Erin M Kollitz1, Guozhu Zhang2, Mary Beth Hawkins3, G Kerr Whitfield4, David M Reif5, Seth W Kullman6. 1. Program in Environmental and Molecular Toxicology, Department of Biological Sciences, North Carolina State University, Raleigh, North Carolina, United States of America. 2. Bioinformatics Research Center, North Carolina State University, Raleigh, North Carolina, United States of America. 3. Department of Biological Sciences, North Carolina State University, Raleigh, North Carolina, United States of America. 4. Department of Basic Medical Sciences, University of Arizona College of Medicine, Phoenix, Arizona, United States of America. 5. Bioinformatics Research Center, North Carolina State University, Raleigh, North Carolina, United States of America; Department of Biological Sciences, North Carolina State University, Raleigh, North Carolina, United States of America. 6. Program in Environmental and Molecular Toxicology, Department of Biological Sciences, North Carolina State University, Raleigh, North Carolina, United States of America; Department of Biological Sciences, North Carolina State University, Raleigh, North Carolina, United States of America.
Abstract
The vertebrate genome is a result of two rapid and successive rounds of whole genome duplication, referred to as 1R and 2R. Furthermore, teleost fish have undergone a third whole genome duplication (3R) specific to their lineage, resulting in the retention of multiple gene paralogs. The more recent 3R event in teleosts provides a unique opportunity to gain insight into how genes evolve through specific evolutionary processes. In this study we compare molecular activities of vitamin D receptors (VDR) from basal species that diverged at key points in vertebrate evolution in order to infer derived and ancestral VDR functions of teleost paralogs. Species include the sea lamprey (Petromyzon marinus), a 1R jawless fish; the little skate (Leucoraja erinacea), a cartilaginous fish that diverged after the 2R event; and the Senegal bichir (Polypterus senegalus), a primitive 2R ray-finned fish. Saturation binding assays and gel mobility shift assays demonstrate high affinity ligand binding and classic DNA binding characteristics of VDR has been conserved across vertebrate evolution. Concentration response curves in transient transfection assays reveal EC50 values in the low nanomolar range, however maximum transactivational efficacy varies significantly between receptor orthologs. Protein-protein interactions were investigated using co-transfection, mammalian 2-hybrid assays, and mutations of coregulator activation domains. We then combined these results with our previous study of VDR paralogs from 3R teleosts into a bioinformatics analysis. Our results suggest that 1, 25D3 acts as a partial agonist in basal species. Furthermore, our bioinformatics analysis suggests that functional differences between VDR orthologs and paralogs are influenced by differential protein interactions with essential coregulator proteins. We speculate that we may be observing a change in the pharmacodynamics relationship between VDR and 1, 25D3 throughout vertebrate evolution that may have been driven by changes in protein-protein interactions between VDR and essential coregulators.
The vertebrate genome is a result of two rapid and successive rounds of whole genome duplication, referred to as 1R and 2R. Furthermore, teleost fish have undergone a third whole genome duplication (3R) specific to their lineage, resulting in the retention of multiple gene paralogs. The more recent 3R event in teleosts provides a unique opportunity to gain insight into how genes evolve through specific evolutionary processes. In this study we compare molecular activities of vitamin D receptors (VDR) from basal species that diverged at key points in vertebrate evolution in order to infer derived and ancestral VDR functions of teleost paralogs. Species include the sea lamprey (Petromyzon marinus), a 1R jawless fish; the little skate (Leucoraja erinacea), a cartilaginous fish that diverged after the 2R event; and the Senegal bichir (Polypterus senegalus), a primitive 2R ray-finned fish. Saturation binding assays and gel mobility shift assays demonstrate high affinity ligand binding and classic DNA binding characteristics of VDR has been conserved across vertebrate evolution. Concentration response curves in transient transfection assays reveal EC50 values in the low nanomolar range, however maximum transactivational efficacy varies significantly between receptor orthologs. Protein-protein interactions were investigated using co-transfection, mammalian 2-hybrid assays, and mutations of coregulator activation domains. We then combined these results with our previous study of VDR paralogs from 3R teleosts into a bioinformatics analysis. Our results suggest that 1, 25D3 acts as a partial agonist in basal species. Furthermore, our bioinformatics analysis suggests that functional differences between VDR orthologs and paralogs are influenced by differential protein interactions with essential coregulator proteins. We speculate that we may be observing a change in the pharmacodynamics relationship between VDR and 1, 25D3 throughout vertebrate evolution that may have been driven by changes in protein-protein interactions between VDR and essential coregulators.
The ray-finned fishes (class: Actinopterygii) are the largest, most successful, and most diverse group of vertebrates [1]. Of the roughly 28,000 species in this class, fewer than 60 are not teleost fish. These few species comprise the four basal Actinopterygiian lineages of Polypteriformes, Acipenseriformes, Lepisosteiformes, and Amiiformes. These lineages are collectively referred to as “ancient fish” as they are considered to be living fossils. This is due to their morphology having remained unchanged over long periods of time and their lineages being relatively species poor [1, 2]. In contrast to their more ancient cousins, teleost fish display a far greater degree of morphologic variation and species diversity. It is likely that this diversity is a result of serial whole genome duplication (WGD) events that occurred early in their lineage. The serial “2R” genome duplication hypothesis suggests that the vertebrate genome is a result of two rapid and successive rounds of genome duplication (referred to as 1R and 2R) near the divergence of jawless and jawed vertebrates, approximately 500 million years ago [3]. Within ray-finned fishes, a third (3R) WGD occurred in the stem lineage of the teleostean fishes [2, 4]. WGDs are proposed to be a considerable force in vertebrate evolution by providing a source of raw genetic material for evolutionary forces to act upon, resulting in the functional divergence of new genes with novel functions [5]. The evolution and divergence of duplicate genes may result in larger gene families and permit more complex interactions and gene networks to evolve, leading to increased morphological complexity, adaptability, and speciation [5, 6]. This is consistent with the notion that larger genomes facilitate functional diversification and enable complex gene interactions. These processes in turn may facilitate morphological variation and physiological plasticity [7].Duplicate genes have several possible fates. The classic model predicts that one copy is usually lost, due to functional redundancy and accumulated mutations as a result of relaxed selection. However, occasionally one copy will obtain a beneficial mutation that confers a novel function while the other copy maintains the original function, referred to as neofunctionalization [8]. A model hypothesized by Force et al, predicts that instead of one copy being lost, both copies undergo subfunctionalization [9]. Under this model, each copy may obtain complementary yet degenerative mutations, resulting in the partitioning of the ancestral function between the two copies, and the preservation of both copies to maintain the original function.One class of regulatory genes that have demonstrated preferential retention post-WGD is the nuclear receptor superfamily [10-12]. Nuclear receptors (NRs) are ligand-activated transcription factors that regulate a diverse array of functions in metazoans; including metabolism, homeostasis, reproduction, embryonic development, and control of cellular proliferation and differentiation [13, 14]. NRs regulate gene expression through binding to small, lipophilic signaling molecules, resulting in systematic control and expression or silencing of target genes [14]. Such control facilitates cellular responses to exogenous and endogenous signals through the coordination of complex transcriptional processes.Studies in teleost fish have identified orthologs for all mammalian NR subclasses, including those for steroid hormones receptors and orphan receptors [10–12, 15]. Furthermore, these studies have revealed that teleost fish maintain a larger complement of NRs than mammals. For example, 48 NRs have been identified in human [16], compared to 70 NRs identified in zebrafish (Danio rerio) [12], 71 NRs in the Japanese medaka (Oryzias latipes) [15], and 68 and 71 NRs in Takifugu rubripes and Tetraodon nigroviridis, two species of pufferfish [10, 11]. The greater number of NRs in teleosts is hypothesized to be due to global retention of NRs and other regulatory genes within the teleost genomes subsequent to the 3R event [5, 6, 17].As the teleost-specific 3R event is in evolutionary terms more recent, these organisms are attractive models for the study of gene evolution and functional divergence post-WGD [18]. Previous studies of teleost NR paralogs have found evidence of functional divergence in fundamental NR functions, including ligand binding [19, 20], receptor transactivation [21-23], and protein-protein interactions [24]. Specifically, our group has identified evidence of functional divergence between teleostvitamin D receptor (VDR, NR1I1) paralogs with regards to protein-protein interactions between VDR paralogs and essential coregulator proteins, receptor transactivation in response to 1, 25D3, and DNA binding affinities [24]. However, the lack of data on ancestral VDRs limited our ability to speculate on ancestral vs. derived functions of the VDRα and VDRβ paralogs.Prior to the identification of functional VDRs in aquatic vertebrates, the conventional theory speculated that the vitamin D endocrine system originated in terrestrial animals due to their complete dependency on dietary calcium [25]. However, studies suggest that the vitamin D endocrine system has an ancient origin. For example, functional VDRs have been cloned from the sea lamprey (Petromyzon marinus) [26], the little skate (Leucoraja erinacea) (this study) and numerous other fish [10, 11, 21, 27, 28]. Homology comparisons of vertebrate VDR protein sequences demonstrate that VDRs maintains a high degree of conservation across species, suggesting that the vitamin D endocrine axis may be highly conserved throughout vertebrate evolution [24, 26, 29]. Supporting this theory is the fact that many non-mammalian vertebrates maintain high concentrations of circulating vitamin D3, and enzymes necessary for vitamin D synthesis and transport have been identified in many species [30-32] (and further reviewed in [33, 34]). However, increasing evidence suggests that calcium homeostasis may not have been a critical function of ancestral VDR. The fact that aquatic vertebrates live in an environment that serves as an abundant calcium source, and functional VDRs have been identified in animals with and without calcified skeletons indicates that VDR may have evolved long before its role in hormonal control of calcium. Yet little is known regarding endocrine physiology of vitamin D in basal vertebrates.In order to elucidate the evolutionary history and ancestral molecular functions of VDR, we have isolated and characterized VDRs from key lineages of basal vertebrates that diverged early in vertebrate evolution. For this study we have included two basal cartilaginous vertebrates: the sea lamprey (Petromyzon marinus), a 1R jawless fish (Agnatha) that is considered to be one of the most basal extant vertebrates [35], and the little skate (Leucoraja erinacea), a member of the class Chondrichthyes, which was the first lineage to diverge after the 2R duplication [36]. We have additionally included the Senegal bichir (Polypterus senegalus), a primitive ray-finned fish that diverged before the teleost 3R duplication, and thus maintains a single VDR ortholog [36, 37]. We hypothesize that comparison of VDR function across the deep ancestry of Agnatha, Chondrichthyes and basal Actinopterygii will help facilitate a conceptual framework of mechanisms underlying nuclear receptor innovation and comparative endocrine physiology.
Materials and Methods
DNA constructs
Little Skate VDR
Embryonic cDNA and an expressed sequence tag (EST) representing a complete open reading frame (ORF) of the VDR nucleic acid sequence from the little skate (Leucoraja erinacea) were gifts from Dr. Randall Dahn at Mount Desert Island Biological Laboratory (MDIBL, Salisbury Cove, ME). The skateVDR cDNA sequence was amplified using a nested PCR protocol. All PCR primers were designed using Primer3 software (S1 Table) [38]. The initial 50 μL PCR reaction included 1 μL skate embryonic cDNA, 1 μL each of forward and reverse outer primers (10 μM), 1 μL 50x dNTPs, 1 μL 50x Advantage Taq (Clontech Laboratories, Mountain View, CA), 5 μL 10x Advantage Taq buffer, and 41 μL PCR-grade water. The reaction was initially heated at 95°C for 2 minutes, followed by 40 cycles of 95°C for 30 seconds, 55.1°C for 30 seconds, 72°C for 1.5 minutes, and a final step of 72°C for 15 minutes. A single PCR product was excised from a 1.5% agarose gel and purified. An aliquot (1 μL) of the purified product was used as the DNA template for the second PCR reaction with the internal primer sets. The second reaction used identical thermocycle settings, however the annealing temperature was modified to match each internal primer set (59ºC for both pSG5 and pVP16, 63ºC for pET32a). PCR products were gel-purified and ligated into the pGEM-T easy vector (Promega Corporation, Madison, WI) according to the manufacturer’s recommendations. The GC10 strain of Escherichia coli bacteria (Genesee Scientific, San Diego, CA) were transformed with 50 ng of the ligation product, and positive clones were identified via a blue/white screen. A single colony was used to inoculate 3 mL LB/amp, and grown overnight at 37°C with shaking at 200 rpm. Plasmid DNA was isolated from the 3 mL cultures using the QIAGEN Hi-Speed miniprep kit (QIAGEN, Valencia, CA), and plasmids were sequenced to confirm gene identity and construct orientation. Full-length cDNA for skateVDR was further subcloned into the pSG5, pVP16, and pET32a vectors via restriction digest using incorporated restriction sites (see S1 Table), gel purified, and ligated into target vectors using T4 DNA ligase (Promega). All constructs were restriction mapped and sequenced to ensure identification, integrity, and orientation of each VDR within each expression vector. All constructs consist of the complete VDR ORF including internal start and stop codons, with the exception of pET32a. In this construct the internal stop codon was removed for inclusion of the 3’ polyhistidine-tag. The sequence data for skateVDR has been submitted to GenBank under the accession number KJ925051.
Senegal Bichir VDR
Senegal bichir (Polypterus senegalus) liver tissue was a provided by Dr. Kenneth Poss and Dr. Randall Dahn at MDIBL. This study was carried out in strict accordance with the recommendations in the National Academy of Sciences Guide for the Care and Use of Laboratory Animals. The protocol was approved by the Mount Desert Island Biological Laboratory Institutional Animal Care and Use Committee (Protocol Number: 10–12). Bichir were euthanized with tricaine methanesulfonate (300mg/L) in Phosphate Buffered Saline (PBS) (pH 7.0). All efforts were made to minimize suffering.Liver tissue was homogenized in 1 mL of RNA Bee (Tele Test Inc, Friendswood, TX) using a Bullet Blender (Next Advance, Averill Park, NY). Following homogenization, total RNA was isolated following the manufacturer’s protocol. RNA quantity and 260/280 ratios were determined using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). First strand cDNA was synthesized using 2 μg total RNA and the High Capacity cDNA Reverse Transcription Kit (Life Technologies, Grand Island, NY) following the manufacturer’s instructions. PCR primers were designed using Primer3 [38] (S1 Table), and were based on an identified EST from the Polypterus senegalus sequence project headed by Dr. Ben King at MDIBL. Bichir VDR was amplified using Advantage Taq as described above, and each 50 μL reaction included 1 μL bichir cDNA, 1 μL each of forward and reverse primers (10 μM), 1 μL 50x dNTPs, 1 μL 50x Advantage Taq, 5 μL 10x Advantage Taq Buffer, and 41 μL PCR-grade water. Reactions were initially heated at 95°C for 2 minutes, followed by 30 cycles of 95°C for 30 seconds, 61.4°C for 30 seconds, 72°C for 2 minutes, and a final step of 72°C for 15 minutes. PCR products were resolved and excised from a 1.5% agarose gel, purified, and ligated into the pGEM-T Easy vector according to the manufacturer’s recommendations. The pGEM-bichir VDR construct was transformed into GC10 bacteria and purified as described above. Bichir VDR was further subcloned into pSG5, pVP16, and pET32a as described above. All constructs were restriction mapped and sequenced to ensure identification, integrity, and orientation of each VDR within each expression vector. The sequence data for bichir VDR has been submitted to GenBank under the accession number KJ925050.
Lamprey and Human VDR, Luciferase Reporters, and Coregulator Constructs
The pSG5-Lamprey VDR construct was a gift from Dr. Kerr Whitfield (University of Arizona, Phoenix, AZ). The pSG5-HumanVDR construct was a gift from Dr. John Moore (GlaxoSmithKline, Research Triangle Park, NC). Full-length lamprey VDR and humanVDR were further subcloned into the pVP16 and pET32a vectors as described above. All human coregulator transient transactivation and mammalian 2-hybrid constructs were a gift from Dr. Donald McDonnell (Duke University, Durham, NC). The XREM luciferase reporter, 5XGal4-TATA-Luc mammalian 2-hybrid luciferase reporter, and the pRL-CMV internal luciferase control were obtained as described previously [21, 24].
Homology and Phylogeny
Vertebrate VDR sequences were obtained through BLAST analysis of the National Center for Biotechnology Information (NCBI; Bethesda, MD; www.ncbi.nih.gov/). Predicted full-length VDR amino acid sequences were identified, and aligned using ClustalW [39] via the SDSC Biology Workbench (URL: http://workbench.sdsc.edu). For the amino acid sequence alignment, VDR functional domains as well as key features of each domain were determined based on previous studies [40-42].Phylogenetic analyses were conducted using MEGA 5.0 [43] and the maximum likelihood method based on the JTT model [44]. Trees were bootstrapped to assess robustness (500 pseudosamples). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test is shown next to the branches. The tree is drawn to scale, with branch length measured in the number of substitutions per site. The GenBank accession numbers for each VDR sequence can be found in S2 Table.
Transient Transactivation Assays
To analyze transactivational activity of lamprey, skate, bichir, and human VDRs, full length VDR constructs were tested in transient transactivation assays with 1α, 25-dihydroxyvitamin D3 (1, 25D3, EMD Millipore, Billerica, MA) as the primary ligand. The assay protocol has been described in detail previously [24]. Briefly, HepG2 cells (ATCC #HB-8065) were seeded in 96-well plates (2.5 x 104 cells/well) and transfected the following day using Lipofectamine 2000 (Life Technologies, Carlsbad, CA). Each well was transfected with 89.7 ng pSG5-VDR, 19.2 ng XREM-Luc reporter, and 4.5 ng pRL-CMV as an internal luciferase control. Coregulator studies included 18.3 ng of an expression vector containing the complete ORF of the human coregulator of interest (pCDNA-RXRWT or RXRAF2, and/or pSG5-SRC1, GRIP1, or pCDNA-ACTR). Media was replaced 24 hours post-transfection with complete MEM spiked with 120 nM 1, 25D3 for single dose assays, or 0–1200 nM 1, 25D3 for concentration—response curves. Twenty-four hours post-exposure, the cells were passively lysed and luciferase activity was measured using the Dual-Glo Luciferase Assay System (Promega Corporation, Madison, WI) following the manufacturer’s protocol. Raw XREM-luciferase readings were first normalized to the pRL-CMV internal luciferase control. Following the initial normalization step, concentration-response data was normalized to the ethanol control. To enable a comparison of the presence and absence of coregulators on VDR transactivation, VDR response in the presence of coregulators was normalized to VDR response in the absence of any coregulators. Single-dose assays were analyzed using one-way ANOVAs followed by Tukey’s HSD post hoc test. Linear regression analysis using a sigmoidal dose-response calculation with variable slope was used to analyze concentration-response curves and determine median effective concentration (EC50), 95% confidence interval (95% CI), and the maximal efficacy (EMAX). All statistics were conducted in GraphPad Prism 4 (GraphPad Software, San Diego, CA). Experiments were repeated at least twice, and performed in replicates of four wells.
Mammalian 2-Hybrid Assays
Protein-protein interactions between VDR and coregulator proteins were assessed using a mammalian 2-hybrid system (Clontech, Mountain View, CA), and has been described in detail previously [24]. Briefly, 96-well plates seeded with HepG2 cells were transfected with 33.6 ng pVP16-VDR as prey and 33.6 ng pM-coregulator as bait. The pM-coregulator is a fusion protein containing the yeastGal4 DNA-binding domain fused to either full-length human RXR (pM-RXRWT or pM-RXRAF2) or the defined NR box of the humanSRC/p160 coactivators [45]: pM-SRC1241-386, pM-GRIP1479-767, or pM-ACTR392-1005. Each well additionally included 126.6 ng of the M2H luciferase reporter 5XGal4-TATA-Luc, which contains response elements for the yeastGal4 DNA-binding domain, and 3 ng pRL-CMV as an internal luciferase control. Media was replaced 24 hours post transfection with complete MEM spiked with 120 nM 1, 25D3. Cells were tested for luciferase activity 24 hours post-exposure using the Dual-Glo Luciferase Assay System described previously. Raw 5xGal4-TATA-Luc readings were first normalized to the internal pRL-CMV control. Following the initial normalization, VDR-coregulator interaction was normalized to VDR in the absence of a coregulator construct. Results were analyzed via one-way ANOVAs followed by Tukey’s HSD post hoc test in GraphPad Prism 4 (GraphPad Software, San Diego, CA). Experiments were repeated at least twice and performed in replicates of four wells.
Electrophoretic Mobility Shift Assays
Recombinant full-length VDR and RXRWT proteins were expressed in a bacterial expression system and purified using immobilized metal affinity chromatography as described previously [24]. In brief, bacteria cultures were grown at 37°C/200 rpm until the OD600 reached 0.6. Protein expression was induced by the addition of 1 mM isopropyl-1-thio-β-galactopyranoside along with 20 μM ZnCl2 to increase protein solubility. Cultures were incubated for an additional 3 hours at 25°C/200 rpm. Following incubation, cultures were pelleted by centrifugation at 4,000 x g for 20 minutes at 4ºC. The supernatant was discarded, and the pellets were stored at -20°C until protein purification. Polyhistidine-tagged recombinant VDR and RXRWT were purified under native kit conditions from the frozen pellet using the QIAexpress Ni-NTA Fast Start Kit (QIAGEN, Valencia, CA) according to the manufacturer’s protocol. Purified protein was quantified using a NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA), and visualized via western blot using mouse monoclonal antibodies to the polyhistidine tags (#34660, QIAGEN, Valencia, CA).DNA–protein binding reactions were performed as described previously [24]. Cy5-labeled and unlabeled oligos were purchased from Integrated DNA Technologies (Coralville, IA). The initial 20 μL binding reactions were composed of buffer (100 mM KCl, 10 mM HEPES, 1 mM EDTA, 0.1 mg/ml BSA, 4 μg/mL sonicated salmon sperm, 1.0 mM DTT, 1% glycerol, 20 mM MgCl2, pH 7.6), 100 ng recombinant VDR and 100 ng recombinant RXRWT (in select assays), and 100 nM 1, 25D3 or ethanol as a vehicle control. Initial reactions were incubated for 45 minutes at 25°C. Following this incubation, 1 pmol of a 5’Cy5-labeled double-stranded oligo representing either the consensus sequence for the canonical vitamin D response element (VDRE) [46] (5’—AGCTTCAGGTCAAGGAGGTCAGAGAGC—3’) or a VDRE containing the DR3 found within the distal promoter region of the humanCYP3A4-XREM reporter used in transient transfection studies (5’—GCTGAATGAACTTGCTGACCCTCTGCT—3’) [47] was added to each reaction. Competition reactions additionally included 100 pmol unlabeled wild-type XREM or canonical VDREs, or an unlabeled mutant form of the canonical sequence (5’—AGCTTCAGAGGAGGAGAGC—3’). Binding reactions were incubated for an additional 30 minutes at 25°C. Following incubation, 20 μL of each binding reaction was loaded into individual wells of a 6% native polyacrylamide gel, and resolved via nondenaturing gel electrophoresis for 90 minutes at 100 volts in 0.5x TBE buffer (45 mM Tris base, 45 mM boric acid, 1 mM EDTA, pH 8.0). Gels were visualized on a Storm 865 (GE Healthcare Life Sciences, Pittsburgh, PA). Negative controls include expressed affinity tags isolated from empty pET32a vector stocks, binding reactions run with either VDR or RXR individually, and ethanol as a vehicle control.
Saturation Binding Analysis
Transfected cell lysates were prepared for saturation binding assays from Cos7 cells (ATCC #CRL-1561) as described in detail previously [24]. Cos7 cells (3.0 x 106 cells per 150 mm culture dish) were transfected with 4 μg pSG5-VDR, 4 μg pSG5-RXRWT, and 16 μg of pBSII vector as carrier DNA, using Lipofectamine 2000. Media was replaced 24 hours post-transfection, and cells were harvested by trypsinization at 48 hours post-transfection. Trypsinized cells were washed twice in 2 mL ice-cold DPBS, and resuspended in 1 mL ice-cold KETZD + 5 buffer (0.15 M KCl, 1 mM EDTA, 10 mM Tris HCl, 0.3 mM ZnCl2, 200x dilution protease inhibitor cocktail (EMD Millipore, Billerica, MA), 5 mM DTT, pH 7.0). Resuspended cells were lysed by sonication (12 repetitions of 1-second bursts at 25% power), and centrifuged at 100,000 x g for 30 minutes at 4°C to pellet the cell debris. The supernatant containing the lysate was divided into aliquots and stored at -80°C.The affinity of basal and human VDRs for 1, 25D3 was assessed as described previously [24]. Briefly, the lysate was diluted 1/20 in ice-cold KETZD+5 buffer, and 200 μL was transferred to each labeled reaction tube. Radiolabeled 1, 25-(OH)2-26, 27-[3H]dimethyl-vitamin D3 ([3H]-1, 25D3, original specific activity 157 Ci/mmol, Perkin Elmer, Waltham, MA) was diluted to 20 Ci/mmol with unlabeled 1 μM 1, 25D3, and further diluted with ethanol to obtain the desired concentrations (0–1.6 nM). The appropriate concentration of [3H]-1, 25D3 (10 μL) was added to each reaction, shaken, and incubated overnight at 4°C. Unbound ligand was removed with the addition of 80 μL of a 0.5% dextran-2.5% charcoal suspension in GP Buffer (150 mM NaCl, 15 mM NaN3, 100 mM anhydrous Na2HPO4, 39 mM NaH2PO4•H2O, 0.1% gelatin, pH 7.6) incubated in an ice bath for 15 minutes with brief shaking every 5 minutes. Samples were centrifuged at 5000 x g for 5 minutes at 4°C to pellet the charcoal suspension, and 200 μL of the supernatant containing the bound ligand was removed for liquid scintillation counting. Total binding was determined using lysate transfected with both pSG5-VDR and pSG5-RXRWT, and nonspecific binding was determined by using lysate transfected with the empty pSG5 vector in place of pSG5-VDR. Specific binding was calculated by subtracting the nonspecific binding counts from the total binding counts. Hyperbolic one-site binding curves were fit using GraphPad Prism 4. The reported dissociation constant (Kd) for each species is the average ± SEM (n = 3 or 4). Variation between the average Kd values was tested via a one-way ANOVA followed by Tukey’s HSD post hoc test. All assays were repeated at least three times with duplicate tubes for each concentration.
Bioinformatic summary analysis
In order to put these functional data in a broader context, the mammalian 2-hybrid (M2H) and transient transactivation (TT) data for lamprey, bichir, skate, medaka (VDRα and VDRβ), zebrafish (VDRα and VDRβ) and humanVDR were integrated into a summary cluster analysis. The data for medaka and zebrafishVDRα and VDRβ are from our previous study [24]. The data for each assay were standardized as z-scores across all eight VDR species to account for interspecies differences in absolute assay readout. The entire data matrix, visualized as a two-color heatmap, was then subjected to unsupervised, hierarchical clustering using Manhattan distance and complete linkage. The Pickett Plot to the right of the heatmap indicates the presence/absence of co-regulators within each assay, as described earlier in Materials and Methods. Data were visualized using the R package Heatplus [48].Next, to identify particular functional assays that were drivers of both the overall cluster pattern and species subclusters, a bootstrap permutation was implemented using custom R code [49]. For each of 10,000 bootstrap samples of assays, we counted the number of times the overall cluster pattern and subclusters (Lamprey, Bichir), (Medaka β, Skate, Zebrafish β), and (Zebrafish α, Medaka α, Human) were recapitulated. Across all permutations, assays having a large effect on cluster membership (e.g. permuting AssayA significantly reduced the co-occurrence of species in ClusterC) were inferred to be important drivers of VDR functional similarity.
Results
Here we report cloning of full-length VDR cDNA for both the little skate and the Senegal bichir. SkateVDR cDNA is composed of 1305 base pairs, encoding a predicted protein of 435 amino acids and a molecular weight of 49.4 kDa. Bichir VDR cDNA is composed of 1266 base pairs, encoding a predicted protein of 422 amino acids and a molecular weight of 47.9 kDa. Lamprey and humanVDR have been cloned and described previously [26, 50]. Lamprey VDR is composed of 1221 base pairs that encode a predicted protein of 407 amino acids with a molecular weight of 46.0 kDa. HumanVDR is composed of 1284 base pairs that encode a predicted protein of 428 amino acids with a molecular weight of 48.3 kDa.Alignments of predicted amino acid sequences demonstrated a high degree of similarity among lamprey, skate, bichir, and humanVDR with other vertebrate VDRs (Tables 1–3 and Fig 1). The highest degree of similarity is found in the DNA binding domain (Table 1). The humanVDR DBD shared an 87%, 90%, and 93% similarity with the DBDs of lamprey, skate, and bichir VDRs, indicating a high degree of conservation across species. The LBD is less well conserved, and a 60%, 62%, and 68% similarity is shared between humanVDR and lamprey, skate, and bichir (Table 2). Full-length amino acid sequences of lamprey, skate, and bichir share a 62%, 66%, and 71% similarity with humanVDR (Table 3). The basal VDRs are fairly similar to both teleostVDR paralogs, and do not appear to be more closely related to one paralog over the other. Fig 1 depicts an amino acid sequence alignment of the four VDRs with the different functional domains and key features highlighted.
Table 1
Homology of vertebrate VDR DNA-binding domains (DBDs).
H
R
C
A
F
Mβ
Mα
ZFβ
ZFα
B
ES
S
L
L
87
87
87
87
87
89
92
90
90
89
87
87
100
S
90
90
90
90
90
90
92
92
93
93
96
100
ES
90
90
90
90
90
90
92
92
93
93
100
B
93
93
95
95
95
95
93
95
96
100
ZFα
92
92
92
92
92
95
96
96
100
ZFβ
92
92
92
92
92
96
96
100
Mα
92
92
92
92
92
95
100
Mβ
92
92
92
92
92
100
F
95
95
95
95
100
A
93
93
96
100
C
96
96
100
R
100
100
H
100
The numbers in the table correspond to percent sequence identity.
Amino acid sequence alignment of lamprey, skate, bichir, and human VDRs.
Functional domains and domain elements were determined based on previous work with human VDR discussed in the manuscript. Fully conserved residues are indicated by “*”. Partial conservation is indicated by “:” (strong) or “.” (weak). Lack of residue consensus is indicated by a blank space. The five functional domains are shaded as follows: The N-terminal A/B domain and the C-terminal F domain are shaded in olive green. The DNA binding domain (DBD) is shaded in orange. The CTE/hinge domain is shaded in purple, while the ligand binding domain (LBD) is shaded in blue. For the DBD, residues that make up the P-box and D-box are indicated with a solid black line, and helix 1 (the recognition helix) and helix 2 are highlighted in yellow. Conserved cysteine residues involved in zinc finger structure are both bold and blue. For the CTE/hinge domain, the T-box and A-box are indicated with solid black lines. For the LBD, the estimated α-helices are highlighted in yellow and identified with the letter H followed by the helix number. The three β-sheets are highlighted in bright green. Amino acid residues that serve as contacts for 1, 25D3 are bold and red. The K and E residues in H3 and H12 involved in the charge clamp formation bold, white, and highlighted in black. A red circle above a residue indicates that the residue plays a role in direct interaction with other VDR residues upon ligand binding.
Table 2
Homology of vertebrate VDR ligand-binding domains (LBDs).
H
R
C
A
F
Mβ
Mα
ZFβ
ZFα
B
ES
S
L
L
60
59
59
59
57
60
61
61
57
59
56
59
100
S
62
61
62
62
64
62
64
63
60
62
66
100
ES
62
63
62
64
60
65
64
65
61
62
100
B
68
67
71
70
66
73
75
72
74
100
ZFα
63
64
66
68
63
82
86
84
100
ZFβ
66
67
66
69
64
85
85
100
Mα
68
67
70
71
66
86
100
Mβ
67
64
68
69
63
100
F
68
68
73
79
100
A
74
73
83
100
C
72
74
100
R
86
100
H
100
The numbers in the table correspond to percent sequence identity.
Amino acid sequence alignment of lamprey, skate, bichir, and human VDRs.
Functional domains and domain elements were determined based on previous work with humanVDR discussed in the manuscript. Fully conserved residues are indicated by “*”. Partial conservation is indicated by “:” (strong) or “.” (weak). Lack of residue consensus is indicated by a blank space. The five functional domains are shaded as follows: The N-terminal A/B domain and the C-terminal F domain are shaded in olive green. The DNA binding domain (DBD) is shaded in orange. The CTE/hinge domain is shaded in purple, while the ligand binding domain (LBD) is shaded in blue. For the DBD, residues that make up the P-box and D-box are indicated with a solid black line, and helix 1 (the recognition helix) and helix 2 are highlighted in yellow. Conserved cysteine residues involved in zinc finger structure are both bold and blue. For the CTE/hinge domain, the T-box and A-box are indicated with solid black lines. For the LBD, the estimated α-helices are highlighted in yellow and identified with the letter H followed by the helix number. The three β-sheets are highlighted in bright green. Amino acid residues that serve as contacts for 1, 25D3 are bold and red. The K and E residues in H3 and H12 involved in the charge clamp formation bold, white, and highlighted in black. A red circle above a residue indicates that the residue plays a role in direct interaction with other VDR residues upon ligand binding.The numbers in the table correspond to percent sequence identity.Key: Lamprey (L), Skate (S), Elephant Shark (ES), Bichir (B), Zebrafish α (ZFα), Zebrafish β (ZFβ), Medaka α (Mα), Medaka β (Mβ), Frog (F), Alligator (A), Chicken (C), Rat (R), Human (H).The numbers in the table correspond to percent sequence identity.Key: Lamprey (L), Skate (S), Elephant Shark (ES), Bichir (B), Zebrafish α (ZFα), Zebrafish β (ZFβ), Medaka α (Mα), Medaka β (Mβ), Frog (F), Alligator (A), Chicken (C), Rat (R), Human (H).The numbers in the table correspond to percent sequence identity.Key: Lamprey (L), Skate (S), Elephant Shark (ES), Bichir (B), Zebrafish α (ZFα), Zebrafish β (ZFβ), Medaka α (Mα), Medaka β (Mβ), Frog (F), Alligator (A), Chicken (C), Rat (R), Human (H).Next, we conducted a phylogenetic analysis with full-length VDR sequences in order to compare phylogenetic relationships of the basal VDRs to additional VDRs throughout vertebrate evolution. VDR sequences include lamprey, skate and bichir, as well as medaka and zebrafishVDRα and VDRβ identified previously [24], and additional vertebrate VDR sequences identified in BLAST analysis. The organization of our tree is consistent with previously described hypothesis of vertebrate evolution (Fig 2) [1]. The species with calcified skeletons (Actinopterygii and Sarcopterygii) form a separate clade from the species with cartilaginous skeletons (Chondrichthyes and Agnatha). In addition, the Actinopterygii (ray-finned fish) and Sarcopterygii (lobe-finned fish, which includes tetrapods) formed two separate clades. Bichir VDR clustered with Actinopterygii, however both bichir and gar were excluded from the teleost cluster with a bootstrap probability of 80 and 98. VDRα and VDRβ form two separate subclusters within Actinopterygii, which is supported by bootstrap analysis (probability of 90) and is consistent with our previous report comparing the ligand-binding domains of teleostVDR paralogs and other tetrapods [21]. HumanVDR clustered with the Sarcopterygii species and is closest to the other mammalianVDR (rat). SkateVDR significantly clustered with the other Chondrichthyes species (bootstrap probability of 94), and this cluster is basal to all other 2R species, which is consistent with Chondrichthyes representing the most basal lineage of jawed vertebrates. In addition, the chondrichthian VDR clade diverged before the Actinopterygii/Sarcopterygii split, suggesting that VDRs from skate and elephant shark are ancestral to both clades. Lamprey VDR appears to be the most divergent VDR based on branch length and homology comparisons, indicative of a greater number of amino acid changes in comparison to the other VDRs.
Fig 2
Phylogenetic analysis of full-length VDR amino acid sequences in vertebrates.
Phylogenetic analysis was conducted in MEGA 5. This tree was estimated using the Maximum Likelihood method based on the JTT matrix-based model. The analysis was bootstrapped (500 pseudosamples) to assess robustness. The percentage of replicate trees in which the associated taxa cluster together in the bootstrap tests is illustrated at each node. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The locations of each WGD (1R, 2R, and 3R) in vertebrate evolution are indicated on the tree and by branch color: green for 1R, blue for 2R, and red for 3R. The GenBank accession numbers for each VDR can be found in S2 Table.
Phylogenetic analysis of full-length VDR amino acid sequences in vertebrates.
Phylogenetic analysis was conducted in MEGA 5. This tree was estimated using the Maximum Likelihood method based on the JTT matrix-based model. The analysis was bootstrapped (500 pseudosamples) to assess robustness. The percentage of replicate trees in which the associated taxa cluster together in the bootstrap tests is illustrated at each node. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The locations of each WGD (1R, 2R, and 3R) in vertebrate evolution are indicated on the tree and by branch color: green for 1R, blue for 2R, and red for 3R. The GenBank accession numbers for each VDR can be found in S2 Table.
Transactivation of the basal VDRs in response to increasing concentrations of 1, 25D
3
To analyze the differential transactivational activity of lamprey, skate, bichir, and human VDRs, full-length VDR constructs were tested in transient transactivation assays with increasing concentrations of 1, 25D3 (Fig 3). Observed EC50 values and 95% confidence intervals are as follows: 2.61 nM (1.42–4.79) for lamprey VDR, 7.93 nM (6.54–9.62 nM) for skateVDR, 98.92 nM (71.39–137.1 nM) for bichir VDR, and 5.38 nM (4.32–6.68 nM) for humanVDR. Lamprey, skate, and human were all within the low nM range previously reported for both teleostVDR paralogs and humanVDR [24, 29]. Conversely, EC50 value for bichir was much greater, at 98.9 nM. Significant variation was observed with the maximum efficacy (EMAX) values between VDRs (p < 0.0001, Fig 3). The EMAX for lamprey was low (2.7 ± 0.1-fold). Skate exhibited an EMAX of 24.6 ± 0.7-fold, whereas bichir and humanVDR exhibited similar EMAX values of 42.9 ± 2.2-fold and 51.3 ± 1.6-fold respectively.
Fig 3
Transactivation of lamprey, skate, bichir, and human VDR in response to 1, 25D3.
Concentration-response profiles are shown for lamprey VDR (red), skate VDR (orange), bichir VDR (green), and human VDR (blue). HepG2 cells were transiently transfected with full-length pSG5-VDR, the XREM-Luc reporter, and the pRL-CMV internal luciferase control as described previously in Materials and Methods. Cells were treated with 0–1200 nM 1, 25D3 in media for 24 hours. VDR response was measured via dual-luciferase assays. Data are represented as the mean fold activation normalized to the ethanol control ± SEM (n = 4). The half-maximal effective concentration (EC50), 95% confidence interval (95% CI), and maximum efficacy (EMAX) values for each VDR was determined using nonlinear regression analysis using a sigmoidal dose-response calculation with variable slope in Prism 4.
Transactivation of lamprey, skate, bichir, and human VDR in response to 1, 25D3.
Concentration-response profiles are shown for lamprey VDR (red), skateVDR (orange), bichir VDR (green), and humanVDR (blue). HepG2 cells were transiently transfected with full-length pSG5-VDR, the XREM-Luc reporter, and the pRL-CMV internal luciferase control as described previously in Materials and Methods. Cells were treated with 0–1200 nM 1, 25D3 in media for 24 hours. VDR response was measured via dual-luciferase assays. Data are represented as the mean fold activation normalized to the ethanol control ± SEM (n = 4). The half-maximal effective concentration (EC50), 95% confidence interval (95% CI), and maximum efficacy (EMAX) values for each VDR was determined using nonlinear regression analysis using a sigmoidal dose-response calculation with variable slope in Prism 4.
Ligand Binding Kinetics
The affinity of the basal VDRs and humanVDR was determined using saturation binding analysis with radiolabeled 1, 25D3 (Fig 4). Nonlinear regression analysis gave dissociation constant (Kd) values of 0.47 ± 0.07 nM for lamprey (n = 4), 0.73 ± 0.10 nM for skate (n = 3), 0.40 ± 0.06 nM for bichir (n = 4), and 0.50 ± 0.07 nM for humanVDR (n = 4). The Kd values obtained for each VDR were within the sub-nanomolar range previously reported for human and lamprey VDR, and teleostVDR paralogs [24, 26, 50]. No difference in binding affinities was detected between species (p>0.05), indicating a conservation of high affinity binding between VDR and 1, 25D3 across vertebrate evolution.
Fig 4
Saturation binding analysis of lamprey, skate, bichir, and human VDR to [3H]-1, 25D3.
Saturation binding profiles are shown for lamprey VDR (red), skate VDR (orange), bichir VDR (green), and human VDR (blue). Lysates were prepared from transfected Cos7 cells as described in Materials and Methods. Lysates were incubated with 0–1.6 nM [3H]-1, 25D3 for 18 hours at 4°C. Unbound ligand was removed as described. Specific binding values were calculated by subtracting the average non-specific binding counts from the total binding counts. Hyperbolic one-site binding curves were fit using Prism 4. The reported dissociation constant (Kd) in the manuscript for each VDR is the average of three or four separate experiments ± SEM. The graphs shown here are specific binding data from a representative experiment.
Saturation binding analysis of lamprey, skate, bichir, and human VDR to [3H]-1, 25D3.
Saturation binding profiles are shown for lamprey VDR (red), skateVDR (orange), bichir VDR (green), and humanVDR (blue). Lysates were prepared from transfected Cos7 cells as described in Materials and Methods. Lysates were incubated with 0–1.6 nM [3H]-1, 25D3 for 18 hours at 4°C. Unbound ligand was removed as described. Specific binding values were calculated by subtracting the average non-specific binding counts from the total binding counts. Hyperbolic one-site binding curves were fit using Prism 4. The reported dissociation constant (Kd) in the manuscript for each VDR is the average of three or four separate experiments ± SEM. The graphs shown here are specific binding data from a representative experiment.
DNA binding
To investigate VDR-RXR heterodimer association with DNA, electrophoretic mobility shift assays (EMSAs) were conducted with both canonical and non-canonical vitamin D response elements (VDREs) (Fig 5, uncropped images are provided in S1 File). With the canonical VDRE (Fig 5A), VDR binding was only observed in the presence of both VDR and RXRWT (lanes 1 vs. 2, and 5 vs. 6). DNA binding did not occur when VDR or RXRWT was used individually, indicating the necessity for obligate VDR-RXRWT heterodimerization. Competition assays using wild-type unlabeled VDRE probes effectively outcompeted the VDR-RXR binding with labeled canonical VDRE, thus no binding complex was visible (lanes 2 vs. 3, and 6 vs. 7). Competition assays using an unlabeled mutant VDRE probe had no effect on VDR binding to the canonical VDRE (lanes 2 vs. 4 and 6 vs. 8). Addition of ligand (1, 25D3) visibly enhanced heterodimer binding to the canonical VDRE (lane 2 vs. lane 6).
Fig 5
Electrophoretic mobility shift analysis of recombinant lamprey, skate, bichir, and human VDR.
The above images depict VDR-RXR heterodimer binding to both (A) the canonical VDRE, and (B) the VDRE from the XREM region of CYP3A4. (A) With the canonical VDRE, DNA binding complexes were only observed in the presence of RXRWT (lanes 2, 4, 6, 8 vs. lanes 1, 3, 5, 7). The addition of 100 nM 1, 25D3 (lanes 5–8) visibly enhanced binding complex formation compared to the ethanol control (lanes 1–4). In competition assays, the addition of 100-fold molar excess of the unlabeled wild type competitor (VDREWT) successfully outcompeted binding to the labeled VDRE (lanes 2 vs. 3 and 6 vs. 7). The use of the mutant competitor (VDREMUT) did not inhibit complex formation with any VDR tested (lanes 2 vs. 4 and 6 vs. 8). (B) A similar pattern was observed with the XREM VDRE. Complex formation was only observed in the presence of recombinant RXRWT (lanes 1 vs. 2 and 4 vs. 5). The addition of 100 nM 1, 25D3 visibly enhanced complex formation (lane 2 vs. lane 5). In competition assays, the addition of 100-fold molar excess of the unlabeled XREM VDREWT successfully outcompeted complex formation on the labeled XREM VDRE (lanes 2 vs. 3 and 5 vs. 6).
Electrophoretic mobility shift analysis of recombinant lamprey, skate, bichir, and human VDR.
The above images depict VDR-RXR heterodimer binding to both (A) the canonical VDRE, and (B) the VDRE from the XREM region of CYP3A4. (A) With the canonical VDRE, DNA binding complexes were only observed in the presence of RXRWT (lanes 2, 4, 6, 8 vs. lanes 1, 3, 5, 7). The addition of 100 nM 1, 25D3 (lanes 5–8) visibly enhanced binding complex formation compared to the ethanol control (lanes 1–4). In competition assays, the addition of 100-fold molar excess of the unlabeled wild type competitor (VDREWT) successfully outcompeted binding to the labeled VDRE (lanes 2 vs. 3 and 6 vs. 7). The use of the mutant competitor (VDREMUT) did not inhibit complex formation with any VDR tested (lanes 2 vs. 4 and 6 vs. 8). (B) A similar pattern was observed with the XREM VDRE. Complex formation was only observed in the presence of recombinant RXRWT (lanes 1 vs. 2 and 4 vs. 5). The addition of 100 nM 1, 25D3 visibly enhanced complex formation (lane 2 vs. lane 5). In competition assays, the addition of 100-fold molar excess of the unlabeled XREM VDREWT successfully outcompeted complex formation on the labeled XREM VDRE (lanes 2 vs. 3 and 5 vs. 6).To support transient transfection data, EMSAs were additionally conducted using a probe representing a divergent DR3 VDRE present within humanCYP3A4 promoter, used in this study as the XREM-Luc reporter (Fig 5B). This VDRE has previously been demonstrated to facilitate expression of CYP3A4 and VDR transactivation of the XREM reporter [21]. As with the canonical DR3, all EMSAs with the XREM VDRE probe exhibited an obligate dependence on VDR-RXR heterodimerization facilitating VDR-DNA interactions (lanes 1 vs. 2, and 4 vs. 5). Competition assays using unlabeled probes effectively outcompeted VDR-RXRWT binding with the XREM VDRE (lanes 2 vs. 3, and 5 vs. 6). Addition of 100 nM 1, 25D3 visibly enhanced heterodimer binding to the XREM VDRE tested in comparison to the ethanol control (lane 2 vs. 5).
Basal VDR Heterodimerization with RXR
To assess the effects of RXR on VDR transactivation, additional transactivation studies were conducted utilizing VDR co-transfected with either full-length RXRWT (pCDNA-RXRWT) or a truncated RXR mutant lacking the c-terminal AF2 region (pCDNA-RXRAF2). Results in Fig 6A illustrate that co-transfection with RXRWT significantly increased VDR transactivation compared to VDR alone. Skate, bichir, and humanVDR transactivation increased 2.1–2.6-fold over background, whereas lamprey VDR increased ~13-fold. In each instance where the RXRAF2 mutant was substituted for RXRWT, luciferase activity was significantly attenuated to background levels.
Fig 6
Assessment of VDR-RXR interactions.
(A) Analysis of overexpressed RXR on VDR transactivation and (B) VDR-RXR heterodimerization in response to 1, 25D3. (A) HepG2 cells were transiently transfected with pSG5-VDR, the XREM-Luc reporter, and the pRL-CMV internal luciferase control as described previously in Materials and Methods. Select assays were cotransfected with pCDNA-RXRWT (orange bars) or pCDNA-RXRAF2 mutant (blue bars). Cells were treated with 120 nM 1, 25D3 for 24 hours. VDR response was measured via dual-luciferase assays. Data are represented as the average fold activation normalized to VDR alone (no RXR) ± SEM (n = 4). Asterisks represent a significant increase in transactivation compared to the VDR control: *** = p < 0.001, ** = p < 0.01, * = p < 0.05. (B) Mammalian two-hybrid assays were conducted to study VDR-RXR heterodimerization in response to 1, 25D3. HepG2 cells were transiently transfected with pVP16-VDR as prey and pM-RXRWT (light orange bars) or pM-RXRAF2 (light blue bars) as bait, along with the Gal4 luciferase reporter 5XGal4-TATA-Luc and the pRL-CMV internal luciferase control. Select experiments were also cotransfected with pSG5-SRC1 where indicated. Cells were exposed to 120 nM 1, 25D3 in media for 24 hours. Protein-protein interaction was measured via dual-luciferase assays as described in the Materials and Methods. Data are represented as the mean fold interaction ± SEM (n = 4). Data are normalized to VDR + empty pM vector (no RXR). Asterisks indicate significance: *** = p < 0.001, ** = p < 0.01, * = p < 0.05. Asterisks above brackets indicate the addition of pSG5-SRC1 significantly enhanced VDR-RXR interaction.
Assessment of VDR-RXR interactions.
(A) Analysis of overexpressed RXR on VDR transactivation and (B) VDR-RXR heterodimerization in response to 1, 25D3. (A) HepG2 cells were transiently transfected with pSG5-VDR, the XREM-Luc reporter, and the pRL-CMV internal luciferase control as described previously in Materials and Methods. Select assays were cotransfected with pCDNA-RXRWT (orange bars) or pCDNA-RXRAF2 mutant (blue bars). Cells were treated with 120 nM 1, 25D3 for 24 hours. VDR response was measured via dual-luciferase assays. Data are represented as the average fold activation normalized to VDR alone (no RXR) ± SEM (n = 4). Asterisks represent a significant increase in transactivation compared to the VDR control: *** = p < 0.001, ** = p < 0.01, * = p < 0.05. (B) Mammalian two-hybrid assays were conducted to study VDR-RXR heterodimerization in response to 1, 25D3. HepG2 cells were transiently transfected with pVP16-VDR as prey and pM-RXRWT (light orange bars) or pM-RXRAF2 (light blue bars) as bait, along with the Gal4 luciferase reporter 5XGal4-TATA-Luc and the pRL-CMV internal luciferase control. Select experiments were also cotransfected with pSG5-SRC1 where indicated. Cells were exposed to 120 nM 1, 25D3 in media for 24 hours. Protein-protein interaction was measured via dual-luciferase assays as described in the Materials and Methods. Data are represented as the mean fold interaction ± SEM (n = 4). Data are normalized to VDR + empty pM vector (no RXR). Asterisks indicate significance: *** = p < 0.001, ** = p < 0.01, * = p < 0.05. Asterisks above brackets indicate the addition of pSG5-SRC1 significantly enhanced VDR-RXR interaction.Next, mammalian 2-hybrid assays were conducted to determine if enhanced transactivation by RXR is due to direct protein-protein interactions (i.e. heterodimerization with VDR). As indicated in Fig 6B, pM-RXRWT and pVP16-VDR demonstrated a strong and significant association in all species, indicating that each VDR is likely forming heterodimers with RXRWT in response to 1, 25D3. The presence of pSG5-SRC1 significantly increased VDR-RXR association for lamprey, skate, and humanVDR, but not bichir VDR. The use of the pM-RXRAF2 mutant significantly attenuated the association between pVP16-VDR and pM-RXR, although a weak but significant association was still demonstrated with skate, human, and bichir VDR in the presence of SRC1.
Basal VDR Interaction with the SRC/p160 Family of Nuclear Receptor Coactivators
Given that nuclear receptor coactivators are critical to VDR function, we next sought to investigate if co-transfection of VDR with members of the SRC/p160 family of nuclear receptor co-activators could facilitate VDR transactivation. In the absence of cotransfected RXRWT, the addition of SRC1, GRIP1, or ACTR did not affect VDR transactivation for any VDR tested (Fig 7A–7D). Conversely, the combination of RXRWT and SRC1 resulted in a significant increase in VDR transactivation for lamprey and skate that was greater then the transactivation increase observed with either coregulator used individually (Fig 7A and 7B). A similar increase was observed with the cotransfection of RXRWT and GRIP1 with skateVDR, but not lamprey. A significant increase was observed with humanVDR co-transfected with RXRWT and SRC1, GRIP1, and ACTR, but these increases were not significant when compared to VDR + RXRWT in the absence of SRC/p160 coactivators (Fig 7D). Cotransfection with the SRC/p160 coactivators both in the presence and absence of RXRWT did not affect bichir VDR transactivation with any of the coactivator combinations tested (Fig 7C).
Fig 7
Influence of overexpressed SRC/p160 coactivators on VDR transactivation in response to 1, 25D3.
The above graphs depict (A) lamprey VDR, (B) skate VDR, (C) bichir VDR, and (D) human VDR. HepG2 cells were transiently transfected with pSG5-VDR, the XREM-Luc reporter, and the pRL-CMV internal luciferase control as described previously in Materials and Methods. Select assays were cotransfected with pSG5-SRC1 (orange bars), pSG5-GRIP1 (blue bars), pSG5-ACTR (yellow bars), or no SRC/p160 coactivators (black bars). Assays were conducted both in the presence (+) and absence (-) of pCDNA-RXRWT. Cells were treated with 120 nM 1, 25D3 for 24 hours. VDR response was measured via dual-luciferase assays as described. Data are represented as the average fold activation normalized to VDR alone ± SEM (n = 4). Asterisks indicate significance: *** = p < 0.001, ** = p < 0.01, * = p < 0.05. Asterisks above brackets indicate the combination of RXRWT the indicated SRC/p160 coactivator significantly increased VDR transactivation compared to the SRC/p160 coactivator in the absence of RXRWT. The letter “b” indicates the combination of both RXRWT and the indicated SRC/p160 coactivator had a greater effect on VDR transactivation compared with VDR + RXRWT in the absence of the SRC/p160 coactivator (black bar). The letter “a” indicates that no difference in VDR transactivation was observed in the presence of both RXRWT and the indicated SRC/p160 coactivator vs. VDR + RXRWT in the absence of the SRC/p160 coactivator. (p < 0.05).
Influence of overexpressed SRC/p160 coactivators on VDR transactivation in response to 1, 25D3.
The above graphs depict (A) lamprey VDR, (B) skateVDR, (C) bichir VDR, and (D) humanVDR. HepG2 cells were transiently transfected with pSG5-VDR, the XREM-Luc reporter, and the pRL-CMV internal luciferase control as described previously in Materials and Methods. Select assays were cotransfected with pSG5-SRC1 (orange bars), pSG5-GRIP1 (blue bars), pSG5-ACTR (yellow bars), or no SRC/p160 coactivators (black bars). Assays were conducted both in the presence (+) and absence (-) of pCDNA-RXRWT. Cells were treated with 120 nM 1, 25D3 for 24 hours. VDR response was measured via dual-luciferase assays as described. Data are represented as the average fold activation normalized to VDR alone ± SEM (n = 4). Asterisks indicate significance: *** = p < 0.001, ** = p < 0.01, * = p < 0.05. Asterisks above brackets indicate the combination of RXRWT the indicated SRC/p160 coactivator significantly increased VDR transactivation compared to the SRC/p160 coactivator in the absence of RXRWT. The letter “b” indicates the combination of both RXRWT and the indicated SRC/p160 coactivator had a greater effect on VDR transactivation compared with VDR + RXRWT in the absence of the SRC/p160 coactivator (black bar). The letter “a” indicates that no difference in VDR transactivation was observed in the presence of both RXRWT and the indicated SRC/p160 coactivator vs. VDR + RXRWT in the absence of the SRC/p160 coactivator. (p < 0.05).As with RXR, mammalian 2-hybrid assays were conducted to test the ability of the VDRs to directly recruit the SRC/p160 coactivators in response to 1, 25D3. Studies were conducted both in the presence and absence of supplemented RXRWT. Results from this study demonstrate that all VDRs are capable of forming direct interactions with pM-SRC1 (Fig 8A–8D). Further, interactions between lamprey, skate, and humanVDR and pM-SRC1 and were significantly enhanced in the presence of co-transfected full-length RXRWT. Human was the only VDR tested that demonstrated direct interaction with pM-GRIP1. Conversely, cotransfection with RXRWT resulted in a significant association between GRIP1 and skateVDR. None of the VDRs demonstrated interaction with pM-ACTR in the presence of absence of RXRWT.
Fig 8
Mammalian 2-hybrid analysis of VDR interaction with SRC/p160 coactivators in response to 1, 25D3.
The above graphs depict (A) lamprey VDR, (B) skate VDR, (C) bichir VDR, and (D) human VDR. Assays were conducted both in the presence (+) and absence (-) of pCDNA-RXRWT. HepG2 cells were transiently transfected with pVP16-VDR as prey and pM-SRC1 (orange bars), pM-GRIP1 (blue bars), or pM-ACTR (yellow bars) as bait, along with the 5XGal4-TATA-Luc reporter and pRL-CMV as an internal luciferase control. Cells were exposed to 120 nM 1, 25D3 in media for 24 hours. Protein-protein interaction was measured via dual-luciferase assays as described in the Materials and Methods. Data are represented as the mean fold interaction ± SEM (n = 4). Data are normalized to VDR + empty pM vector (no coactivators). Asterisks above bars represent a significant interaction between VDR and the SRC/p160 coactivators: *** = p < 0.001, ** = p < 0.01, * = p < 0.05. Asterisks above brackets indicate the addition of RXRWT significantly enhanced VDR-SRC/p160 interaction. The interaction between pVP16-skate VDR and pM-SRC1 was tested with an unpaired t-test: t6 = 16.56, p < 0.0001 (†).
Mammalian 2-hybrid analysis of VDR interaction with SRC/p160 coactivators in response to 1, 25D3.
The above graphs depict (A) lamprey VDR, (B) skateVDR, (C) bichir VDR, and (D) humanVDR. Assays were conducted both in the presence (+) and absence (-) of pCDNA-RXRWT. HepG2 cells were transiently transfected with pVP16-VDR as prey and pM-SRC1 (orange bars), pM-GRIP1 (blue bars), or pM-ACTR (yellow bars) as bait, along with the 5XGal4-TATA-Luc reporter and pRL-CMV as an internal luciferase control. Cells were exposed to 120 nM 1, 25D3 in media for 24 hours. Protein-protein interaction was measured via dual-luciferase assays as described in the Materials and Methods. Data are represented as the mean fold interaction ± SEM (n = 4). Data are normalized to VDR + empty pM vector (no coactivators). Asterisks above bars represent a significant interaction between VDR and the SRC/p160 coactivators: *** = p < 0.001, ** = p < 0.01, * = p < 0.05. Asterisks above brackets indicate the addition of RXRWT significantly enhanced VDR-SRC/p160 interaction. The interaction between pVP16-skateVDR and pM-SRC1 was tested with an unpaired t-test: t6 = 16.56, p < 0.0001 (†).
Summary of Bioinformatic Analysis
Fig 9A and 9B provides a global, multispecies context for VDR functional assays that includes previous data for medaka and zebrafishVDRα and VDRβ [24]. The data resulted in three empirical clusters of [Lamprey, Bichir], [Skate, Zebrafish β, and Medaka β] and [Zebrafish α Medaka α, and Human]. The first cluster (C1) included Lamprey and Bichir, which shared similar response across most of the 1, 25D3 mammalian 2-hybrid assays (M2H). However, the two species differ in their activity in the transient transfection (TT) assays. The next cluster (C2) included Skate and the VDRβ paralogs of Zebrafish and Medaka. The last cluster (C3) grouped Humans with the VDRα paralogs of Zebrafish and Medaka.
Fig 9
Hierarchical clustering of transient transactivation (TT) and mammalian 2-hybrid (M2H) assays.
(A) Clustering includes eight VDR orthologs with Manhattan distance and complete linkage. Data for each assay (rows) were standardized as z-scores across all eight VDR species (columns) to account for interspecies differences in absolute assay readout. (B) The Pickett Plot to the right of the heatmap indicates the presence/absence of coregulators within each assay.
Hierarchical clustering of transient transactivation (TT) and mammalian 2-hybrid (M2H) assays.
(A) Clustering includes eight VDR orthologs with Manhattan distance and complete linkage. Data for each assay (rows) were standardized as z-scores across all eight VDR species (columns) to account for interspecies differences in absolute assay readout. (B) The Pickett Plot to the right of the heatmap indicates the presence/absence of coregulators within each assay.Permutation stability results were used to infer factors underlying the empirical clustering results. Activity associated with the coregulators GRIP1, SRC1, and ACTR drove assignment of the two Medaka paralogs (VDRα and VDRβ) to separate clusters. When assays involving these factors were permuted, only ~ 20% of resulting clusters maintained intact C3 membership. Cluster C2 was less sensitive to permutation, although SRC1 and GRIP1 cofactors disrupted the inclusion of ZebrafishVDRβ in this cluster. In this analysis, Lamprey and Bichir clustered together in 99% of permutations, regardless of functional assay(s) involved.
Discussion
Nuclear receptors (NRs) are ligand-dependent transcription factors that bind to lipophilic signaling molecules, resulting in systematic control and expression of target genes. Such control facilitates cellular responses to endogenous and exogenous signals through the coordination of complex transcriptional processes [51]. Despite their diversity in function, NRs share a common protein organization including a highly conserved N-terminal DNA binding domain (DBD) and a C-terminal ligand-binding domain (LBD), and specific transactivation domains [14] (Fig 1). The identification of NRs in both diploblastic Cnidarian and triploblastic animals suggests NR proteins arose early in metazoan evolution [52]. This is supported by the fact that NRs appear to be absent in genomes of fungi, plants, and prokaryotes, and suggests that NRs arose in multicellular organisms sometime after the divergence of metazoans from lower eukaryotes [53]. Phylogenetic comparisons of ancestral NRs demonstrate that during evolution to bilaterian lineages, NR diversification was shaped by two major periods of gene loss and duplication and lineage-specific expansion [52]. The first period lead to the divergence of the six major subfamilies. The second period occurred specifically in vertebrates, and resulted in paralogs within each subfamily. The second period of diversification is consistent with the vertebrate serial genome duplication hypothesis, which states that the vertebrate genome is a result of successive rounds of genome duplication [54].While significant information is available regarding functionality of most mammalian NRs, there is a paucity of data regarding NR functions of basal vertebrates. This data gap limits our ability to infer derived and ancestral properties of more recent receptor functions. We have previously reported evidence of functional divergence between vitamin D receptor paralogs (VDRα and VDRβ) isolated from teleost fish that evolved after the 3R WGD event [24]. In order to elucidate the evolutionary history and ancestral molecular functions of VDR, we have characterized VDR function from basal vertebrates that diverged at key periods in vertebrate evolution. Our results indicate that select characteristics of VDR function, such as receptor-ligand interactions, evolved early and have been highly conserved throughout vertebrate evolution. However, VDR transactivation in response to 1, 25D3, and the influence of protein-protein interactions between nuclear receptor coactivators and VDR appear to vary significantly between basal and more derived vertebrates.We first confirmed that all three basal VDRs and humanVDR are capable of 1, 25D3-dependent transactivation by titrating the concentration of 1, 25D3 in our transactivation assays. Combined with our previous data on medaka and zebrafishVDRα and VDRβ [24], EC50 values for all VDRs (with the exception of bichir) were in the low nanomolar range (<10 nM). These results are consistent with that observed from other VDR studies which employed Gal4-VDR-LBD chimeras to assess VDR transactivation across phylogenetically diverse taxa [21, 29]. The EC50 for bichir, a 2R bony fish, was over 10-fold greater than the EC50 for any other VDR tested, suggesting that 1, 25D3 is a less potent agonist for this VDR ortholog. The reason for the decreased potency observed in bichir VDR is unclear. The fact that the EC50 for VDRs from species that diverged both before and after bichir are in the low nanomolar range suggests that the decreased sensitivity observed with bichir VDR might be species or lineage specific. However, attenuated sensitivity of Xenopus laevisVDR to 1, 25D3 has also been previously reported [25]. While 1, 25D3 is a highly potent VDR ligand for the vast majority of species tested, the results with bichir and Xenopus indicate that potency may vary between species. Mechanistic details associated with differential ligand sensitivities are currently undetermined, yet VDR of both species retain 1, 25D3-mediated transactivation, RXR heterodimerization, and DNA binding [25].Our concentration-response curves further suggest that the ability of 1, 25D3 to induce a highly efficacious response is likely a more recent evolutionary innovation. High transactivational efficacy was only observed in the bony vertebrates (i.e. bichir, human, and VDRα), compared to lamprey and skate (and VDRβ), which appears to be more ancestral-like in function. The maximum transactivational efficacy was highest for human and bichir, which is similar to the efficacies observed for medaka and zebrafishVDRα from our previous study [24]. The maximum transactivational efficacy was much lower for lamprey and skate, the two most basal vertebrate species. Our lamprey transactivation data is consistent with the previous findings reported by Whitfield et al [26], and Reschly et al [29], which demonstrated that lamprey VDR maintains an EC50 comparable to that of human and rodent VDR, however the maximum level of transactivation exhibited by lamprey VDR was highly attenuated by comparison.The observed differential transactivational efficacies are potentially associated with critical NR functions including ligand binding, DNA binding, receptor heterodimerization and recruitment of coregulators to the transcription complex. The perturbation of any of these steps may have critical effects on downstream VDR transactivation. We thus ran additional assays to assess each of these fundamental NR functions with VDR orthologs from basal vertebrates. We first conducted saturation binding assays with basal VDRs and [3H]-1, 25D3 to determine if the observed differential transactivational efficacies were potentially a result of differential ligand affinities. Decreased ligand affinity may be indicative of a ligand’s ability to stabilize VDR in the active conformation, which may have downstream effects on subsequent steps in receptor transactivation. Yet ligand-binding data reveal that ligand affinity between 1, 25D3 and VDR is well conserved across vertebrate evolution, including basal species. In each instance, Kd values for all VDRs tested were within the sub-nanomolar range (10–10 M) previously reported for high affinity mammalianVDR proteins [55]. Of note, lamprey and skate had slightly lower ligand affinities compared to bichir and human. The lower affinity of lamprey and skateVDR is consistent with previously reported ligand affinity by Whitfield et al [26] and may be associated with a leucine to valine substitution in both species compared to humanVDR at Val418 [40]. The interaction between Val418 in human and 1, 25D3 stabilizes helix 12 (H12) of VDR in the active conformation, positioning it for optimal interaction with NR coactivators such as SRC1 [40]. The positioning of H12 is critical for NR activation, a necessity illustrated by the fact that destabilization of H12 has been determined to be a mechanism of action for some VDR antagonists [56], and that the loss of the AF2 region of H12 completely abolishes VDR transactivation [57]. However, in this study we have demonstrated that both lamprey and skateVDR are both highly capable of recruiting coactivators in response to 1, 25D3, and thus we suspect that such a small difference in ligand affinity is not driving the observed transactivational variances. Furthermore, it should be noted that ligand affinity is not necessarily indicative of transactivational efficacy. It has been previously demonstrated both by our laboratory and others that high ligand affinity and high transactivational efficacy of specific NR ligands are not proportional [22, 24, 58]. This phenomenon is likely due to the ability of ligands to induce subtle conformational differences within receptors that elicit different biological responses such as DNA binding, coactivator recruitment and heterodimerization [58].RXR is considered the obligate heterodimer partner for VDR, and previous studies have demonstrated the necessity of this partnership in VDR-mediated transcription [59, 60]. The cotransfection of RXRWT in our VDR transactivation assays significantly increased VDR activation for all VDRs tested. This is consistent with our previous study on teleostVDR paralog transactivation with RXR, and with enhanced VDR transactivation previously reported with humanVDR in the presence of RXR [24, 61]. Our mammalian 2-hybrid assays additionally demonstrate that all VDRs directly heterodimerize with RXRWT in response to 1, 25D3. When compared to our previous data with medaka and zebrafishVDRα and VDRβ[24] it appears the overexpression of RXRWT increases VDR activation 2.1–5.4 fold in our system, similar to an ~1.6 fold increase previously observed in transactivation studies with cotransfected humanVDR and RXR [61]. However, lamprey VDR proved to be exceptionally sensitive to RXRWT. Lamprey VDR transactivation increased ~13-fold in the presence of overexpressed RXRWT. These results are in contrast to a previous lamprey VDR study [26]. This study observed a much smaller increase in lamprey VDR transactivation with zebrafish RXR, and a lack of heterodimer formation with human RXR in DNA binding assays, although it should be noted that the lack of heterodimer formation may be due to the different VDRE sequences used in the previous study [26]. Our EMSA results provide additional support regarding the conservation and necessity of the VDR-RXR partnership for DNA binding. Analogous to previous observations with humanVDR [60, 61], all basal vertebrate VDRs only formed binding complexes in the presence of RXRWT, and complex binding to VDREs was enhanced with the addition of 1, 25D3, emphasizing the necessity of ligand binding for optimal heterodimerization. Considering that all VDRs demonstrate increased transactivation in the presence of RXR, heterodimerize with RXR in response to 1, 25D3, and bind to both canonical and divergence VDREs with a high degree of specificity implies that VDR-RXR heterodimerization is an ancient trait that evolved early in VDR evolution, and has been highly conserved across species.In addition to RXR, assays were run to determine the ability of the basal VDRs to recruit members of the SRC/p160 family of NR coactivators, and the effect of the coactivators on VDR transactivation. Leucine-rich motifs of the SRC/p160 coactivators, referred to as the NR box, interact with the AF2 region of NRs in a ligand-dependent manor [62]. SRC/p160 coactivators enhance NR transactivation through chromatin remodeling and recruiting additional proteins to the transcription complex [45]. Similar to our studies with RXR, our transactivation and mammalian 2-hybrid assays with the SRC/p160 coactivators also demonstrate a strong degree of conservation. All VDRs demonstrate a preference for SRC1 over GRIP1 and ACTR, a preference that has been observed previously with humanVDR [63]. In our system, overexpressed RXRWT was necessary for the SRC/p160 coactivators to enhance transactivation. Consistent with Jurutka et al [63], we have hypothesized that a direct association between these proteins is necessary to drive gene expression. Conversely, SRC/p160 coactivators did not have a significant effect on bichir VDR activation, although our M2H data indicate that bichir successfully recruits SRC1.The ability of 1, 25D3 to bind the basal VDRs with high affinity yet only induce partial efficacy in transactivation assays compared to modern vertebrate VDRs suggests that 1, 25D3 may function as a partial agonist for the basal VDRs (and possibly the teleostVDRβ paralogs). Partial agonists are defined by their ability to directly bind a receptor, but are only able to induce partial efficacy compared to a full agonist. While these observations are traditionally made with a single receptor and multiple ligands, what we may be observing is a change in the pharmacodynamics relationship between VDR and 1, 25D3 throughout vertebrate evolution. Our lamprey and skateVDR data supports the theory that the evolution of 1, 25D3 as a high potency and high affinity ligand for VDR evolved early, however it appears that the ability of 1, 25D3 to act as a full agonist evolved later in time. Our bioinformatic analysis suggests that interaction with RXR and the SRC/p160 coactivators may have been influential in the ability of VDR to mediate a full agonist response to 1, 25D3. While VDR has maintained a high ligand affinity across species, we speculate that an increasing sensitivity to coregulators may have been an influence driving the increased transactivational response observed in both human and the teleostVDRα paralogs. The cluster analysis indicates that the coregulators have the greatest effect on the C3 cluster (humanVDR, zebrafish and medakaVDRα). By examining phylogeny of our test species there appears to be a trend suggesting that full transcriptional response to 1,25D3 may have appeared before the Actinopterygii/Sarcopterygii split, but after the divergence of more basal jawed vertebrates such as Chondrichthyes, but additional studies are necessary to support this theory.It is well known that vitamin D is an ancient hormone which is found in all forms of life [34]. That being said, the ancestral physiological role(s) for VDR and the vitamin D endocrine system in aquatic vertebrates remains relatively unknown. For bony fish, a canonical role for VDR and vitamin D in calcium ion homeostasis and skeletal maintenance may be inferred and for some teleost species initial evidence for this role has been demonstrated [27]. Yet in cartilaginous vertebrates, the vitamin D endocrine system likely has little role in skeletal maintenance, as these species lack mineralized bone. Rather, there is a proposed role for VDR in bile salt metabolism, detoxification, and immune system function in these species [26]. It is well established in terrestrial organisms that the vitamin D endocrine system extends far beyond skeletal maintenance. Studies over the past decade have revealed that VDR and the vitamin D endocrine system encompass many non-calcemic roles, including detoxification, embryonic development, cell proliferation and differentiation, neurodevelopment and immune system function (reviewed in [64, 65]). We speculate that some of these same roles for vitamin D and VDR may be functional in early aquatic vertebrates. These functionalities may even predate the role of vitamin D in calcium ion homeostasis and skeletal maintenance. In fact, a recent study by Lin et al [27] demonstrated that the VDRα paralog from zebrafish facilitates calcium uptake, bone mineralization and expression of vitamin D catabolizing CYPs, while the VDRβ paralog maintains a non-calcemic role [27]. This physiological data may in turn support our functional assessments demonstrating a definitive cluster between medaka and zebrafishVDRα and humanVDR, which maintain calcemic modalities. Comparatively, medakaVDRβ, zebrafishVDRβ and skateVDR form a cluster that may represent a group of non-calcemic receptors. This diversification of teleosts VDR represents either neofunctionalization [8] in this case a role in calcium ion regulation, or subfunctionalization [9] depending upon the physiological role(s) of VDR in basal and ancestral vertebrates, which is yet to be determined [24]. Here we demonstrate that VDR evolved an increasing sensitivity to interactions with coregulator proteins during the evolution of bony vertebrates. We propose that this process may have in turn been a major influence driving the increased efficacy of VDR in response to 1, 25D3 observed in modern vertebrates and facilitated novel calcemic vitamin D endocrine functions compared to VDRs from ancestral species.
Authors: A R Baker; D P McDonnell; M Hughes; T M Crisp; D J Mangelsdorf; M R Haussler; J W Pike; J Shine; B W O'Malley Journal: Proc Natl Acad Sci U S A Date: 1988-05 Impact factor: 11.205
Authors: Deanna L Howarth; Sheran H W Law; Benjamin Barnes; Julie M Hall; David E Hinton; Linda Moore; Jodi M Maglich; John T Moore; Seth W Kullman Journal: Endocrinology Date: 2008-02-07 Impact factor: 4.736
Authors: Erin M Kollitz; Guozhu Zhang; Mary Beth Hawkins; G Kerr Whitfield; David M Reif; Seth W Kullman Journal: PLoS One Date: 2016-12-12 Impact factor: 3.240