg8‐associated phagosomes (50 ± 8.3, 23 ± 2.3, and 9 ± 3.4%, respectively), as shown in the present study. These data suggest that the generation/recruitment of PtdIns3P to the phagosomal membrane precedes the recruitment of Atg8. In this report, we have also shown by the kinetic study of the recruitment of Atg8 and Vps26/Rab7A that Atg8 is involved in the initial phase of the formation of the phagocytic cup, similar to PtdIns3P, and their further maturation in a Rab7A‐independent pathway (Fig. 6). It is important to investigate where and how PtdIns3P is involved in the recruitment of Atg8 during the phagosome formation in a future study.In conclusion, the findings from our present study demonstrate that Atg8 is involved in lysosomal and phagosomal acidification, a process that is required for the activation of hydrolases such as cysteine proteases, which are well established virulence factors in En. histolytica (Hellberg et al., 2001; Tillack et al., 2006; Mitra et al., 2007; Matthiesen et al., 2013). Further investigation into the unique role and regulatory mechanisms of Atg8 in En. histolytica may help identify novel, unique targets to develop effective measures against this important protozoan pathogen.
Experimental procedures
Bacteria, chemicals and reagents
Escherichia coli DH5α and BL21 (DE3) strains were purchased from Life Technologies (Tokyo, Japan) and Invitrogen (C6000‐03) respectively. All chemicals of analytical grade were purchased from Sigma‐Aldrich (Tokyo, Japan) or Wako (Tokyo, Japan) unless otherwise stated.
En
. histolytica strains and culture
Trophozoites of En. histolytica strain HM‐1 : IMSS cl6 (HM‐1) were cultured axenically in BI‐S‐33 medium (Diamond et al., 1978) at 35.5°C, as previously described (Clark and Diamond, 2002). An En. histolytica clinical isolate, KU45 (zymodeme XIV), was isolated from stool of a dysenteric patient in Urayasu, Chiba, Japan in April 2004. KU46 (II) was isolated from a diarrhoeal patient resistant to metronidazole treatment in Hamamatsu, Shizuoka, Japan in April 2004. KU47 (II) was isolated from an human immunodeficiency virus (HIV)‐positive diarrhoeal patient in Tokyo, Japan in April, 2004. KU48 (XIV) was isolated from liver aspirates of a patient in Tokyo, Japan in May 2006. KU50 was isolated from a diarrhoeal patient at Bokuto Tokyo Metropolitan Hospital, Tokyo, Japan in March 2007. These clinical isolates were monoxenically cultivated in the presence of Crithidia fasciculata, as previously described (Costa et al., 2006). KU2, KU3, KU5 and KU13 (Haghighi et al., 2002; Nozaki et al., 2006) were cultivated in axenic conditions.
Recombinant En
. histolytica Atg8 (EhAtg8) and antiserum against EhAtg8
Standard techniques were used for routine DNA manipulations, subcloning and plasmid construction (Sambrook and Russell, 2001). Production of recombinant protein encoded by the EhAtg8a gene (XP_649165) and antiserum against the EhAtg8a was performed as described previously (Picazarri et al., 2008a, 2008b).
RT‐PCR
To determine if EhAtg8a and EhAtg8b were expressed at the mRNA level, RT‐PCR with isotype‐specific oligonucleotides, EhAtg8a sense: 5′‐ATAGAATAAATGGAATCACAACCA‐3′, EhAtg8b sense: 5′‐ATGGATCCAACTTTTCCAATAAAC‐ 3′ and common antisense: 5′‐TTAATTTCCAAAGACAGATTCTCT‐3′, was conducted as previously described (Mitra et al., 2007). Briefly, polyadenylated RNA was extracted from HM‐1 trophozoites with a Messenger RNA Isolation Kit (Agilent Technologies, Tokyo, Japan) and then treated with deoxyribonuclease I (Invitrogen, 18047‐019) to exclude genomic DNA. Poly‐A RNA was reverse transcribed with the SuperScript III First‐Strand Synthesis System and oligo(dT)20 primer (Invitrogen, 18080051). PCR was performed with the resulting cDNA as a template using a DNA Engine Peltier Thermal Cycler (Bio‐Rad, Hercules, CA, USA). The PCR cycling conditions consisted of an initial step of denaturation at 94°C for 1 min, followed by 30 cycles of denaturation at 98°C for 10 s, annealing at 52°C for 30 s and extension at 72°C for 30 s.
Gene silencing of EhAtg8
Gene silencing was performed as previously described (Bracha et al., 2006; Mi‐ichi et al., 2011; Nakada‐Tsukui et al., 2012). Briefly, a 384‐bp fragment containing the entire open reading frame (ORF) of EhAtg8a gene starting at the initiation codon was amplified by PCR with the oligonucleotide primers 5′‐ aaaaggcctATGGAATCACAACCAAAACTT‐3′ and 5′‐ ggggagctcTTAATTTCCAAAGACAGATTC‐3′ using pGST‐EhAtg8 as a template (Picazarri et al., 2008a). The PCR cycling conditions consisted of 98°C for 30 s, followed by 30 cycles of 98°C for 5 s, 55°C for 20 s, 72°C for 30 s and a final extension at 75°C for 5 min. The obtained PCR product was digested with StuI and SacI and inserted into StuI/SacI‐digested pSAP2 45 to produce pEhATG8gs. This plasmid was introduced into the En. histolytica G3 strain (Bracha et al., 2003; 2006) by liposome‐mediated transfection (Nozaki et al., 1999; Picazarri et al., 2008b). Transformants were selected and maintained in medium supplemented with 6 μg ml−1 geneticin.
Cell fractionation
Approximately 5–7 × 106 trophozoites were harvested, washed twice with phosphate‐buffered saline (PBS) containing 2% glucose and resuspended in homogenization buffer [50 mM Tris, pH 7.5, 250 mM sucrose, 50 mM NaCl and 1.34 mM trans‐epoxysuccinyl‐L‐leucylamido‐(4‐guanidino)butane (E‐64)]. The amoebae were homogenized with 100 strokes in a glass homogenizer and then centrifuged at 400× g for 5 min at 4°C to remove unbroken cells. The supernatant was further centrifuged at 100 000× g for 1 h and the obtained pellet and supernatant fractions were subjected to immunoblot analysis and phospholipase D treatment.
Immunoblot analysis
Sodium dodecyl sulfate (SDS)‐polyacrylamide gel electrophoresis (PAGE) was conducted using 13.5% separating gels containing 6 M urea as previously described (Kirisako et al., 2000). Approximately 5 μg of lysates or membrane fractions were separated by denaturing SDS‐PAGE and transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk in Tris‐buffered saline Tween 20 (TBS‐T) [50 mM Tris‐HCl (pH8.0), 150 mM NaCl, 0.5% Tween20] and were then incubated with anti‐EhAtg8 (1:1000 dilution) (Picazarri et al., 2008a) or anti‐EhNifS (1:1000 dilution) (Ali et al., 2004) rabbit polyclonal antibodies overnight at 4°C. After washing in TBS‐T, the membranes were incubated with rabbit IgG horseradish peroxidase (HRP)‐conjugated antibody (1:10000 dilution) (GE Healthcare, NA934) for 1 h. Reacted bands were visualized by chemiluminescence using the Immobilon Western Chemiluminescent HRP substrate (Millipore Corp., P36599).
Indirect immunofluorescence assay
Trophozoites were fixed with 3.7% paraformaldehyde in PBS (pH 6.6) at room temperature for 10 min, washed with PBS and then permeabilized with 0.2% saponin for 10 min. The permeabilized cells were incubated with anti‐EhAtg8 polyclonal rabbit (1:1000 dilution) or anti‐HA (1:1000 dilution) mouse monoclonal antibody for 1 h and subsequently incubated with anti‐mouse, anti‐rabbit IgG Alexa Fluor 488 antibody or anti‐mouse IgG Alexa Fluor 568 antibody (Invitrogen, A11029, A11034, A11031) for 1 h at room temperature. Finally, the cells were washed with PBS containing 0.1% bovine serum albumin (BSA), mounted on a slide glass and examined under a confocal laser scanning microscope (Carl Zeiss, LSM 510 META). Images were analysed with LSM 510 software (Carl Zeiss, Jena, Germany).
Endocytosis assay
Approximately 4–5 × 105 cells were incubated in 500 μl BI‐S‐33 medium containing 2 mg ml−1 FITC‐dextran at 37°C for 15–180 min. Cells were washed twice with cold PBS and resuspended in 500 μl PBS. The fluorescence signal from a 250‐μl sample of the cell suspension was measured using a F‐2500 Fluorescence Spectrophotometer (Hitachi High‐Technologies, Tokyo, Japan) with excitation at 495 nm and emission at 519 nm. The remaining 250 μl of the cell suspension was lysed with 1:10 volume of 10X lysis buffer, and the fluorescence signal and total amount of endocytosed dextran in the lysate was measured as described earlier. As FITC has much stronger fluorescence emission at neutral pH compared with acidic pH, the fluorescence signal from live cells largely reflects the amount of FITC‐dextran in non‐acidified endosomes, whereas the signal in the lysate at neutral pH indicates the total amount of FITC‐dextran in the cell (Meza and Clarke, 2004; Mitra et al., 2005; 2006). All assays were performed in duplicate. Endocytosis efficiency was calculated based on the fluorescence from cell lysates that had been neutralized to limit bias from the pH of different cellular compartments. The fluorescence signal of the lysate of the control (pSAP2) cells harvested after 180 min of co‐incubation with FITC‐dextran was set as 100%. The percentage of acidified endosomes was calculated by dividing the fluorescence signal of the unlysed cell suspension with that of the neutralized cell lysate.
Phagocytosis assay
Approximately 105 amoebae were grown overnight in a 24‐well plate under anaerobic conditions. Nile Red fluorescent carboxylate‐modified FluoSphere microspheres (Molecular Probes,F8825), TRITC‐labelled Es. coli cells (Molecular Probes, E2862) or pHrodo‐labelled Es. coli cells (Molecular Probes, P35366) were added to the amoebae. After incubation for 0, 10, 30 or 60 min at 35.5°C, the amoebae were washed once with warm PBS containing 250 mM galactose (PBS‐galactose) and 450 μL PBS‐galactose was added. The plate was chilled on ice and detached amoebae were recovered and analysed by two‐colour flow cytometry (Becton Dickinson, FACSCalibur). To examine the localization of Atg8 during phagocytosis, approximately 3 × 105 of CellTracker Blue‐loaded CHO cells were added to each 8‐mm well containing 1 × 105
En. histolytica trophozoites on a slide glass. After incubation for 10, 30 and 60 min, the cells were fixed and stained with anti‐EhAtg8 antiserum and anti‐rabbit IgG Alexa Fluor 568 antibody. The stained cells were examined under a LSM510 META microscope, as described earlier. To examine the colocalization of Atg8 and Vps26, fixed cells were stained with Alexa Fluor 488‐ or Alexa Fluor 546‐labelled anti‐EhAtg8 and anti‐EhVps26 (Nakada‐Tsukui et al., 2005) rabbit serum by ZENON rabbit IgG labeling kit (Life technologies, Z‐25302 and Z‐25304) respectively.Fig. S1. Alignment of Atg8 in Entamoeba and other organisms. (A) Atg8 protein sequences from Entamoeba histolytica (a, XP_649165; b, XP_649940), Entamoeba dispar (1, XP_001736059; 2, XP_001735824), Entamoeba moshkovskii (1, EMO_027800; 2, EMO_113660; 3, EMO_031640) (Amoeba DB, http://amoebadb.org/amoeba/), Entamoeba nuttalli (1‐378bp of scaffold JH928776 in Amoeba DB) and Entamoeba invadens (XP_004257811) were aligned by ClustalW. (B) Atg8 and its homologues from Saccharomyces cerevisiae (NP_00947), Dictyostelium discoideum (EAL64271), Homo sapiens (NP_009209), Tetrahymena thermophila (EAR86305) and Trypanosoma brucei (A, XP_846213; B, XP_846214) were aligned with E. histolytica Atg8a and Atg8b. NHD and ULD are indicated by dashed and solid lines respectively. A dot indicates an amino acid replacement in EhAtg8b.Fig. S2. Detection of EhAtg8a and EhAtg8b transcripts by RT‐PCR. (A) Schematic diagram of the two Atg8 genes in Entamoeba histolytica. EhAtg8b contains a unique VspI site. (B) EhAtg8a and EhAtg8b transcripts were amplified by PCR using isotype‐specific oligonucleotide primers and cDNA synthesized with (cDNA) or without (‐RT) reverse transcriptase. (C) Verification of the identity of the EhAtg8a and EhAtg8b transcripts. EhAtg8a and EhAtg8b transcripts were amplified by RT‐PCR and digested with (+VspI) or without VspI (−VspI).Fig. S3. Ubiquitous expression of Atg8 in Entamoeba histolytica clinical isolates. Immunoblot analysis of EhAtg8 in clinical isolates. All strains were either monoxenically cultivated with Crithidia fasciculata or axenically cultivated, harvested at semi‐confluence (2 or 3 days) and approximately 5 μg of the samples were analysed by SDS‐PAGE and immunoblotting. The double arrows indicate the doublet bands of the membrane‐associated form of EhAtg8.Fig. S4. Additional immunofluorescent images of Atg8‐associated phagosomes. Methods and conditions should be referred to the legend of Fig. 5A. Briefly, Entamoeba histolytica trophozoites of HM‐1 strain were co‐cultured with CellTracker Blue‐loaded CHO cells for the indicated times, fixed and then reacted with anti‐EhAtg8 antibody and Alexa‐568 conjugated anti‐rabbit IgG secondary antibody. Arrows indicate phagosomes with EhAtg8. Two additional cells are shown for each time point.Fig. S5. Additional immunofluorescent images showing the association of Atg8 with the phagocytic cup. Methods and conditions should be referred to the legend of Fig. 6. Briefly, Entamoeba histolytica trophozoites of pSAP2 control transformant (with G3 background) were co‐cultured with CellTracker Blue‐loaded CHO cells for 10 min (upper panels) or 30 min (lower panels), fixed and then reacted with anti‐EhAtg8 and anti‐EhVps26 antibodies labelled with Alexa Fluor 488 or Alexa Fluor 546 by ZENON rabbit IgG labeling kit.Click here for additional data file.
Authors: Andrew M Tomlins; Fathia Ben-Rached; Roderick Am Williams; William R Proto; Isabelle Coppens; Ulrike Ruch; Tim W Gilberger; Graham H Coombs; Jeremy C Mottram; Sylke Müller; Gordon Langsley Journal: Autophagy Date: 2013-08-29 Impact factor: 16.016
Authors: Ben Loos; Anna-Mart Engelbrecht; Richard A Lockshin; Daniel J Klionsky; Zahra Zakeri Journal: Autophagy Date: 2013-07-10 Impact factor: 16.016
Authors: Roberto Cárdenas-Zúñiga; Virginia Sánchez-Monroy; Rosa María Bermúdez-Cruz; Mario Alberto Rodríguez; Jesús Serrano-Luna; Mineko Shibayama Journal: Parasitol Res Date: 2016-10-28 Impact factor: 2.289
Authors: Yasmin Pedra-Rezende; Isabela S Macedo; Victor Midlej; Rafael M Mariante; Rubem F S Menna-Barreto Journal: Front Microbiol Date: 2022-03-29 Impact factor: 5.640
Authors: Zdeněk Verner; Vojtěch Žárský; Tien Le; Ravi Kumar Narayanasamy; Petr Rada; Daniel Rozbeský; Abhijith Makki; Darja Belišová; Ivan Hrdý; Marie Vancová; Corinna Lender; Constantin König; Iris Bruchhaus; Jan Tachezy Journal: PLoS Pathog Date: 2021-11-15 Impact factor: 6.823