Literature DB >> 25629048

Aberrant hypermethylation of aldehyde dehydrogenase 2 promoter upstream sequence in rats with experimental myocardial infarction.

Peng Wang1, Cheng Shen1, Lei Diao2, Zhiyin Yang3, Fan Fan4, Cong Wang4, Xiangwei Liu4, Xiaolei Sun4, Zhen Dong4, Hong Zhu4, Xin Ma4, Quan Cao4, Xiaona Zhao4, Duan Ma2, Yunzeng Zou5, Kai Hu4, Aijun Sun5, Junbo Ge5.   

Abstract

BACKGROUND: Aldehyde dehydrogenase 2 (ALDH2) plays a crucial role in myocardial protection against ischemia. Downregulation of ALDH2 was evidenced after myocardial infarction and the underlying mechanism is not fully understood. DNA methylation can regulate gene transcription in epigenetic level. We thus hypothesized that DNA methylation may affect ALDH2 expression in myocardial infarction (MI).
METHODS: MI was induced in Sprague-Dawley rats. MI border zone tissues were harvested at 1st week, 2nd week, and 3rd week after MI. Bisulfite sequencing PCR (BSP) was performed to detect the methylation levels of ALDH2 core promoter. Sequenom MassARRAY platform (MassARRAY) was used to examine the methylation levels of ALDH2 promoter upstream sequence. ALDH2 protein and mRNA expression were assayed by Western blot and real-time PCR, respectively.
RESULTS: Compared with Sham group, ALDH2 protein and mRNA expression of MI groups was significantly downregulated. Compared with Sham group, DNA methylation level of CpG sites in ALDH2 promoter upstream sequence was significantly higher in MI groups in a time-dependent manner (CpG1, CpG2, and CpG7, P < 0.01). DNA methylation did not affect ALDH2 core promoter sequence during the progress of MI. No significant difference was detected in DNA methylation level of ALDH2 promoter upstream sequence among MI groups.
CONCLUSION: Aberrant hypermethylation of CpG sites in ALDH2 promoter upstream sequence is associated with myocardial ischemia injury and may partly result in ALDH2 downregulation after MI.

Entities:  

Mesh：

Substances：

Year:  2015        PMID： 25629048      PMCID： PMC4299765          DOI： 10.1155/2015/503692

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Previous study shows aldehyde dehydrogenase 2 (ALDH2) plays a critical role in myocardial protection against ischemia, and down-regulation of ALDH2 expression is associated with exacerbated myocardial ischemia injury [1]. Furthermore, enhanced activation of ALDH2 could ameliorate myocardial ischemia injury in rats with experiment myocardial infarction (MI) [2]. The underlying mechanisms for the protective effects of ALDH2 against ischemia are multiple, such as decreasing toxic aldehydes accumulation [1], enhancing autophagy via AMPK-and Akt/mTOR signal [3], promoting apoptosis by MAPK-ERK1/2-JNK-p38 pathway [4] and modulating ER stress [5]. Our previous study demonstrated ALDH2 of myocardial cells decreased after MI, both in transcription and translation level [6]. However, the underlying mechanisms of ALDH2 reduction post MI remain largely unknown, moreover, there is no study focusing on upstream regulation of ALDH2 at transcription level. In the light of the epigenetic theory [7], DNA methylation can regulate gene transcription by adding methyl groups to cytosine residues into DNA sequences [8-10]. DNA methylation can induce repression of gene transcription, physically preventing transcription factor binding and reducing access to gene regulatory regions [11, 12]. There are reports indicating DNA methylation involvement in myocardial protection against ischemia by affecting the transcription level of specific genes [13]; we, hence, hypothesized that DNA methylation level of ALDH2 gene may affect its transcription or be involved in myocardial protection in the setting of MI.

2. Methods

2.1. MI Model and Study Groups

Adult male Sprague-Dawley rats weighing 240–250 g were purchased from Shanghai Animal Administration Center. MI was produced by left anterior descending (LAD) artery ligation as described previously [14]. Success of MI was proved by echocardiography on the 7th day after surgery. Animal experimental protocols were operated on according to the guidelines of “The Guide for the Care and Use of Laboratory Animals” and were approved by the Animal Care and Use Committee of Fudan University Academy Press (NIH Publication number 85-23, revised 1996). Experimental rats were randomized into 4 groups, which included one Sham group and three MI experiment groups. Each MI group contained 5 successfully LAD ligations with reduced ejection fraction (<40%) and myocardial tissue was harvested at 1 week, 2 weeks, and 3 weeks after MI, respectively.

2.2. DNA Extraction

Genomic DNA was extracted from the infarction border using a QIA amp DNA Mini Kit according to manufacturer's instructions (Qiagen, Hilden, Germany), and myocardial tissue in the same region of Sham group was also obtained for DNA extraction. The concentration and purity of the DNA were determined by absorbances at 260 and 280 nm by NanoDropTM 1000 spectrophotometer (Thermo Scientific, Wilmington, USA).

2.3. DNA Sodium Bisulfite Conversion

Sodium bisulfite modification for the extracted DNA was performed using an EZ DNA Methylation Kit according to manufacturer's instructions (Zymo Research, Orange, CA, USA). Sequencing results confirmed that more than 99.0% of cytosine residues were converted. The bisulfite-converted DNA was resuspended in 10 μL elution buffer and stored at −80°C for BSP and MassARRAY.

2.4. Bisulfite Sequencing PCR for ALDH2 Core Promoter

CpG and CpG islands of ALDH2 core promoter BSP were determined with online software (http://emboss.bioinformatics.nl/cgi-bin/emboss/cpgplot); primers of ALDH2 core promoter were designed with Primer software Methyl Primer Express v1.0.exe and the primers were shown in Table 1.
Table 1

Primer sequences, product length, and CpG units used for BSP.

Primer numberForward primer (5′-3′)Reverse primer (5′-3′)Product length (bp)CpG unit
M1GTGAGTTGGGTAGGGATGGACRTCTTCCCCTACCCATATAACC1019
M2GGGATAAAGAGGATTGTTTAGGATAATACCAACCCCCAACCAAC13919
M3GTTGGTTGGGGGTTGGTATCCRTATCTCTACCTCCCATTAATAACC17720
M4GAGTAATYGGYGATTGTAGTTTTGTAGAATCCCCATATTCTACAAACTCCATCTC10510
A 20 μL mixture was prepared for each reaction and included 1x HotStarTaq buffer, 2.0 mM Mg2+, 0.2 mM dNTP, 0.2 μM of each primer, 1U HotStarTaq polymerase (Qiagen Inc.), and 1 μL template DNA. The cycling program was 95°C for 15 min: 11 cycles of 94°C for 20 s, 62°C–0.5°C per cycle for 40 s, and 72°C for 1 min; 24 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 1 min, and then 72°C for 2 min. PCR products were purified by adding 1U SAP and 6U Exo I per 8U PCR products. The mixtures were incubated at 37°C for 60 min, followed by incubation at 70°C for 10 mins. Sequencing reaction were performed in reaction mixture including 2 μL BigDye3.1 mix, 2 μL sequencing primer (0.4 μM), and 1-2 μL purified PCR product, and sequencing primers are GTGAGTTGGGTAGGGATGGA(ALDH2-MF1), GGGATAAAGAGGATTGTTTAGGATA(ALDH2-MF2), CCRTATCTCTACCTCCCATTAATAACC(ALDH2-MF3), and ATCCCCATATTCTACAAACTCCAT CTC(ALDH2-MF4). All of sequencing primers were designed with MethPrimer software. The cycling program was 96°C for 1 min: 28 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min. Final results were evaluated in ABI3130XL sequencer.

2.5. MassARRAY Quantitative Methylation Analysis

The Sequenom MassARRAY platform was used for the quantitative methylation analysis of the upstream sequence of ALDH2 gene promoter. The methylation status of a detected pattern was then analyzed using Epityper software version 1.0 (Sequenom, San Diego, CA, USA). The promoter regions of the upstream sequence were chosen according to the website: http://genome.ucsc.edu. PCR primers used in this system (Table 2) were designed using predict software (Methyl Primer Express v1.0.exe).
Table 2

Primer sequences, product length, and CpG units used for MassARRAY.

PrimernumberForward primer (5′-3′)1 Reverse primer (5′-3′)2 Product length (bp)CpG unit
SQ1TTAAGGATTTGTTTGTATTTAATTGGCAAACAATACCACAATTTATATCTTTTA4166
SQ2AGATTTGGAGAGATGGTTTAGTGGTACCCATTTCCTACAAAAAAATATCC49810
SQ3TTAAAAGATATAAATTGGGGTTGGGACCAACAAAACCCCTCTAAATAAAC3499

1For 10-mer tag, CAGTAATACGACTCACTATAGGGAGAAGG was added and 2for T7 promoter tag AGGAAGAGAG was added.

The procedures and reaction system were reported before [15]. The region analyzed and the CpG sites of the upstream sequence are shown in Figure 2 and Table 3. The same experiments were repeated in triplicate. The methylation level was presented as the ratio of methylated cytosines over the total number of methylated and unmethylated cytosines.
Figure 2

Upstream sequence of ALDH2 core promoter. (a) The chart is the analysis result of Methyl Primer Express; red pillars stand for CpG sites, and bar underlying highlights CpG high density region; (b) another analysis in the same region; blue dots represent valid CpG sites while red dots are invalid which cannot be detected in MassARRAY. Valid dots were numbered.

Table 3

Upstream sequence of ALDH2 core promoter in detail.

 AGACCTGGAGAGATGGCTCAGTGGTTAAGAGCACCGACTGCTCTTCCAGAGGTCCTGAGTTCAAATCCCAG 
                         0 
 CAGGTTCACAACCATTTGTAATGAGATCTGATGCCCTCCTCTGGTATGTCTGAAGACAGCTACAGTGTACTTAT 
   
 ATATAACAATAAATAAAATTAAAAAAAAAAAAAGCAGTAGACATCCCGTGAGTTAGTGGCTCTTCCTCTGTGA 
                                1 
 ATTAGTAAGTCAAAAGACACAAACTGGGGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGGAAGC  
                                      2          3 
  GCAAGGCCCTGGGTTCGGTCCCCAGCTCCGGGAAAAAAAAAAAAAAAAAAGAACCAAAAGACACAAACT 
            4        5 
 GTGGCATTGTTTGTAATCACACAAGATTGGAAGCCACCTTAAATGTCACCCACAGAACTTTCTTTAAATGGG 
   
 AATGCACAGGTAGCGAACGAAACAGCGAGTAAACCAGTGAACGGGGACACCTTCCTGCAGGAAATGGGT 
             6                   7 

The valid CpG sites are written in bold, while invalid CpG sites are written in italic. Valid CpG sites are numbered.

2.6. Western Blot Analysis

Western blot was carried out as described previously [16]. Infarction border myocardial tissue samples were harvested for Western blot. Anti-ALDH2 antibody (1 : 500) was purchased from Santa Cruz Biotechnology Inc.

2.7. Total RNA Preparation and Real-Time PCR of ALDH2

Total RNA was extracted from the infarction border zone using reverse transcription and real-time PCR was performed according to the manufacturer's protocol of PrimeScriptTM RT reagent kit and SYBR Premix Ex TaqTM kit (TaKaRa). Real-time quantification was applied in Bio-Rad IQ5 real-time PCR machine. Relative expression of ALDH2 gene was calculated by using 2−ΔΔCt method. Primers are the same as described previously [6].

2.8. Global Methylation Level of Myocardial Cell

Global methylation level of myocardial cell was examined with Methylated DNA quantification kit (purchased from Epigentek). All steps were followed according to the protocol of kit.

2.9. Inhibiting DNA Methyltransferase by Decitabine

Adult male Sprague-Dawley rats were administered intraperitoneal DNA methyltransferase (DNMT) inhibitor, Decitabine (DAC), by 1 mg/kg once a day for 7 days. Myocardial infarction model procedure was performed on half of rats intervened by DAC which is DAC+MI group, while the group with only DAC intervention is DAC group. Heart tissues of both groups were harvested seven days after myocardial infarction model procedure. Global DNA methylation level and ALDH2 upstream target sequence methylation level were examined with Methylated DNA quantification Kit and MassARRAY, respectively, and expressions of related proteins were determined with Western blot.

2.10. Statistical Analysis

Data were analyzed using GraphPad Prism (version 5.0; GraphPad Software Inc., San Diego, CA, US) and SPSS (version 15.0; SPSS Inc., Chicago, IL, US). ANOVA with post-hoc test was performed to compare the methylation levels between MI and Sham groups and between different MI groups.

2.11. Bioinformatics

The transcription factor binding elements were predicted using the known DNA-binding profiles (JASPAR, http://jaspar.genereg.net/) at the position of polymorphic sites (Primary profile similarity is up to 80%).

3. Results

3.1. Decreased ALDH2 Protein and mRNA Expression in Infarction Border Zone after MI

ALDH2 protein expression result and real-time PCR result are shown in Figures 3(a) and 3(b), respectively. ALDH2 protein and mRNA expression on infarction border zone was significantly and similarly decreased at 1 week, 2 weeks, and 3 weeks after MI (all P < 0.05 versus Sham).
Figure 3

Result and analysis chart of Western blot and real-time PCR. (a) Protein level of ALDH2 was determined by Western blot. (b) mRNA of ALDH2 was determined by real-time PCR. * P < 0.05 versus Sham.

3.2. DNA Methylation in ALDH2 Core Promoter Region

The sequence of CpG sites in ALDH2 core promoter was shown in Figure 1, and 58 valid CpG sites were detected in BSP (Table 3), which covered all possible CpG sites in ALDH2 core promoter region. Furthermore, this region was qualified as CpG island (criteria: up to 200 bp, and GC percentage: up to 50%). Our results showed that the baseline methylation levels of all CpG sites in ALDH2 core promoter were at level 0 (Table 4, DNA methylation level standard: level 0 is no methylation, level 1 is 1~33%, level 2 is 33%~67%, level 3 is 68%~99%, and level 4 is 100%) in all 4 examined groups, and the BPS result indicated CpG sites of rat ALDH2 core promoter were not affected by DNA methylation; therefore, MI did not trigger the alteration of DNA methylation in ALDH2 core promoter region.
Figure 1

ALDH2 core promoter sequence. (a) ALDH2 core promoter sequence. (b) CpG distribution of ALDH2 core promoter was analyzed in Methyl Primer Express; red pillar stands for CpG sites and bar underlying represents CpG island (criteria: up to 200 bp, and GC percentage: up to 50%).

3.3. Aberrant DNA Methylation Level in Upstream Sequence of ALDH2 Promoter after MI

To maintain the homogenous characteristic of tissue between BSP and MassARRAY, tissue samples from the same myocardial region were used to examine the methylation level of upstream sequence of ALDH2 core promoter. A 500 to 600 bp length region of DNA sequence was targeted, which existed in upstream direction of ALDH2 promoter and was 763 bp distant from rat ALDH2 core promoter. Valid CpG sites were numbered and methylation level was detected in this region with SQ2 primer. The mean methylation levels of seven CpG sites varied across different CpG units, ranging from 21.2% to 69.0% (Figure 4). SQ2 primer MassARRAY analysis suggested there were statistical differences in DNA methylation level between Sham group and MI groups at CpG1, CpG2, CpG3, and CpG7 (P < 0.01, Figure 4). No significant difference was detected between MI groups in CpG2, CpG4, CpG5, CpG6, and CpG7 (P > 0.1), but, compared with the other two MI groups, 1-week MI groups showed a higher DNA methylation level of at CpG 1 and CpG 3 sites (Figure 4, P < 0.05 versus 1 week), and no difference was detected between 2-week and 3-week MI groups (Figure 4, P > 0.05).
Figure 4

Methylation level in the upstream of ALDH2 core promoter. CpG numbers are described in Table 3. SQ2 is chosen as primer, which is described in Table 2. * P < 0.01 versus Sham, ** P < 0.05 versus 1st MI group.

3.4. Verification of Methylation Level in ALDH2 Promoter Upstream Sequence

Further MassARRAY evaluation and verification were performed with SQ1 and SQ3 primers, which contained part of valid CpG sites of SQ2 primer, respectively (Table 2). SQ1 primer analysis showed there were no significant differences among MI groups at all 5 CpG sites (Figure 5, P > 0.05), whereas the difference still existed at CpG1 and CpG2 between Sham and MI groups (Figure 5, P < 0.01 versus Sham).
Figure 5

Two more pairs of primer for verification of upstream sequence. (a) SQ1 Primer and SQ1 MassARRAY result. (b) SQ3 primer MassARRAY result. Both (a) and (b) are performed according to Table 2 primer pattern, and CpG numbers are showed in Table 3. * P < 0.01 versus Sham.

SQ3 primer results were similar among MI groups (Figure 5, P > 0.05). CpG2 and CpG7 methylation level differences were still maintained as shown in SQ2 and SQ1 (Figure 5, P < 0.01 versus Sham). No difference of methylation level was found at CpG4 and CpG5 in SQ3 (Figure 5, P > 0.05 versus Sham). Taken together, hypermethylation was evidenced at CpG1, CpG2, and CpG7 in infarction border zone. It indicated that SOX10 (SRY-related HMG-box 10, SRY for sex determining region Y) was the most possible TF binding to target sequence (Table 5).
Table 5

Predicted transcription factors by JASPAR database.

Model ID Model nameScoreRelative scoreStartEndStrand Predicted site sequence
MA0152.1 NFATC26.7240.82902503934764826321TCTTCCT
MA0442.1 SOX105.8460.86398282988520931361CTCTGT
MA0099.2 JUN::FOS5.6360.81647063835791336421TGAATTA
MA0040.1 Foxq111.2090.8891496750481851821921CATTGTTTGTA
MA0442.1 SOX108.6250.9873566081954361821871CATTGT
MA0442.1 SOX104.8050.8177676074235511861911GTTTGT
MA0038.1 Gfi17.4640.8462758181862751901991GTAATCACAC
MA0116.1 Zfp4236.6570.8015803487226672102241GCCACCTTAAATGTC
MA0160.1 NR4A28.7820.8997539786713432192261AATGTCAC
MA0442.1 SOX106.6360.8990549007254682352401CTTTCT
MA0038.1 Gfi16.1290.8061714163043152792881TAAACCAGTG

Putative sites were predicted with the setting of ALDH2 promoter upstream sequence, and predicted scores were ⩾80%.

3.5. Global Methylation Level Was Decreased by DAC

DNA global methylation level of myocardial cells from the infarction border was significantly reduced after intervention of DAC (Figure 6(a), P < 0.05) while, in the groups without DAC intervention, no significant difference of DNA methylation level was detected between Sham and MI groups (Figure 6(b)).
Figure 6

Global methylation level of myocardial cell. (a) Global methylation level of myocardial cell decreased after the intervention of DAC (* P < 0.05). (b) No significant difference of DNA methylation level was detected between Sham and MI groups.

3.6. DAC Intervention Reduced DNA Methylation Level of Target Upstream Sequence and Related Proteins Expression

MassARRAY analysis was performed in target upstream sequence with primer SQ1 for DAC group and DAC+MI group. Western blot of related proteins, including DNMT1 and ALDH2, was performed. DAC intervention reversed hypermethylation of target upstream sequence in MI (Figure 7(a), P < 0.05). Furthermore, DAC inversed the reduction of ALDH2 after MI while it had no significant effect on baseline ALDH2 expression (Figure 7(b), P < 0.05).
Figure 7

DNA methylation level of target upstream sequence and related proteins expression. (a) MassARRAY analysis result of target upstream sequence for DAC group and DAC + MI group. Sham group and MI-1-week group are chosen as comparative groups (* P < 0.05). (b) Western blot of related proteins, including DNMT1 and ALDH2 (* P < 0.05).

4. Discussion

Our study demonstrates that DNA methylation might contribute to the upstream regulation of ALDH2 after myocardial infarction, suggesting that there is an association between ALDH2 promoter hypermethylation and myocardial infarction (The location of ALDH2 in Rattus norvegicus is 12q16. The RefSeq number is NC_005111.4. All information of target gene is referred from the database of Pubmed GenBank). Additionally, we combined two examination methods of DNA methylation, which might offer a more concrete result and contribute to a thorough understanding for ALDH2 promoter region with an ideal cost-effective outcome. It has been substantially shown that DNA methylation plays a pivotal role in the regulation of DNA transcription level [9], and DNA methylation is one of the most important epigenetic changes [7]. The effects of DNA methylation upon transcription regulation are multiple [10, 12], and the change of DNA methylation level in a specific region, mostly occurring at CpG sites or CpG island [17-19], is critically related to the final results of DNA methylation upon transcription regulation [20, 21]. We hypothesized that DNA methylation may actively participate in the pathogenesis of myocardial infarction and is related to ALDH2 decrease after MI. Till now, there is no report exploring the association between ALDH2 gene methylation and myocardial infarction. In this study, DNA methylation was evaluated in the present study with BSP and MassARRAY. Core promoter sequence of rat ALDH2 gene was analyzed and possible CpG sites were mapped in BSP examination. BSP analysis showed that DNA methylation did not affect ALDH2 core promoter in the setting of myocardial infarction. To overcome the limitation of BSP technique [22], MassARRAY was performed for DNA methylation examination in upstream sequence of ALDH2 promoter. MassARRAY analysis results showed there were no significant differences among MI groups at all 5 CpG sites (P > 0.05), whereas the difference between Sham and MI groups was found at CpG1, CpG2, and CpG7 sites (P < 0.01 versus Sham). Our first MassARRAY experiment with SQ2 suggested there were slightly significant differences in MI groups (Figure 4), while subsequent experiments with SQ1 and SQ3 were carried out to test the accuracy of SQ1 result, and results showed there were no differences in MI groups. Previous methodology research also suggested confounding factors could influence the accuracy of MassARRAY [23], so verification issue is essential and should be addressed in MassARRAY. In our study, BSP was performed to examine DNA methylation level of ALDH2 core promoter, which turned out to be a negative result. However, MassARRAY was performed in this region as well, while the preliminary PCR result of MassARRAY was invalid because of extensively high production of dimers, and regulation of PCR temperature or consequences of primers had no effect on eliminating dimers, so MassARRAY final result is far from ideal. It is suggested that the appendix of Primer is combined with specific DNA sequence in ALDH2 core promoter to trigger high production of dimer, while appendix of Primer is constant and essential for mass spectrum in MassARRAY, and ALDH2 core promoter cannot be changed. The preferential method was supposed to choose BSP instead of MassARRAY, and this result also indicated the limitation of MassARRAY in some specific genes; moreover, combination of MassARRAY and BSP may be a rational procedure for detecting DNA methylation level of specific genes, especially in ALDH2 promoter of Rattus norvegicus. Global methylation status in this study was detected to get a comprehensive evaluation of myocardial DNA methylation level. Though study in cancers suggested that hypomethylation of ALDH2 belongs to part of a global DNA methylation change [24], our study indicated there was just nonsignificant increase in global DNA methylation of myocardial cells after MI (Figure 6(b)), while upstream sequence of ALDH2 core promoter was hypermethylated. The possible explanation for this result is the fact that global DNA methylation is typically an integration of all CpG sites, in which significant changes of specific sequences can be neutralized, and chip screening might be the preferential method for analyzing such issues [25]. Further experiment was carried out to determine the potential mechanism for hypermethylation. Target sequence, which is upstream sequence of ALDH2 core promoter, possesses a baseline methylation status, and DNMT 1 can influence the maintenance of DNA methylation [26], so we targeted DNMT1 as a potential enzyme responsible for the change of target sequence. Our result suggested DAC intervention indeed deceased DNA methylation status, both in global methylation (Figure 6(a)) and in specific CpG sites in target sequence (Figure 7(a)), and DAC intervention upregulated ALDH2 expression via inhibiting DNMT1 (Figure 7(b)). All these indicated that DNMT1 increased the methylation level of target sequence after MI and, hence, reduced ALDH2 expression. On the other hand, DAC intervention reduced the global methylation level (Figure 6(a)), which is consistent with cancer studies [27]. The underlying mechanism for the above change could be that hypoxia induced the increase of DNMT1, at least in its enzyme expression, and that DNMT1 subsequently enhanced DNA methylation status of target sequence; finally, ALDH2 was downregulated (Figure 8). One potential link between hypoxia and DNMT1 could be HIF-1α, which is suggested as a possible pathway for the alteration of DNMT and explored in a previous study [28]. Moreover, bioinformatics analysis suggested SOX10 could be a potential TF binding with target sequence (Table 5); further researches are warranted to verify the above hypothesis.
Figure 8

Potential mechanism for alternation of DNA methylation level in ALDH2 core promoter upstream sequence.

Besides methylation changes of ALDH2 after myocardial infarction, there might be a series of genes, which would also face methylation changes in the setting of MI. Breitling et al. reported that F2RL3 gene hypermethylation was associated with the incidence of MI [29]. There was also the report stating that DNA methylation at GNASAS gene was modestly higher in MI patients [30]. Chang et al. found that there was hypermethylation in FGF2 gene promoter in MI patients [31]. Epidemic research demonstrated that global DNA methylation was significantly elevated in male MI patients [32], and Fiorito et al. showed three differentially methylated regions (TCN2 promoter, CBS 5′UTR, and AMT gene-body) in male MI patients [33]. As a key enzyme against myocardial ischemia injury, ALDH2 is also regulated under some other potential mechanisms which could induce the declination of its expression or enzyme activity. In our previous study, ALDH2 was proved to protect myocardial cells against ischemia-reperfusion injury through regulation of autophagy via AMPK- and Akt-mTOR signaling [3]; furthermore, microRNA-34a was shown to reduce the expression of ALDH2 via binding on ALDH2 mRNA in MI rats [6]. Lagranha et al. found that PKC could induce declination of ALDH2 phosphorylation and attenuate ALDH2 both in vivo and in isolated rat heart model of myocardial ischemia reperfusion [34]. Yu et al. demonstrated PI3K/Akt-dependent signaling pathway was associated with the decrease of ALDH2 in MI rats [35]. It is reported SIRT3-mediated deacetylation decreased ALDH2 activity [36]. There are still some limitations in our study. We only observed that MI was associated with aberrant hypermethylation of CpG sites; future studies are needed to prove the mechanism how myocardial ischemia injury could affect DNA methylation level in target sequence. This procedure may involve specific gene, such as NKCC1 gene as reported [37], or alteration of other DNMTs, such as DNMT3a or DNMT3b, which is a key enzyme family for de novo DNA methylation progress [27, 38] and reported involved after MI [39].

5. Conclusion

In summary, the present study suggests DNA methylation has an effect on the upstream sequence of ALDH2 promoter, which is possibly associated with the decrease of ALDH2 expression after myocardial infarction. These findings could be a potential epigenetic explanation for ALDH2 decrease after myocardial infarction or ischemia injury.

(a) M1

CpG number123456789
A1000000000
A2000000000
A3000000000
A4000000000
A5000000000
B1000000000
B2000000000
B3000000000
B4000000000
B5000000000
C1000000000
C2000000000
C3000000000
C4000000000
C5000000000
Sh1000000000
Sh2000000000
Sh3000000000
Sh4000000000
Sh5000000000

(b) M2

CpG number12345678910111213141516171819
A10000000000000000000
A20000000000000000000
A30000000000000000000
A40000000000000000000
A50000000000000000000
B10000000000000000000
B20000000000000000000
B30000000000000000000
B40000000000000000000
B50000000000000000000
C10000000000000000000
C20000000000000000000
C30000000000000000000
C40000000000000000000
C50000000000000000000
Sh10000000000000000000
Sh20000000000000000000
Sh30000000000000000000
Sh40000000000000000000
Sh50000000000000000000

(c) M3

CpG number1234567891011121314151617181920
A100000000000000000000
A200000000000000000000
A300000000000000000000
A400000000000000000000
A500000000000000000000
B100000000000000000000
B200000000000000000000
B300000000000000000000
B400000000000000000000
B500000000000000000000
C100000000000000000000
C200000000000000000000
C300000000000000000000
C400000000000000000000
C500000000000000000000
Sh100000000000000000000
Sh200000000000000000000
Sh300000000000000000000
Sh400000000000000000000
Sh500000000000000000000

(d) M4

CpG number12345678910
A10000000000
A20000000000
A30000000000
A40000000000
A50000000000
B10000000000
B20000000000
B30000000000
B40000000000
B50000000000
C10000000000
C20000000000
C30000000000
C40000000000
C50000000000
Sh10000000000
Sh20000000000
Sh30000000000
Sh40000000000
Sh50000000000

(a), (b), (c), and (d) represent four pairs of BSP primers, respectively, which were numbered in Table 1.

(A): for 1st week MI group.

(B): for 2nd week MI group.

(C): for 3rd week MI group and SH for Sham group.

  39 in total

1.  Possible involvement of DNA methylation in NKCC1 gene expression during postnatal development and in response to ischemia.

Authors:  Hae-Ahm Lee; Su-Hyung Hong; Jung-Wan Kim; Il-Sung Jang
Journal:  J Neurochem       Date:  2010-04-28       Impact factor: 5.372

2.  Inhibition of aldehyde dehydrogenase 2 activity enhances antimycin-induced rat cardiomyocytes apoptosis through activation of MAPK signaling pathway.

Authors:  Peng Zhang; Danling Xu; Shijun Wang; Han Fu; Keqiang Wang; Yunzeng Zou; Aijun Sun; Junbo Ge
Journal:  Biomed Pharmacother       Date:  2009-12-30       Impact factor: 6.529

3.  ALDH2 activator inhibits increased myocardial infarction injury by nitroglycerin tolerance.

Authors:  Lihan Sun; Julio Cesar Batista Ferreira; Daria Mochly-Rosen
Journal:  Sci Transl Med       Date:  2011-11-02       Impact factor: 17.956

4.  MicroRNA-34a promotes cardiomyocyte apoptosis post myocardial infarction through down-regulating aldehyde dehydrogenase 2.

Authors:  Fan Fan; Aijun Sun; Hangtian Zhao; Xiangwei Liu; Wenbin Zhang; Xueting Jin; Cong Wang; Xin Ma; Cheng Shen; Yunzeng Zou; Kai Hu; Junbo Ge
Journal:  Curr Pharm Des       Date:  2013       Impact factor: 3.116

Review 5.  Epigenetic regulation of vascular endothelial gene expression.

Authors:  Charles C Matouk; Philip A Marsden
Journal:  Circ Res       Date:  2008-04-25       Impact factor: 17.367

6.  Remote ischemic postconditioning protects the heart by upregulating ALDH2 expression levels through the PI3K/Akt signaling pathway.

Authors:  Ying Yu; Xian-Jie Jia; Qiao-Feng Zong; Guan-Jun Zhang; Hong-Wei Ye; Jie Hu; Qin Gao; Su-Dong Guan
Journal:  Mol Med Rep       Date:  2014-04-15       Impact factor: 2.952

7.  Aberrant DNA methylation of cancer-associated genes in gastric cancer in the European Prospective Investigation into Cancer and Nutrition (EPIC-EURGAST).

Authors:  Karen Balassiano; Sheila Lima; Mazda Jenab; Kim Overvad; Anne Tjonneland; Marie Christine Boutron-Ruault; Françoise Clavel-Chapelon; Federico Canzian; Rudolf Kaaks; Heiner Boeing; Karina Meidtner; Antonia Trichopoulou; Pagona Laglou; Paolo Vineis; Salvatore Panico; Domenico Palli; Sara Grioni; Rosario Tumino; Eiliv Lund; H Bas Bueno-de-Mesquita; Mattjis E Numans; Petra H M Peeters; J Ramon Quirós; María-José Sánchez; Carmen Navarro; Eva Ardanaz; Miren Dorronsoro; Göran Hallmans; Roger Stenling; Roy Ehrnström; Sara Regner; Naomi E Allen; Ruth C Travis; Kay-Tee Khaw; G Johan A Offerhaus; Nuria Sala; Elio Riboli; Pierre Hainaut; Jean-Yves Scoazec; Bakary S Sylla; Carlos A Gonzalez; Zdenko Herceg
Journal:  Cancer Lett       Date:  2011-07-14       Impact factor: 8.679

8.  Genome-wide binding of MBD2 reveals strong preference for highly methylated loci.

Authors:  Roberta Menafra; Arie B Brinkman; Filomena Matarese; Gianluigi Franci; Stefanie J J Bartels; Luan Nguyen; Takashi Shimbo; Paul A Wade; Nina C Hubner; Hendrik G Stunnenberg
Journal:  PLoS One       Date:  2014-06-13       Impact factor: 3.240

9.  Differential DNA methylation correlates with differential expression of angiogenic factors in human heart failure.

Authors:  Mehregan Movassagh; Mun-Kit Choy; Martin Goddard; Martin R Bennett; Thomas A Down; Roger S-Y Foo
Journal:  PLoS One       Date:  2010-01-13       Impact factor: 3.240

Review 10.  DNA methyltransferases: a novel target for prevention and therapy.

Authors:  Dharmalingam Subramaniam; Ravi Thombre; Animesh Dhar; Shrikant Anant
Journal:  Front Oncol       Date:  2014-05-01       Impact factor: 6.244
View more
  7 in total

1.  Analysis of Time Series Gene Expression and DNA Methylation Reveals the Molecular Features of Myocardial Infarction Progression.

Authors:  Yuru Han; Baoyu Duan; Jing Wu; Yanjun Zheng; Yinchen Gu; Xiaomeng Cai; Changlian Lu; Xubo Wu; Yanfei Li; Xuefeng Gu
Journal:  Front Cardiovasc Med       Date:  2022-06-24

2.  Integrated DNA methylation and gene expression analysis in the pathogenesis of coronary artery disease.

Authors:  Liu Miao; Rui-Xing Yin; Qing-Hui Zhang; Xi-Jiang Hu; Feng Huang; Wu-Xian Chen; Xiao-Li Cao; Jin-Zhen Wu
Journal:  Aging (Albany NY)       Date:  2019-03-07       Impact factor: 5.682

Review 3.  Epigenetic Biomarkers in Cardiovascular Diseases.

Authors:  Carolina Soler-Botija; Carolina Gálvez-Montón; Antoni Bayés-Genís
Journal:  Front Genet       Date:  2019-10-09       Impact factor: 4.599

Review 4.  Targeting Epigenetics and Non-coding RNAs in Myocardial Infarction: From Mechanisms to Therapeutics.

Authors:  Jinhong Chen; Zhichao Liu; Li Ma; Shengwei Gao; Huanjie Fu; Can Wang; Anmin Lu; Baohe Wang; Xufang Gu
Journal:  Front Genet       Date:  2021-12-20       Impact factor: 4.599

Review 5.  Integrative Analysis of Multi-Omics and Genetic Approaches-A New Level in Atherosclerotic Cardiovascular Risk Prediction.

Authors:  EIena I Usova; Asiiat S Alieva; Alexey N Yakovlev; Madina S Alieva; Alexey A Prokhorikhin; Alexandra O Konradi; Evgeny V Shlyakhto; Paolo Magni; Alberico L Catapano; Andrea Baragetti
Journal:  Biomolecules       Date:  2021-10-28

6.  Integrative analysis of DNA methylation and gene expression reveals key molecular signatures in acute myocardial infarction.

Authors:  Xiaoli Luo; Yi Hu; Li Li; Jue Li; Junwei Shen; Xinwen Liu; Tao Wang
Journal:  Clin Epigenetics       Date:  2022-03-27       Impact factor: 6.551

Review 7.  Radiation-induced cardiovascular disease: an overlooked role for DNA methylation?

Authors:  Magy Sallam; Mohammed Abderrafi Benotmane; Sarah Baatout; Pieter-Jan Guns; An Aerts
Journal:  Epigenetics       Date:  2021-01-31       Impact factor: 4.528
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.