Literature DB >> 25919089

Aptamer-Mediated Codelivery of Doxorubicin and NF-κB Decoy Enhances Chemosensitivity of Pancreatic Tumor Cells.

David Porciani1, Lorena Tedeschi2, Laura Marchetti3, Lorenzo Citti2, Vincenzo Piazza4, Fabio Beltram1, Giovanni Signore4.   

Abstract

Aptamers able to bind efficiently cell-surface receptors differentially expressed in tumor and in healthy cells are emerging as powerful tools to perform targeted anticancer therapy. Here, we present a novel oligonucleotide chimera, composed by an RNA aptamer and a DNA decoy. Our assembly is able to (i) target tumor cells via an antitransferrin receptor RNA aptamer and (ii) perform selective codelivery of a chemotherapeutic drug (Doxorubicin) and of an inhibitor of a cell-survival factor, the nuclear factor κB decoy oligonucleotide. Both payloads are released under conditions found in endolysosomal compartments (low pH and reductive environment). Targeting and cytotoxicity of the oligonucleotidic chimera were assessed by confocal microscopy, cell viability, and Western blot analysis. These data indicated that the nuclear factor κB decoy does inhibit nuclear factor κB activity and ultimately leads to an increased therapeutic efficacy of Doxorubicin selectively in tumor cells.

Entities:  

Year:  2015        PMID: 25919089      PMCID: PMC4417125          DOI: 10.1038/mtna.2015.9

Source DB:  PubMed          Journal:  Mol Ther Nucleic Acids        ISSN: 2162-2531            Impact factor:   10.183


Introduction

The therapeutic efficiency of chemotherapeutic agents is often hampered by their lack of selectivity.[1] A promising strategy to overcome these limitations relies on the engineering of systems for targeted delivery, i.e., devices that can selectively recognize tumor cells and promote efficient internalization of the therapeutic payload, avoiding off-target toxicity. To this end, targeting of biomolecules overexpressed in tumor cells with natural or synthetic ligands (peptides, proteins, antibodies, aptamers) are actively explored.[2] One of the most promising targeting strategies involves the use of nucleic acid aptamers, short single-stranded oligonucleotides (DNA or RNA) able to recognize and bind their target molecule with high affinity and selectivity.[3,4] Compared with antibodies, aptamers are nonimmunogenic, easy to synthesize, optimize, and manipulate.[5] Furthermore, they can penetrate more efficiently into tumor tissues.[6] Recent studies led to the development of a variety of targeted drug-delivery platforms based on aptamer–drug conjugates (e.g., aptamer–doxorubicin (Dox) conjugates)[7,8] or aptamer-nanomaterial assemblies.[9,10] Here we focus on aptamers targeting transferrin receptor (TfR), a receptor which is overexpressed in many solid tumors.[11,12] These aptamers can bind human and mouse TfR either by showing higher affinity (e.g., c2) or by targeting TfR in a different in different binding site with respect to transferrin (e.g., FB4, GS24, and DW4).[13,14,15] Anti-TfR aptamers present a rather high potential, especially when selective delivery of anticancer agents with adverse side effects, such as Dox, is required. Dox is one of the most widely used chemotherapeutic drugs. Unfortunately, it shows rather significant unwanted cytotoxicity, especially toward cardiomiocytes.[16] In addition, its therapeutic efficiency sensibly decreases during the treatment because of acquired chemoresistance.[17] Acquired chemoresistance was linked to activation of the nuclear factor κB (NF-κB),[18] a ubiquitous transcription factor that suppresses Dox-induced apoptosis.[1] NF-κB is activated in response to several stimuli (carcinogenesis, inflammatory agents, or chemotherapeutic drugs) and translocates from cytoplasm to the nucleus where it promotes transcription of antiapoptosis genes such as X-linked inhibitor of apoptosis protein (XIAP) and Bcl-2 family genes, ultimately conferring resistance toward apoptotic stimuli.[19] Recent studies demonstrated that inhibition of NF-κB sensitizes tumor cells to Dox-induced apoptosis in various cancer cells (breast cancer, pancreatic cancer, renal and hepatocellular carcinoma).[1,20,21] Several approaches were proposed to inhibit NF-κB activation;[1,19,22] among those, a decoy strategy that hampers binding of NF-κB to the promoter region of its targeted genes is a particularly reliable approach.[23,24] Decoys are synthetic, double-stranded oligonucleotides (ODNs) that selectively inhibit biological function of targeted transcription factors. NF-κB decoy ODNs are designed to mimic the κB consensus sequence recognized by NF-κB to the promoter regions of its target genes, ultimately preventing NF-κB binding to these sequences into the nucleus. The clinical application of this strategy is, however, limited by poor uptake into mammalian cells. This leads to the need for high dosage, repeated administrations, and long incubation times to obtain significant biological effects.[24] Here we show our results on the design, synthesis, and optimization of an ODN chimera, named aptacoy, able to selectively target pancreatic tumor cells through a nuclease-stabilized anti-TfR RNA aptamer, and perform simultaneous, targeted release of Dox and NF-κB decoy, leading to highly targeted, synergistic effect of the two molecular payloads.

Results

Rational design of aptamer–Dox conjugate

It is known that Dox intercalates within DNA strands through its aromatic rings, preferentially binding to double stranded 5′-GC-3′ or 5′-CG-3′ sequences.[25] Our rational design of the therapeutic assembly started with the modification of a known anti-hTfR RNA aptamer (c2.min)[14] to increase its Dox-loading capacity. We designed an elongated aptamer bearing a short DNA tail (CGA)7 at 3′end to create a duplex G-C rich region on hybridization with its complementary DNA sequence (TCG)7, hereafter called antitail. Nucleic acid PACKage (NUPACK), a secondary structure prediction tool,[26] evidenced one Dox binding site on the RNA motif and six to seven possible binding sites on the duplex region of the oligonucleotidic carrier structure (hereafter c2C), yielding the potential for loading seven to eight Dox molecules/c2C (). Interestingly, the DNA duplex domain does not interfere with the correct RNA aptamer folding (), in agreement with previous findings involving similar structures.[27] Activity of c2C was assessed with a functional assay by monitoring internalization in pancreatic tumor cells (MIA PaCa-2) that overexpress hTfR.[28] The endocytosis process of the dual-labeled assembly (Atto 633 and Alexa Fluor 488 on c2.min and antitail portions of c2C, respectively) was monitored by confocal microscopy (). Complete colocalization of the two dyes in subcellular vesicles was observed after 20 minutes incubation, consistently with the uptake and retention of the entire complex.[29] Interestingly, considerable perinuclear localization was observed at longer times (120 minutes) for both dyes, suggesting that at least a fraction of c2C is not recycled during the endocytosis process. Overall, the endocytosis of the whole complex demonstrates the capability of c2.min to retain its activity even when embedded in a more complex ODN structure. Next, we turned our attention to the assembly of a noncovalent conjugate between c2C and Dox. To this end, we evaluated Dox loading efficiency by monitoring quenching of its fluorescence emission on intercalation in DNA.[7] Dox fluorescence steadily decreased on incubation with the hybridized ODN for Dox/c2C ratios up to 7.5 : 1 (), in agreement with the predicted presence of seven to eight Dox binding sites (). Only low fluorescence reduction was detected in presence of c2.min and no quenching effect was observed in absence of the hybridization between the tail and antitail portions (see Supplementary Figure S1). This result confirms the role of the DNA duplex in Dox loading. Most importantly, c2C–Dox complex did not release Dox after 1 hour incubation in serum-containing medium (1% and 5%) at 37°C, and only minor leakage was observed (<10%) after 2 hours incubation (see Supplementary Table S1). Notably, even with longer incubation (24 hours) the assembly was quite stable, and leakage from the double helix was ~25% in both serum conditions. In addition, no serum-concentration dependence was observed. This suggests that leakage occurs through thermally-driven Dox desorption from double helix that does not involve interaction with serum proteins.

Aptamer-mediated tumor targeting and antitumor efficacy of c2C–Dox

We next evaluated the aptamer-mediated uptake of Dox in tumor cells (MIA PaCa-2). Nontumoral mouse fibroblasts (NIH-3T3) were used as negative control.[30] Cells were treated with either the whole complex or free Dox, keeping constant both Dox concentration (1.5 µmol/l) and Dox/c2C ratio (7.5 : 1). After 2 hours incubation, confocal imaging microscopy showed that free Dox readily diffuses through the plasma membrane and accumulates into the nuclei of both hTfR-positive and hTfR-negative cells with nearly identical efficiency. In contrast, Dox internalization mediated by c2C was markedly different in tumor and control cells (). Indeed, c2C–Dox was readily internalized in MIA PaCa-2 cells, as shown by Dox fluorescence detected both in endocytic vesicles and into the nucleus, whereas only a weak cytoplasmic signal was detected in control cells (NIH-3T3), likely because of negligible nonspecific internalization of the complex. Interestingly, uptake mechanisms for free Dox and c2C–Dox by MIA PaCa-2 cells appear quite different. Free Dox accumulates almost exclusively in the nuclear region, while c2C–Dox shows both nuclear fluorescence and cytoplasmic signal, in keeping with a subcellular compartimentalization of Dox within endosomes and lysosomes (endolysosomes) because of receptor-mediated endocytosis. This behavior is in agreement with previous studies that showed cytoplasmic localization of Dox released from transferrin–Dox conjugates.[31] The intracellular release of Dox from the ODN complex in MIA PaCa-2 cells was also evaluated at longer times (24 hours after treatment). Interestingly, higher fluorescence was observed both in the cytoplasm and in the nucleus (). This fact suggests escape of Dox from DNA duplex during later stages of the endocytosis pathway.[32] Next, we turned our attention to the assessment of c2C–Dox cytotoxic effects toward tumor cells using a cell viability assay (WST-8).[33] Dose–response curves were recorded for both tumor and control cells treated with either free Dox or c2C–Dox. Furthermore, a c2-scrambled sequence (i.e., c36) known not to recognize hTfR[14] was used as an additional control (c36C–Dox). A distinct cell line (HeLa) was also employed to assess the cytotoxicity of our complex with a different tumor model. As expected, Dox did present dose-dependent cytotoxicity in all cell lines. c2C–Dox was sensibly more selective, leading to higher cytotoxic effect both in MIA-PaCa-2 and in HeLa cells, when compared with controls (). Notably, c36C–Dox did not show appreciable cytotoxicity in any tumor cell line, apart from a minor contribution likely stemming either from partial Dox leakage during incubation or some minor nonspecific uptake (). This supports the observation that the observed cytotoxic enhancement shown by c2C–Dox is indeed related to an active targeting process. Interestingly, both free Dox and c2C–Dox showed higher cytotoxicity toward HeLa than MIA PaCa-2, indicating a higher Dox sensitivity of the cervical cancer cells when compared with the pancreatic tumor model. Finally, we also confirmed that the observed cytotoxicity was actually related to an apoptotic process because of the intracellular Dox release, by means of an Annexin V/Propidium Iodide assay.[34,35] Treatment of MIA-PaCa-2 cells with c2C–Dox evidenced the typical pattern of late apoptotic cells. Conversely, treatment with free c2C did not induce appreciable fluorescence, indicating nonapoptotic cellular condition (see Supplementary Figure S2).

pH- and nuclease-dependent Dox release from the c2C–Dox

The release mechanism of Dox from DNA duplex during endocytosis pathway was investigated using simulated conditions in vitro. c2C–Dox (1.5 µmol/l Dox concentration) was incubated in solutions at different pH (7.4, 6.5, 5.8, 5.5, 5.0), and fluorescence of the Dox released was compared with that of a Dox control sample at the same concentration.[36] Dox release increased at lower pH value, reaching 40% at pH 5.5 and 55% at pH 5.0 within 30 minutes (). Interestingly, this result is in excellent agreement with previous observations regarding Dox release in acidic solution.[37] On addition of DNA nucleases to c2C-Dox at pH 5.0, Dox release increased from 55% to 98% within 2 hours at room temperature. The observed pH dependency can be related to the protonation of –NH2 groups on Dox at lower pH,[36] which reduces the hydrophobic interaction between the aromatic ring of Dox and the bases of DNA duplex. The pH- and nuclease-dependent Dox release from c2C–Dox conjugate is also consistent with the increased Dox fluorescence detected in cell cytoplasm at longer times (24 hours after treatment) () and supports the hypothesis of pH- and enzymatic Dox release at endolysosomal level during receptor-mediated endocytosis pathway.

Synthesis and Dox-loading of a novel aptacoy chimera

In order to increase the cytotoxicity of the c2C–Dox conjugate, we investigated a novel codelivery strategy. Recently, it was demonstrated that NF-κB activation suppresses the apoptotic potential of Dox, ultimately conferring an increased chemoresistance to a plethora of tumor cells.[1,18] Synthetic double-stranded DNA ODNs with high affinity for NF-κB, known as NF-κB decoys, were extensively used to block induction of gene expression mediated by NF-κB both in vitro and in vivo.[23,24] During translocation, NF-κB is potentially susceptible to hijacking by decoys bearing the binding sequence recognized by NF-κB.[38] Therefore, we designed a chimeric ODN, named aptacoy, composed by c2C portion directly conjugated to a NF-κB decoy. The latter portion mimics the κB consensus sequence for NF-κB binding and hampers its nuclear translocation, ultimately blocking the NF-κB-mediated downstream activation of antiapoptotic genes. First, we designed a nuclease-resistant phosphorothioate ODN with a self-complementary sequence to obtain the suitable double-stranded DNA via intramolecular folding (see Supplementary Figure S3).[39] To promote release of NF-κB decoy from aptacoy after internalization in targeted cells, we conjugated NF-κB decoy with the antitail using a disulfide linker that is stable in the extracellular medium but is easily cleaved in reducing intracellular environment, such as lysosomes.[40] The oligo conjugation was performed with a two-step procedure (see Supplementary Figures S3 and S4). After this process, the resulting conjugated product was hybridized with the tail portion of c2, to obtain the aptacoy structure, hereafter c2C-d. Incubation with a suitable amount of Dox yielded the final physical conjugate c2C-d–Dox (i.e., aptacoy-Dox). Dox quenching because of intercalation within double-stranded DNA was comparable with our results with c2C–Dox (see Supplementary Figure S5). The presence of a double-stranded helix in the decoy domain of the construct may introduce additional sites for Dox intercalation. Thus, we added unconjugated NF-κB decoy to a Dox solution and monitored fluorescence intensity changes to assess the quenching effect of decoy. Originally, we detected a noticeable Dox fluorescence quenching, which however was remarkably smaller than that shown by hybridized complex (see Supplementary Figure S5). Overall, these results confirmed that maximum quenching effect was because of the formation of the aptacoy–Dox complex. Despite the presence of additional binding sites, Dox/c2C-d molar ratio was kept constant at 7.5 in subsequent experiments to better compare therapeutic efficiency of both complexes (c2C–Dox versus c2C-d–Dox). Note, however, that greater Dox/c2C-d ratios are achievable by exploiting the additional binding sites present on the double-stranded decoy.

Codelivery of Dox and NF-κB decoy via anti-TfR aptamer in living cells

We investigated whether the NF-κB decoy could be effectively released in cytoplasm from the aptacoy, ultimately inhibiting the transcriptional activity of NF-κB. To this end, we performed fluorescence immunostaining of NF-κB in MIA PaCa-2 cells to monitor its cellular localization in different conditions. In unstimulated MIA PaCa-2 cells (treated only with c2C), NF-κB was found mainly in the cell cytoplasm as confirmed by the lack of colocalization between NF-κB and nuclear marker DAPI (). Stimulation with NF-κB inducer TNF-α (20 ng/ml) led to an impressive accumulation of NF-κB in cell nuclei, as shown by the complete colocalization between NF-κB and DAPI. Interestingly, nuclear translocation of NF-κB was significantly reduced in MIA PaCa-2 cells treated with c2C-d prior to TNF-α stimulation, as shown by cytoplasmic localization of NF-κB (). The inhibition of TNF-α-induced NF-κB activation indicates that NF-κB decoy was actually released from c2C-d and could bind NF-κB in the cell cytoplasm hampering its nuclear translocation.[41] The actual mechanism of decoy endosomal escape is not quite clear, however, as is the case for most therapeutic ODNs (siRNAs, miRNAs, antagomirs, antisense oligos, and hammerhead ribozymes).[42,43] Next, we evaluated the effect of Dox on NF-κB nuclear translocation in MIA PaCa-2 cells. Not surprisingly, MIA PaCa-2 cells showed a prominent nuclear translocation of NF-κB after Dox stimulation in agreement with previous studies on different cell lines.[20,21] However, treatment with c2C-d efficiently decreased Dox-induced NF-κB nuclear translocation, confirming the inhibitory activity exhibited by the decoy toward NF-κB (). Then, we evaluated whether c2C-Dox-d could improve sensitization of tumor cells to the apoptotic effect of released Dox. In order to compare the cytotoxicity of c2–Dox and c2C–Dox–d, we performed cell-viability assays on pancreatic tumor and control cells. In addition, we examined the behavior of c2C-sd–Dox, a construct bearing a scrambled decoy sequence[23] to assess the potential cytotoxicity of a phosphorothioate payload. Dose–response curves were obtained for each complex toward MIA PaCa-2 cells (). Cytotoxicity of c2C-d–Dox significantly exceeded values found for c2C–Dox, and was quite comparable with free Dox. Conversely, treatment with c2C-sd–Dox did produce effects identical to the administration of c2C-Dox, thus evidencing that increased cytotoxicity is related to the effect of the decoy itself (). Furthermore, this complex fully retained its targeting properties, being able to deliver Dox selectively in targeted cells, as shown by the almost null cytotoxicity toward NIH-3T3 cells even on continuous treatment (24 hours) with the complex (). Next, we sought to investigate whether the enhanced cytotoxic effect shown by aptacoy–Dox complex was actually because of an apoptotic process. To this end, Western blot analysis was performed to evaluate the extent of poly-(ADP-ribose) polymerase (PARP) cleavage, a well-established apoptotic marker.[44] PARP cleavage was observed on treatment with either free Dox or c2C-d–Dox (). On the contrary, resting cells and c2C-treated cells did not present significant accumulation of cleaved PARP. Notably, the relative intensity of cleaved versus full-length bands suggests that apoptotic processes are enhanced on treatment with c2C-d–Dox compared to free Dox. This important outcome suggests that the enhanced cytotoxicity of c2C-d–Dox observed with MIA PaCa-2 cells is indeed related to an increased apoptosis. Finally, we investigated the expression of XIAP whose expression is tightly regulated by NF-κB. XIAP belongs to the family of inhibitor of apoptosis proteins and is directly involved in caspases inhibition to protect cell against death.[19] Enhanced NF-κB activity and consequently a marked up-regulation of XIAP were found in chemoresistant pancreatic cancer cells.[19,45] Western blot analysis was performed to monitor XIAP expression in MIA PaCA-2 cells on treatment with c2C, c2C-Dox, or c2C-d-Dox. Importantly, a remarkable decrease of XIAP expression was observed in cells treated with c2C-d–Dox when compared with resting and c2C–Dox treated cells (). Notably, XIAP expression of resting cells exceeded what found for c2C–Dox, which in turn was higher than that relative to the c2C-d–Dox. This trend matches the reported repression of XIAP gene expression induced by Dox[46] which is significantly improved by the effective inhibition of NF-κB activity after aptacoy–Dox treatment. Overall, these results demonstrate that the combination of Dox and NF-κB decoy sensitizes pancreatic cancer cells, ultimately leading to the enhancement of Dox-mediated apoptotic effect.

Discussion

In summary, we presented a molecular-engineering strategy to design a drug-delivery platform composed uniquely by ODNs. This assembly exploits receptor-mediated internalization to perform selective delivery of Dox in tumor pancreatic cells and sensitizes them to Dox-induced apoptosis. We combined the targeting ability of an RNA aptamer that recognizes tumor cells expressing TfR and the inhibitory effect of a DNA decoy toward NF-κB. The complex was generated by DNA self-assembly between two complementary single-stranded DNA sequences: one located within targeting RNA aptamer and one covalently linked to NF-κB decoy with a disulfide bridge. The resulting aptacoy can accomodate multiple Dox molecules in DNA duplex domains yielding a therapeutically-active complex. We demonstrated that the aptamer motif promotes efficient selective delivery of molecular payloads in tumor cells. Most importantly, the codelivery of a decoy significantly increased Dox cytotoxicity toward targeted pancreatic tumor cells owing to selective inhibition of constitutive NF-κB activity. We believe that the present drug-delivery platform can lead to reduction of tumor chemoresistance toward Dox thus enhancing its therapeutic efficiency. Finally, the flexibility of our aptacoy platform represents a useful starting point for further engineering of this system with the intriguing possibility to design specific ODN architectures exploiting appropriate combinations of aptamer ligands, decoys, and drugs that could pave the way to the development of highly functional targeted therapy.

Materials and methods

Materials. All chemicals were purchased from Sigma Aldrich (St Louis, MO) unless otherwise specified, and were used as received. ODN synthesis and purification were performed according to a reported protocol.[47] High-performance liquid chromatography (HPLC) analyses, absorption, and fluorescence measurements were performed accorded to reported protocols.[13] ODN sequences. All phosphoramidite monomers were purchased from Glen Research (Sterling, VA). The sequence of the anti-TfR RNA aptamer (c2.min) with a short DNA tail (CGA)7 at the 3′end was the following (tail sequence is in italic): 5′-GGGGGAUCAAUCCAAGGGACCCGGAAACGCUCCCUUACACCCCCGACGACGACGACGACGACGA-3′ The sequence of the scrambled aptamer (c36) with a short DNA tail (CGA)7 at the 3′end was the following (extended sequence of aptamer is in italic): 5′GGCGUAGUGAUUAUGAAUCGUGUGCUAAUACACGCCCGACGACGACGACGACGACGA-3′ All pyrimidines of the RNA aptamer motif were substituted by 2′-fluoro-pyrimidines. All synthesized ODNs contained a 5′amino group attached by a C-6 alkyl chain. The antitail sequence was the following: 5′-TCGTCGTCGTCGTCGTCGTCG-3' The sequence of the phosphorothioate NF-κB decoy was the following (consensus sequence are in italic): 5′-CCTGGAAAGTCCCGAAAGGGACTTTCCAGG-3′ The sequence of scrambled phosphorothioate NF-κB decoy was the following (complementary sequences are in italic) 5′-GCCGTACCTGACTTAGCCGAAAGGCTAAGTCAGGTACGGC-3′ All synthesized phosphorothioate ODNs contained a 3′amino group attached by a C-6 alkyl chain. Cell culture. Human pancreatic carcinoma cells (MIA PaCA-2), human cervical cancer cells (HeLa), and mouse embryonic fibroblast cells (NIH-3T3) were purchased from the American Type Culture Collection (ATCC, Manassas, VA). All cell lines were grown using a previously reported protocol.[13] Confocal imaging of cells. Cells were imaged using a Leica TCS SP5 SMD inverted confocal microscope (Leica Microsystems, Heidelberg, Germany) interfaced with a diode laser (Picoquant, Berlin, Germany) for excitation at 405 nm, with Ar lasers for excitation at 488 and 561 nm and with a HeNe laser for excitation at 633 nm. Glass bottom Petri dishes containing cells were mounted in a thermostated chamber at 37°C (Leica Microsystems) and viewed with a 63 × 1.2 NA water immersion objective or 40 × 1.5 NA oil immersion objective (Leica Microsystems). The pinhole aperture was set to 1.0 Airy. All data collected were analyzed by ImageJ software version 1.44o. Secondary structure and hybridization predictions. ODN secondary structure predictions were obtained using the Internet tool NUPACK nucleic acid package (http://www.nupack.org/) with the default settings. Hybridization prediction between the tail sequence on the RNA aptamer structure and its short DNA complementary sequence (antitail) were obtained with NUPACK analysis algorithms software, representing each ODN as an RNA sequence. The NUPACK-generated secondary structures were used to obtain three-dimensional structures exploiting the utilities of the NUPACK software. ODN labeling. The amino residues at 5′-end of the extended RNA aptamer (c2.min + tail) and antitail were conjugated, to the ATTO 633 NHS fluorophore (ATTO-TEC GmbH, Siegen, Germany) and Alexa Fluor 488 NHS fluorophore (Invitrogen, Carlsbad, CA), respectively, by means of standard NHS coupling procedures between the primary amine of the ODNs and NHS-derivative of the fluorophores. The labeling reaction, purification, and quantification of the final product were performed according to a reported protocol.[13] ODN annealing protocol. To assemble the extended sequence of the RNA aptamer with its complementary DNA sequence, these two ODNs were mixed with equal molar concentration in a buffer solution, (PBS 1X containing 1 mM MgCl2). The mixture was placed in a thermoblock and heated to 90°C for 1 minute to denature the nucleic acid structures. Then, the entire apparatus was placed on the workbench for 30 minutes and denatured oligo sample was slowly cooled to allow correct hybridization between the two complementary strands. The hybridized product was always freshly prepared before each evaluation. Dox intercalation in double helix region of the hybridized aptamer. A physical conjugate between hybridized aptamer carrier sample (c2C, c36C, c2C-d, and c2C-sd) and Dox was made by addition of 1 : 7.5 molar ratio of aptamer to Dox in binding buffer (PBS 1× containing 1 mmol/l MgCl2). Dox fluorescence was measured (excitation: 480 nm, emission: 500–700 nm). Slits for both excitation and emission were set at 10 nm. The resulting complex (c2C–Dox, c36C–Dox, c2C-d–Dox, and c2C-sd–Dox) was freshly prepared before each experiment. Dox release from aptamer in serum-containing media. After physical conjugate preparation between c2C and Dox, the c2C–Dox complex was added to either 1% or 5% serum-containing medium and incubated at 37 °C for 0, 30, 60, 120 minutes, and 24 hours. Dox fluorescence was measured (excitation: 480 nm, emission: 540–700 nm. Slits for excitation and emission were set at 20 and 10 nm, respectively). The amount of Dox released was determined by comparison with that of a Dox sample incubated in the same conditions, assuming the fluorescence intensity of the starting complex and of free Dox sample as 0 and 100%, respectively. Assessment of cellular uptake by confocal microscopy. Internalization assay in MIA PaCa-2 cells was performed using a dual-labeled conjugate, in which the extended c2.min was labeled with ATTO 633 and the antitail was labeled with Alexa Fluor 488. MIA PaCa-2 cells were seeded 24 hours before the experiment in WillCo dishes to reach 80–90% confluence. Standard conditions for incubation consisted in 15-minute incubation at 37°C, 5% CO2 in DMEM containing 1% bovine serum albumin (BSA), 0.2 mg/ml calf thymus DNA, and 0.2 µM of dual-labeled probe in a total volume of 500 µl. After incubation, cells were washed three times with PBS, fresh serum-containing medium was added and the sample was imaged by confocal microscopy. Cellular uptake of free Dox and c2C-Dox conjugate was assessed through confocal imaging evaluation both on MIA PaCa-2 cells and NIH-3T3 cells. In brief, the cells were seeded 24 hours before experiment in WillCo dishes to reach 80–90% confluence. Then, the cells were incubated with a 1% serum-containing medium with either free Dox or c2C-Dox (1.5 µmol/l Dox concentration) for 2 hours at 37 °C. After incubation, cells were washed three times with PBS, then fresh 1% serum-containing medium was added, and the sample was imaged by confocal microscopy either immediately (i.e., after 2 hours of incubation) or after additional 22 hours of incubation with drug-free culture medium (i.e., after 24 hours). Dox fluorescence in living cells was detected by confocal microscopy using 488 nm as excitation wavelength. All experiments were performed in triplicate. WST-8 cell viability assay. Cytotoxicity of free Dox and aptamer–Dox complexes was evaluated by using a tetrazolium salt, 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2Htetrazolium, monosodium salt (WST-8) assay. MIA PaCA-2 cells, HeLa cells, and NIH-3T3 cells (1 × 104 cells per well) were seeded in 96-well plates. After culture for 24 hours, the cells were incubated with a 1% serum-containing medium with either free Dox or oligo-Dox conjugates for 2 hours. After 2 hours incubation, cells were washed twice with PBS and then fresh 1% serum-containing medium was added. After 24 hours from the treatment the medium was removed and cells were incubated with WST-8 reagent (10 µl) and 1% serum-containing medium (90 µl) for 3 hours. Dose–response curves for MIA PaCa-2, HeLa, and NIH 3T3 were obtained using increasing drug concentrations (1.5, 2.5, 3.5, 4.5, and 5.5 µmol/l as Dox concentration and 0.20, 0.33, 0.46, 0.6, 0.73 µmol/l as oligo concentration). The unconjugated aptamer cytotoxicity (c2C) was evaluated treating the cells with the higher aptamer concentration (0.73 µmol/l) employed in dose–response curve experiments. Absorbance (450 nm) was measured using a microplate reader (Infinite F50, Tecan, Männedorf, Switzerland). The percentage of cell viability was determined by comparing drug-treated cells with the untreated cells (100% viability). Data represent the average of three or more independent experiments. Error bars represent the SD from three or more independent experiments. Statistical analysis. Data obtained from cell viability assay were statistically analyzed using one-way ANOVA followed by Tukey's HSD test for multiple comparison analysis. Data are expressed as mean with 95% confidence intervals for all groups. P-values <0.05 were considered statistically significant. Statistical analyses and graphs were assembled using GraphPad PRISM (version 6, GraphPad software for Science, San Diego, CA). Apoptosis assay. Apoptosis evaluation was performed as described in what follows, using Alexa Fluor 488 annexin V/Dead Cell Apoptosis Kit (Life Technologies, Carlsbad, CA). Cells were seeded (2 × 105 cells per well) in Willco dishes. After culture for 24 hours, the cells were incubated with 1% serum-containing medium supplemented with either c2C–Dox conjugate (1.5 µmol/l Dox concentration) or free c2C (0.2 µmol/l aptamer concentration) as negative control for 24 hours. The subsequent procedures were performed in accordance with the manufacturer's protocol. Confocal microscopy was used to monitor qualitatively the cellular staining using a dual filter set for Alexa Fluor 488 and propidium iodide and a 40 × 1.5 NA oil immersion objective. Qualitative apoptosis evaluation was determined by comparing drug-treated cells with the untreated cells. The experiment was performed in duplicate with the acquisition of an elevated number of random regions of interest for each experiment. pH- and nuclease-dependent drug controlled release. Dox release in cuvette was studied as follows: the c2C–Dox conjugate (1.5 µmol/l Dox concentration) was incubated into binding buffer solution (PBS containing 1 mmol/l MgCl2) with different pH values: 7.4, 6.5, 5.8, 5.5, or 5.0. pH values were adjusted by the addiction of different aliquots of HCl 1M to each sample. The samples were placed in a quartz cuvette, and Dox fluorescence was monitored in real time spectrophotometrically. The acquisition for each sample was completed when fluorescence intensity became stable. In order to mimic lysosomal environment, 2 μl of DNase I (2,000 units/ml; New England Biolabs, Ipswich, MA) were added to the c2C-Dox sample at pH 5.0, and the sample was incubated at room temperature. During this incubation, Dox fluorescence was recorded at regular time intervals (10–15 measurements/hour). Fluorescence of free Dox samples was measured for each pH value, and measured fluorescence changes were used to normalize signals detected for the c2C–Dox samples. Percentage of Dox released was calculated by comparing fluorescent signals of free Dox at pH 7.4 (100%) with the signals of the c2C–Dox samples. Data represent the average of two or more independent experiments. Error bars represent the SD from two or more independent experiments. Synthesis of the NF-κB decoy–antitail conjugate. The amino residues at 3′-end of the NF-κB decoy were conjugated to the dithio-bis(succinimidyl propionate) using the following protocol: 10 nmol of decoy were dissolved in sodium bicarbonate buffer 0.15 mol/l at pH 8.5 and mixed with 40-fold molar excess (400 nmol, in 20 ml of DMSO) of dithio-bis(succinimidyl propionate) in a final volume of 200 μl. The reaction mixture was stirred overnight at 4 °C. Analytical evaluation of the chemical conjugation reaction was performed at 25 °C using RP-HPLC analysis. The derivatized decoy was purified from unreacted dithio-bis(succinimidyl propionate) by dialysis using dialysis membrane (MWCO 1000) (Spectrum Laboratories, Rancho Dominguez, CA), concentrated using centrifugal filter units (3 K MWCO) and quantified by UV–VIS analysis. Next, a two-step reaction was performed to conjugate the carboxyl residue of the linker on derivatized decoy with the amino group at 5′-end of the antitail. Carboxyl group was activated with EDC (1000-fold molar excess) and Sulfo-NHS (10-fold molar excess) in PBS buffer for 20 minutes. Then, 5′-amino-antitail (threefold molar excess) was added, and the reaction mixture was stirred 6 hours at room temperature in PBS buffer containing triethylamine 1 mmol/l at pH 7.8. Purification of the decoy–antitail conjugate was performed with an IE-HPLC on a DNA Pac PA200 4 × 250 mm (Thermo Scientific) at 1.0 ml/min, using Tris–HCl 20 mmol/l pH 9.5, ACN 10% (Eluent A), and NaClO4 400 mmol/l, Tris–HCl 20 mmol/l pH 9.5, ACN 10% (Eluent B) as mobile phase at 25 °C. Absorbance was measured between 200 and 650 nm. The desired product was separated by means of IE-HPLC from the excess of the antitail and collected. The collected fraction was then dialyzed using dialysis membrane (MWCO 1000), concentrated using centrifugal filter units (3 K MWCO), and quantified by UV–VIS analysis. Finally, an aliquot was analyzed in IE-HPLC to check the purity of desired product. Detection of NF-κB by immunofluorescence staining of p65. Immunofluorescence staining on MIA PaCA-2 cells using an antibody against p65 subunit of NF-κB was performed as follows: rabbit polyclonal anti-NF-κB p65 (phospho S536, Abcam, Cambridge, UK) was used as primary antibody and the Alexa Fluor 647-donkey antirabbit IgG (H+L) antibody (Life Technologies, Carlsbad, CA) as secondary antibody. Cells were seeded (2 × 105 cells per well) in Willco dishes. After culture for 24 hours, cells were incubated with 1% serum-containing medium supplemented with c2C–d conjugate or with c2C alone (0.2 µmol/l ODN concentration) as negative control for 24 hours. After this incubation, cells were treated with TNF-α (20 ng/ml) for 1 hour. In order to assess Dox effect on NF-κB nuclear translocation in the presence and the absence of the decoy, the cells were coincubated with Dox (1.5 µmol/l) either c2C-d or c2C alone as negative control for 24 hours. Then, the cells were fixed with 4% paraformaldehyde and 4% sucrose in PBS (15 minutes, room temperature) and subsequently permeabilized with 0.25% triton X-100 (6–8 minutes, room temperature). After fixation and permeabilization treatment, the cells were incubated with a PBS solution containing 1% BSA as blocking agent (30 minutes, room temperature) before incubation with the primary antibody diluted 1 : 100 in 0.5% BSA/PBS (1 hour, room temperature). Next, the cells were washed three times with PBS and incubated with the secondary antibody diluted 1 : 150 in 0.5% BSA/PBS (45 minutes, dark, room temperature). Finally, the cells were mounted using Vectashield Mounting Medium with 4',6-diamidino-2-phenylindole (DAPI) (Vector Labs Burlingame, CA). Confocal microscopy was used to evaluate the cellular localization of NF-κB. The experiment was performed in duplicate with the acquisition of an elevated number of random regions of interest for each experiment. Western blot analysis. MIA PaCa-2 cells were seeded (7 × 105 cells per well) in a six-well plate. After 24 hours, cells were incubated with 1% serum-containing medium supplemented with either free Dox or c2C-d–Dox or with c2C alone (1.5 and 0.2 µmol/l as Dox and ODN concentration, respectively) for PARP detection for 2 hours. Alternatively cells were treated with either c2C-d–Dox or c2C–Dox at the same conditions described above for XIAP detection. After 2 hours incubation, cells were washed twice with PBS then fresh 1% serum-containing medium was added. After 24 hours from the treatment the medium was removed and cells were washed in ice-cold PBS and lysed in RIPA buffer supplemented with proteases and phosphatases inhibitors (Roche, Basel, Switzerland). After clarification, each postnuclear supernatant was quantified for protein content by Bradford assay (Thermo Scientific, Waltham, MA), and 30 µg of each protein extract were resolved on 4–12% Criterion XT Bis–Tris gradient gel (Bio Rad, Hercules, CA). Proteins were electrotransferred to polyvinylidene difluoride membranes (Bio Rad). These were washed and blocked in TBST + 5% w/v either nonfat dry milk (recommended for PARP) or BSA (recommended for XIAP). The membranes were then incubated with either rabbit monoclonal antibody to PARP (1 : 1000 diluted, 9542, Cell Signaling Technology) or rabbit monoclonal antibody to XIAP (1 : 1000 diluted, 9770, Cell Signaling Technology) in blocking solution for 2 hours at room temperature. Immunodetection was performed using antirabbit horseradish peroxidase-linked secondary antibody (1 : 2,000 diluted, Cell Signaling Technology, Danvers, MA). Filters were developed using Clarity Western ECL substrate (Biorad) and chemoluminescence signals detected by Image Quant LAS4000 (GE healthcare, Milan, Italy). The same membranes were also stripped and blotted against a rabbit monoclonal antibody to α-Tubulin (1 : 2000, clone B-512, Sigma) as loading control. Obtained images were subjected to linear contrast enhancement after image analysis. Figure S1 Fluorescence spectra of Dox solution (1.5 μM) incubated with: buffer, antitail, c2min, and c2C; Dox fluorescence in the conjugated (c2C–Dox) molecule is quenched because of its intercalation in DNA duplex. Figure S2 Cell apoptosis assay. MIA PaCA-2 cells were incubated with Apt–Dox conjugate (1.5 μM Dox concentration) or aptamer alone (0.2 μM aptamer concentration) for 24 hours. Scale bars: 10 μm. Figure S3 Synthesis of NF-κB decoy–antitail conjugate. On the top is depicted the secondary structure prediction of NF-κB. The yellow box highlights the consensus region recognized and bound by NF-κB. The first reaction is the conjugation of the DSP linker to the amino residues at 5′-end of the NF-κB decoy. Next, a two-step process affords the chemical conjugate between carboxyl residue of the linker on derivatized decoy and the amino group at 5′-end of the antitail. Purified conjugate was hybridized with the extended sequence of RNA aptamer to generate the Apt–decoy chimera (bottom) represented on the basis of its helicity. Figure S4 HPLC traces of conjugation crude reaction mixture. Figure S5 Dox quenching after intercalation with c2C, c2C–d, and decoy alone. Table S1 Doxorubicin release from aptamer in serum-containing media.
Table 1

pH- and nuclease-triggered Dox release

  45 in total

1.  Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.

Authors:  C Tuerk; L Gold
Journal:  Science       Date:  1990-08-03       Impact factor: 47.728

2.  NUPACK: Analysis and design of nucleic acid systems.

Authors:  Joseph N Zadeh; Conrad D Steenberg; Justin S Bois; Brian R Wolfe; Marshall B Pierce; Asif R Khan; Robert M Dirks; Niles A Pierce
Journal:  J Comput Chem       Date:  2011-01-15       Impact factor: 3.376

Review 3.  Nuclear factor-kappaB inhibitors as sensitizers to anticancer drugs.

Authors:  Chikashi Nakanishi; Masakazu Toi
Journal:  Nat Rev Cancer       Date:  2005-04       Impact factor: 60.716

4.  Preferential binding of daunomycin to 5'ATCG and 5'ATGC sequences revealed by footprinting titration experiments.

Authors:  J B Chaires; J E Herrera; M J Waring
Journal:  Biochemistry       Date:  1990-07-03       Impact factor: 3.162

5.  A double-strand decoy DNA oligomer for NF-kappaB inhibits TNFalpha-induced ICAM-1 expression in sinusoidal endothelial cells.

Authors:  Tomoyoshi Shibuya; Yoshiyuki Takei; Miyoko Hirose; Kenichi Ikejima; Nobuyuki Enomoto; Atsushi Maruyama; Nobuhiro Sato
Journal:  Biochem Biophys Res Commun       Date:  2002-10-18       Impact factor: 3.575

6.  Expression of the IAP protein family is dysregulated in pancreatic cancer cells and is important for resistance to chemotherapy.

Authors:  Rita Bayer Lopes; Rathi Gangeswaran; Iain A McNeish; Yaohe Wang; Nick R Lemoine
Journal:  Int J Cancer       Date:  2007-06-01       Impact factor: 7.396

7.  Target-molecule-triggered rupture of aptamer-encapsulated polyelectrolyte microcapsules.

Authors:  Xueru Zhang; Denise Chabot; Yasir Sultan; Carlos Monreal; Maria C DeRosa
Journal:  ACS Appl Mater Interfaces       Date:  2013-06-11       Impact factor: 9.229

8.  Building a multifunctional aptamer-based DNA nanoassembly for targeted cancer therapy.

Authors:  Cuichen Wu; Da Han; Tao Chen; Lu Peng; Guizhi Zhu; Mingxu You; Liping Qiu; Kwame Sefah; Xiaobing Zhang; Weihong Tan
Journal:  J Am Chem Soc       Date:  2013-11-25       Impact factor: 15.419

9.  A Comparison of B16 Melanoma Cells and 3T3 Fibroblasts Concerning Cell Viability and ROS Production in the Presence of Melatonin, Tested Over a Wide Range of Concentrations.

Authors:  Maria Angeles Bonmati-Carrion; Nuria Alvarez-Sánchez; Rüdiger Hardeland; Juan Antonio Madrid; Maria Angeles Rol
Journal:  Int J Mol Sci       Date:  2013-02-14       Impact factor: 5.923

10.  Dimeric DNA Aptamer Complexes for High-capacity-targeted Drug Delivery Using pH-sensitive Covalent Linkages.

Authors:  Olcay Boyacioglu; Christopher H Stuart; George Kulik; William H Gmeiner
Journal:  Mol Ther Nucleic Acids       Date:  2013-07-16       Impact factor: 10.183

View more
  22 in total

1.  Self-Assembled Aptamer-Nanomedicine for Targeted Chemotherapy and Gene Therapy.

Authors:  Nianxi Zhao; Zihua Zeng; Youli Zu
Journal:  Small       Date:  2017-12-04       Impact factor: 13.281

Review 2.  Ligand-targeted theranostic nanomedicines against cancer.

Authors:  Virginia J Yao; Sara D'Angelo; Kimberly S Butler; Christophe Theron; Tracey L Smith; Serena Marchiò; Juri G Gelovani; Richard L Sidman; Andrey S Dobroff; C Jeffrey Brinker; Andrew R M Bradbury; Wadih Arap; Renata Pasqualini
Journal:  J Control Release       Date:  2016-01-06       Impact factor: 9.776

Review 3.  Aptamers as Modular Components of Therapeutic Nucleic Acid Nanotechnology.

Authors:  Martin Panigaj; M Brittany Johnson; Weina Ke; Jessica McMillan; Ekaterina A Goncharova; Morgan Chandler; Kirill A Afonin
Journal:  ACS Nano       Date:  2019-11-05       Impact factor: 15.881

Review 4.  Aptamers: A promising chemical antibody for cancer therapy.

Authors:  Gang Zhou; George Wilson; Lionel Hebbard; Wei Duan; Christopher Liddle; Jacob George; Liang Qiao
Journal:  Oncotarget       Date:  2016-03-22

Review 5.  Aptamer-Mediated Targeted Delivery of Therapeutics: An Update.

Authors:  Silvia Catuogno; Carla L Esposito; Vittorio de Franciscis
Journal:  Pharmaceuticals (Basel)       Date:  2016-11-03

Review 6.  Toward the Selection of Cell Targeting Aptamers with Extended Biological Functionalities to Facilitate Endosomal Escape of Cargoes.

Authors:  Kwaku D Tawiah; David Porciani; Donald H Burke
Journal:  Biomedicines       Date:  2017-08-24

Review 7.  Current Advances in Aptamers for Cancer Diagnosis and Therapy.

Authors:  Shin-Ichiro Hori; Alberto Herrera; John J Rossi; Jiehua Zhou
Journal:  Cancers (Basel)       Date:  2018-01-03       Impact factor: 6.639

Review 8.  EpCAM Immunotherapy versus Specific Targeted Delivery of Drugs.

Authors:  Joanna Macdonald; Justin Henri; Kislay Roy; Emma Hays; Michelle Bauer; Rakesh Naduvile Veedu; Normand Pouliot; Sarah Shigdar
Journal:  Cancers (Basel)       Date:  2018-01-12       Impact factor: 6.639

9.  ssDNA Aptamer Specifically Targets and Selectively Delivers Cytotoxic Drug Doxorubicin to HepG2 Cells.

Authors:  Ge Yu; Huan Li; Shuanghui Yang; Jianguo Wen; Junqi Niu; Youli Zu
Journal:  PLoS One       Date:  2016-01-25       Impact factor: 3.240

Review 10.  Aptamer-Based Therapeutic Approaches to Target Cancer Stem Cells.

Authors:  Gang Zhou; Olivier Latchoumanin; Mary Bagdesar; Lionel Hebbard; Wei Duan; Christopher Liddle; Jacob George; Liang Qiao
Journal:  Theranostics       Date:  2017-09-13       Impact factor: 11.556

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.