Zhiguo Wang1, Yiqing Liu2, Qi Li1, Canping Ruan1, Bin Wu3, Qiang Wang4, Zhiqian Hu1, Huanlong Qin5. 1. Department of General Surgery, Shanghai Chang Zheng Hospital, Second Military Medical University, Shanghai, China (mainland). 2. Library, Second Military Medical University, Shanghai, China (mainland). 3. Department of Thoracic Surgery, Shanghai Chang Zheng Hospital, Second Military Medical University, Shanghai, China (mainland). 4. Department of General Surgery, Shanghai Zhabei Central Hospital, Shanghai, China (mainland). 5. Department of General Surgery, Tenth People's Hospital of Tongji University, Shanghai, China (mainland).
Abstract
BACKGROUND: Preoperative oral carbohydrate (OCH) improves postoperative insulin resistance (PIR) and insulin sensitivity. However, the exact mechanisms involved in the improvement of PIR with respect to preoperative OCH are still not clear. The aim of this study was to investigate the involvement of preoperative OCH and PI3K/AKT/mTOR pathway in reducing PIR in rats. MATERIAL AND METHODS: Forty male Sprague-Dawley rats were randomly assigned to PreOp, glucose, saline, and fasting groups. Rats in the PreOp, glucose, and saline groups received OCH, 5% glucose solution, and saline, respectively. Rats in the fasting group did not receive anything but were fasted 3 h before surgery. Blood glucose, insulin and leucine levels, and insulin resistance, secretion, and sensitivity indexes were measured before and after surgery. mRNA and protein (total and phosphorylated) levels of mTOR, IRS-1, PI3K, PKB/AKT, and GlUT4 were measured using real-time polymerase chain reaction and Western blot in skeletal muscles. RESULTS: In the PIR experiment, blood glucose, serum insulin, insulin resistance, and serum leucine levels were all significantly lower in the PreOp group than in the other 3 groups (P<0.05) after surgery. HOMA-ISI were higher in the PreOp group vs the other 3 groups after surgery (P<0.05), and HOMA-b in the PreOp group was higher than that in the other 3 groups at 30 and 120 min after surgery. Additionally, post-operative phosphorylated IRS-1, PI3K, and AKT protein levels were significantly higher in the PreOp group than in the other 3 groups (P<0.05), but no significant differences were observed in their respective protein levels (P>0.05). CONCLUSIONS: OCH decreases postoperative insulin resistance and improves postoperative insulin sensitivity in skeletal muscles through the PI3K/AKT/mTOR pathway.
BACKGROUND: Preoperative oral carbohydrate (OCH) improves postoperative insulin resistance (PIR) and insulin sensitivity. However, the exact mechanisms involved in the improvement of PIR with respect to preoperative OCH are still not clear. The aim of this study was to investigate the involvement of preoperative OCH and PI3K/AKT/mTOR pathway in reducing PIR in rats. MATERIAL AND METHODS: Forty male Sprague-Dawley rats were randomly assigned to PreOp, glucose, saline, and fasting groups. Rats in the PreOp, glucose, and saline groups received OCH, 5% glucose solution, and saline, respectively. Rats in the fasting group did not receive anything but were fasted 3 h before surgery. Blood glucose, insulin and leucine levels, and insulin resistance, secretion, and sensitivity indexes were measured before and after surgery. mRNA and protein (total and phosphorylated) levels of mTOR, IRS-1, PI3K, PKB/AKT, and GlUT4 were measured using real-time polymerase chain reaction and Western blot in skeletal muscles. RESULTS: In the PIR experiment, blood glucose, serum insulin, insulin resistance, and serum leucine levels were all significantly lower in the PreOp group than in the other 3 groups (P<0.05) after surgery. HOMA-ISI were higher in the PreOp group vs the other 3 groups after surgery (P<0.05), and HOMA-b in the PreOp group was higher than that in the other 3 groups at 30 and 120 min after surgery. Additionally, post-operative phosphorylated IRS-1, PI3K, and AKT protein levels were significantly higher in the PreOp group than in the other 3 groups (P<0.05), but no significant differences were observed in their respective protein levels (P>0.05). CONCLUSIONS:OCH decreases postoperative insulin resistance and improves postoperative insulin sensitivity in skeletal muscles through the PI3K/AKT/mTOR pathway.
Postoperative insulin resistance (PIR) reduces insulin-stimulated glucose uptake in skeletal muscles and adipose tissue, reducing glucose uptake and leading to hyperglycemia [1,2]. Preoperative oral carbohydrate (OCH) can improve post-surgical insulin sensitivity [2,3], as well as post-operative glycemic control, attenuate early post-operative metabolic response, improve insulin resistance (IR), and reduce recovery time [4]. Preoperative OCH intake was found to be safe in patients with colorectal cancer receiving elective open resection [5]. Intake of 400 ml (50 g) of carbohydrates stimulates a release of insulin similar to that seen after a mixed meal [6]. Treatment with this carbohydrate-rich beverage preoperatively attenuates PIR development by 50% measured on the first post-operative day after major abdominal surgery [7].Peripheral tissues, mostly skeletal muscles, are the major PIR sites, and impaired insulin signaling is the major mechanism for PIR [8]. The insulin/insulin-like growth factor pathway regulates energy homeostasis in animals [9]. The PI3K/AKT signaling pathway plays an important role in the development of PIR [10]. The insulin signaling pathway mainly activates the phosphorylation of kinases of the PI3K/Akt/mTOR pathway in order to improve glucose metabolism [11-13]. However, the exact mechanisms involved in the improvement of PIR with respect to preoperative OCH are still unclear.Leucine is the most likely activator of mTOR [14]. In skeletal muscles, leucine can stimulate mTOR signaling and increase phosphorylation of eukaryotic initiation factor 4E-binding protein 1 and 70-kDa ribosomal protein S6 kinase 1 [15]. In addition, circulating leucine and isoleucine are both post-operatively decreased when intravenous glucose was administered during upper abdominal surgery. This could stimulate insulin secretion and result in accumulation of substrates such as pyruvate and alanine [16]. However, the effect of circulating leucine on glucose metabolism is unclear.Therefore, the present study hypothesized that preoperative OCH could decrease circulating leucine and improve PIR by the PI3K/AKT/mTOR pathway. The aim of the present study was to investigate the involvement of preoperative OCH and PI3K/AKT/mTOR pathway in reducing PIR in a rat model of small bowel resection (SBR). The study results may provide further understanding of the molecular mechanisms involved in the improvement of PIR by preoperative OCH.
Material and Methods
Animals and ethics
Forty male Sprague-Dawley rats weighing 150–200 g were purchased from Shanghai SIPPR/BK Laboratory Animals Ltd., Shanghai, China [Certificate number: 2008001618428. Production license: SCXK (Shanghai) 2008-0016]. The rats were acclimatized for a week prior to the experiments, with free access to water and food. The animals were kept under a physiological day/night cycle with an ambient temperature of 23±1°C, humidity of 50–70%, and noise restriction of <50 dB. The experimental protocol was approved by the Animal Ethics Committee of the Shanghai Chang Zheng Hospital.
Preoperative treatment
Forty rats were fasted for 14 h before surgery (from 7: 00 pm the previous night to 9: 00 am on the day of surgery). Rats were randomly assigned to 4 groups (n=10/group): rats in the PreOp, glucose, and saline groups received OCH (PreOp solution, Nutricia, Holland), 5% glucose solution (Baxter International Inc., Shanghai, China), and saline (Baxter International Inc., Shanghai, China), respectively. Rats in the fasting group did not receive anything, but were fasted 3 h before surgery. The PreOp solution contained 0.2 g/mL glucose, 1.3 g/mL sucrose, 0.7 g/mL maltose, 10 g/mL glycan, 0.122 g/mL potassium, 0.006 g/mL calcium, 0.006 g/mL chloride, 0.001 g/mL phosphorus, and 0.001 g/mL magnesium.
PIR surgery model in rats
Three hours after the above treatments, rats underwent anesthesia using 10% chloral hydrate (Shanghai Reagent Co., Ltd, China) 500 μl/100 g by intraperitoneal injection. Sedated rats were fixed in the dorsal position, abdominal fur was removed, and the abdominal area was disinfected [1]. A 5-cm midline abdominal incision was made, the small intestine was exposed, and 2–3 mesenteric vessels were disconnected at 5 cm from the ligament of Treitz. A 5-cm length of small intestine was removed. Small intestine was anastomosed, followed by abdomen closure using 6/0 Prolene sutures. Average surgery time was 20 min. After surgery, rats were kept in individual cages and under a heat lamp to maintain body temperature.
Blood and tissue collection
In the PIR experiment, blood samples (300 μL) were collected 4 h before the surgery, and 30, 60, 90, and 120 min after surgery. Blood samples were centrifuged at 4°C at 2000 rpm for 10 min, and serum was collected and stored at –20°C. Rats were killed 120 min after the last blood sampling.Abdominal muscle tissue was removed after the experiment and quickly put into cold saline. Gastrocnemius tissue was washed 3 times in cold saline to remove the blood, and was stored in liquid nitrogen for measurements of mTOR, PI3K, AKT, and/or GLUT4 mRNA and protein levels.
Blood glucose and insulin assay
Blood glucose levels were determined using the Wako LabAssay™ Glucose kit (Wako Pure Chemical Industries, Ltd., Japan), according to the manufacturer’s protocol. Serum insulin levels were measured using the BlueGene RatInsulin enzyme-linked immunosorbent assay kit (Shanghai BlueGene Biotech CO., Ltd., China), according to the manufacturer’s protocol.
Homeostatic model assessment (HOMA) of PIR
The following formulae were used to evaluate PIR in each animal through HOMA [17-19]:HOMA-IR (insulin-resistant) = (blood glucose level × serum insulin level)/22.5HOMA-β = (serum insulin level ×20)/(blood glucose level − 3.5)HOMA-ISI (insulin sensitivity index) = 1/[log(blood glucose level) + log(serum insulin level)]
Serum leucine evaluation by high-performance liquid chromatography (HPLC)
Serum leucine levels were measured using HPLC (Perkin Elmer, USA). To prepare the sample solution, 200 μL of amino acid standards and serum samples were added into individual 1.5-mL microcentrifuge tubes. Fifty μL of norleucine (1 g/L diluted in 10 mol/L; Sangon Biotech, China) was added to each tube as internal standard. Then, 100 μL of acetonitrile triethylamine solution (triethylamine: acetonitrile (v/v)=500: 8.6, Sangon Biotech, China) and 100 μL of phenyl isothiocyanate acetonitrile solution (isothiocyanate: acetonitrile (v/v)=250: 1, Sangon Biotech, China) were added to each tube, mixed well, and kept aside for 1 h at room temperature. Following that, 400 μL of hexane was added into each tube, mixed well, and kept aside for 10 min at room temperature to form 2 phases. The lower phase, which contained amino acids, was filtered and transferred into a fresh tube using a 0.45-μm syringe filter. Then, 200 μL of phenylthiocarbamoyl amino acid was diluted in 800 μL of sterile water as sample solution. A Venusil AA chromatographic column was used (4.6×250 mm and 5 μm; Agela Technologies, China), and column temperature was kept at 40°C. Ten μL of each sample solution was used for the measurement of amino acid concentration, and the wavelength was 254 nm.
RNA isolation and real-time polymerase chain reaction (PCR)
Frozen abdominal muscle (100 μm) was sectioned on a cryostat. RNA was extracted from muscle sections using Trizol (Life Technologies, USA), according to the manufacturer’s instructions. cDNA was synthesized from 1 μg of total RNA using the Tiangen Quantscript Reverse Transcriptase kit (KR103, Tiangen Biotech, China). Quantitative real-time PCR was performed on a Real-Time PCR System (Bio-Rad, USA) using TIANGEN SuperReal PreMix (SYBR Green, FP204, Tiangen Biotech, China).β-actin served as an internal control. All PCR reactions were performed in triplicate. Primer sequences and annealing temperature of mTOR, insulin receptor substrate 1 (IRS-1), PI3K, PKB, and GLUT4 are presented in Table 1. Quantitative real-time PCR analysis was carried out using the 2−ΔΔCt method.
Table 1
Primer sequences.
Gene
Primer sequence
Annealing temperature (°C)
β-actin
F 5′CCTGTACGCCAACACAGTGC3′
58
R 5′ATACTCCTGCTTGCTGATCC3′
mTOR
F 5′GACGGTGTAGAACTTGGAGAA3′
58
R 5′TGAGATGTCGCTTGCTTGA3′
IRS-1
F 5′TGTGCCAAGCAACAAGAAAG3′
58
R 5′ACGGTTTCAGAGCAGAGGAA3′
Akt
F 5′GTCCTATTGTCGTGCATGTGG3′
58
R 5′CTCTTCAAGCCTGAGGTTTCC3′
PI3K
F 5′AGGCTGTGATTGGGCGTA3′
58
R 5′AAGCAACCTCAAAGGGAAA3′
GluT4
F 5′GCCAAGAAGGAGCCCTAACTT3′
58
R 5′TGTCTCAGCCCATCCTCAAGTA3′
Western blotting
Frozen abdominal muscle samples were homogenized in cold cell lysis buffer (Sigma-Aldrich, USA) supplemented with a protease and phosphatase inhibitor cocktail and phenylmethanesulfonylfluoride (PMSF). Crude extract was cleared from debris by centrifugation (800 g, 10 min, and 4°C), and supernatant was separated by centrifugation (14000 g, 15 min, 4°C). Lysate was collected, and protein concentration was determined by bicinchoninic acid assay (Sigma, USA). From each sample, 50 μg was denatured in 4× Laemmli buffer [250 mM Tris-hydrochloride pH 6.8, 40% glycerol, 8% sodium dodecyl sulfate (SDS), 0.01% bromphenol blue, and 20% β-mercaptoethanol], run on 10% SDS-polyacrylamide gel, and transferred onto nitrocellulose membrane (Amersham, USA). Membranes were blocked with 5% milk in Tris Buffered Saline with Tween 20 (TBS-T) and subsequently incubated with primary antibody in TBS-T supplemented with 5% blocking milk in 1: 1000 dilution of rabbit anti-mTOR (#2972S, Cell Signaling, USA) and anti-p-mTOR (Ser2448) (#2971P, Cell Signaling, USA), anti-IRS-1(59G8) (#2390, Cell Signaling, USA) and anti-p-IRS-1 (Ser302) (#2384, Cell Signaling, USA), anti-PI3Kp85 (#4292, Cell Signaling, USA) and anti-p-PI3K p85 (Tyr458) (#4228, Cell Signaling, USA), anti-AKT (4685S, Cell Signaling, USA) and anti-p-AKT(Thr308) (#2965P, Cell Signaling, USA), and anti-GluT4 (#2213S, Cell Signaling, USA) and anti-β-actin (sc-47778, Santa Cruz, USA). An IRDye 800CW (926-32210) (LI-COR, USA) was used as a secondary antibody. Proteins were visualized with 800 nM wave length on an Odyssey Luminescent Image Analysis system (LI-COR, USA).
Statistical analysis
Data were analyzed using SPSS 11.5 for windows (SPSS Inc, Chicago, Illinois, USA). Continuous data are presented as means ± standard deviation. Analysis of variance and Kruskal-Wallis were used to compare the groups. Pairwise comparisons were conducted using the least significant difference t-test or Dunnett T3 test. Chi-square test was used to analyze correlation in the dataset. P-values <0.05 were considered statistically significant.
Results
Animal weight
Before surgery, the weight of the animals in the 4 treatment groups were 180.72±15.09 g (PreOp group), 181.24±14.79 g (glucose group), 179.87±15.39 g (saline group), and 180.37±14.39 g (fasting group) (F=0.094, P=0.761).
Changes in blood glucose and serum insulin levels
There was no difference in preoperative blood glucose levels among the 4 treatment groups (P=0.968). However, blood glucose levels were increased at 30 min post-surgery and continued to increase thereafter. At 90–120 min after surgery, blood glucose levels were different among the 4 treatment groups (P<0.05). Blood glucose levels of the PreOp group were significantly lower than that of the fasting group at 30 to 120 min after surgery; the corresponding values were lower in the PreOp group than in the glucose and saline groups at 90 to 120 min after surgery, respectively, and higher in the fasting group than in the glucose and saline groups at 120 min after surgery (Figure 1A).
Figure 1
(A) Blood glucose levels in the PreOp (Group P), 5% glucose (Group G), saline (Group S), and fasting groups (Group F) before surgery, and 30, 60, 90, and 120 min after surgery in rats. * Preoperative vs. 30 min.; § Preoperative vs. 60 min; & Preoperative vs. 90 min; Δ Preoperative vs. 120 min; ж 30 min vs. 60 min; % 30 min vs. 90 min; # 30 min vs. 120 min; ¤ 60 min vs. 90 min; Ψ 60 min vs. 120 min. (B) Serum insulin levels in Groups P, G, S, and F before surgery, and 30, 60, 90, and 120 min after surgery in rats. * Preoperative vs. 30 min.; § Preoperative vs. 60 min; & Preoperative vs. 90 min; Δ Preoperative vs. 120 min; ж 30 min vs. 60 min; % 30 min vs. 90 min; # 30 min vs. 120 min; ¤ 60 min vs. 90 min; Ψ 60 min vs. 120 min.
There was no difference in the preoperative serum insulin levels among the 4 treatment groups (P=0.778). After surgery, blood insulin levels showed the same trend as for blood glucose. Serum insulin levels of the PreOp group were significantly lower than that of the fasting group at 30, 90, and 120 min (P<0.05); the corresponding values were significantly lower in the PreOp group than in the glucose and saline groups at 60 and 120 min after surgery, respectively (Figure 1B).
HOMA-IR, HOMA-β, and HOMA-ISI
Before surgery, there was no difference in HOMA-IR among the 4 treatment groups (P=0.990). After surgery, HOMA-IR showed a rapid increase in the 4 treatment groups at 30 min. HOMA-IR of the PreOp group became significantly lower than the values of the other 3 groups at 60 min post-surgery (P<0.05), which suggested that the PreOp treatment reduced postoperative HOMA-IR (Figure 2A). On the other hand, HOMA-β of animals underwent a rapid decrease postoperatively, and HOMA-ISI were higher in the PreOp group vs. the other 3 groups after surgery (P<0.05), while HOMA-β in the PreOp group was higher than that in the other 3 groups at 30 and 120 min after surgery (P<0.05 and P<0.01, respectively, Figure 2B, 2C).
Figure 2
(A) HOMA-IR in Groups P, G, S, and F before surgery, and 30, 60, 90, and 120 min after surgery in rats. * Preoperative vs. 30 min.; § Preoperative vs. 60 min; & Preoperative vs. 90 min; Δ Preoperative vs. 120 min; ж 30 min vs. 60 min; % 30 min vs. 90 min; # 30 min vs. 120 min; ¤ 60 min vs. 90 min; Ψ 60 min vs. 120 min. (B) HOMA-β in Groups P, G, S, and F before surgery, and 30, 60, 90, and 120 min after surgery in rats. * Preoperative vs. 30 min.; § Preoperative vs. 60 min; & Preoperative vs. 90 min; Δ Preoperative vs. 120 min; ж 30 min vs. 60 min; % 30 min vs. 90 min; # 30 min vs. 120 min; ¤ 60 min vs. 90 min; Ψ 60 min vs. 120 min. (C) HOMA-ISI in Groups P, G, S, and F before surgery, and 30, 60, 90, and 120 min after surgery in rats. * Preoperative vs. 30 min.; § Preoperative vs. 60 min; & Preoperative vs. 90 min; Δ Preoperative vs. 120 min; ж 30 min vs. 60 min; % 30 min vs. 90 min; # 30 min vs. 120 min; ¤ 60 min vs. 90 min; Ψ 60 min vs. 120 min.
Serum leucine levels
HPLC results showed that there was no difference in preoperative serum leucine levels among the 4 treatment group: 0.34±0.05 μmol/L (PreOp group), 0.35±0.04 μmol/L (glucose group), 0.35±0.08 μmol/L (saline group), and 0.35±0.05 μmol/L (fasting group) (P>0.05, Figure 3A). Significant differences were observed in serum leucine levels between the PreOp group and the other 3 groups at 2 h post-surgery (F=13.886, P<0.001, Figure 3B).
Figure 3
Serum leucine levels in Groups P, G, S, and F. (A) before surgery and (B) 120 min after surgery in rats. * F group vs. P group; ** F group vs. G group; *** F group vs. N group; # comparison among all 4 groups; ## P group vs. G group; ### P group vs. N group.
mRNA expression of PI3K, AKT, mTOR, IRS-1, and GluT4 in muscles by RT-PCR
Results showed that the mRNA expression levels of PI3K, AKT, and IRS-1 in muscles of the PreOp group were significantly higher than those of the other 3 groups (all P<0.05), whereas mTOR expression was downregulated in the PreOp group compared with the other 3 groups (P<0.05). There was no difference in GLUT4 expression in rat muscles among the 4 groups (Figure 4).
Figure 4
Messenger RNA expression of IRS-1, PI3K, AKT, mTOR, and Glut4 in skeletal muscles of rats 2 h after surgery.
Protein expression and phosphorylation of PI3K, AKT, mTOR, and IRS-1 in muscles by Western blot
There was no change in total PI3K, AKT, mTOR, and IRS-1 protein expression (all P<0.05). However, upregulation of phosphorylated-(p-) PI3K, p-AKT, p-IRS, and downregulation of p-mTOR were demonstrated in the PreOp group compared with that in the other groups (all P<0.05) (Figure 5). These results indicate that the PI3K/AKT/mTOR pathway might be involved in the postoperative development of IR.
Figure 5
Total protein and phosphorylated levels of mTOR, IRS-1, PI3K, and AKT in skeletal muscle of rats 2 h after surgery.
Discussion
Following trauma, PIR frequently occurs as a reaction of the body to traumatic stress and manifestation of any impairment of the body’s reaction to physiological functions of insulin. In the present study, the established rat model exhibited significant PIR after SBR surgery. The PreOp OCH treatment attenuated the postoperative blood glucose and insulin levels, improved insulin secretion function of pancreas islets, and increased insulin sensitivity of peripheral tissues, thus contributing to the reduction of PIR. Despite a lack of substantial change in protein expression of the PI3K/AKT/mTOR signal pathway, the associated protein phosphorylation level underwent significant changes, suggesting activation of the PI3K/AKT/mTOR pathway. Additionally, the activation of IRS-1 phosphorylation was also observed. These results suggest that the OCH treatment may affect PIR via regulation of the PI3K/AKT/mTOR pathway.Compared with the PreOp OCH treatment, preoperative oral administration of glucose solution or normal saline induced no significant improvement in PIR, possibly because OCH contained polysaccharides and disaccharides as well as fructose and electrolytes, which were able to promoting gastric emptying. Previous studies in healthy volunteers showed that oral administration of monosaccharide solution (e.g., 5% glucose) led to extension of gastric emptying time [20,21]; when the monosaccharide was replaced with polysaccharides to reduce the osmotic pressure, the gastric emptying time of OCH was significantly shortened [22-24]. Therefore, preoperative oral administration of sugar-rich solution generally uses polysaccharides (dextrin-maltose mixture), which leads to substantial reduction of the osmotic pressure compared with an equal amount of pure glucose or other monosaccharides, thereby accelerating the rate of gastric emptying.Under normal circumstances, insulin from pancreatic β cells approaches the target organ via a short cycle, then accelerating glucose metabolism in target cells. IR is defined as a phenomenon in which a certain amount of insulin cannot achieve the expected biological effects; that is, only a normal or higher level of insulin achieves a low biological effect. IR is an important cause of high blood glucose levels after trauma, mainly in peripheral tissues, especially muscle tissues. In addition to pathological hyperglycemia and impaired glucose tolerance, IR can cause increased catabolism, negative nitrogen balance, reduction of lean tissues, impaired would healing, and elevation of infection rate. These can seriously affect the environmental stability in vivo. The above phenomenon is referred to as diabetes mellitus [8]. In the present study, a significant decrease in HOMA-ISI and HOMA-β was observed post-surgery, indicating that the pancreatic secretion function was suppressed at an early stage after trauma. HOMA-β of the PreOp group exhibited a small range of reduction and rapid recovery, demonstrating that animals of the PreOp group had the least impairment of secretion function and fastest recovery post-surgery. HOMA-ISI became obviously lower than the baseline values at 30 min post-surgery, suggesting that insulin sensitivity in vivo was suppressed at an early stage after trauma. However, HOMA-ISI of animals was significantly higher in the PreOp group compared with the other 3 groups, indicating that the PreOp OCH treatment might enhance insulin sensitivity via a specific pathway and thereby improving PIR.Posttraumatic IR involves complex mechanisms. Recently, the roles of the IRS-1/PI3K/AKT system in posttraumatic IR have received more attention. Tyrosine phosphorylation of IRS-1 is the first step for most biological effects of insulin and the core step of insulin signal transduction. Active IRS-1 in cells functions as an adaptor protein; the cells react with a variety of downstream signal proteins to induce cascade reactions and mediate the physiological activities of insulin in cells. In this process, activation of PI3K and AKT play an important role. The PI3K/PKB system is an independent pathway, which is involved in signal transduction of a variety of growth factors and has extensive biological effects [25]. After trauma, tyrosine phosphorylation of IRS-1 is suppressed; thus, the inhibition of serine phosphorylation associated with IRS-1 protein transduction is enhanced, resulting in IR. Regulating protein expression in the IRS-1/PI3K/Akt pathway can lead to reduction of IR [26] and acceleration of glucose transport in skeletal muscle [27]. The present study demonstrated that OCH treatment inhibited the mTOR pathway to activate the PI3K/AKT-independent pathway. These results are supported by previous findings from China [28].A previous study reported that mTOR and Akt contributed to IR. The basal phosphorylation levels of mTOR and Akt were higher in the insulin-resistant plantaris muscles of obeserats compared with that found in their lean counterparts [29]. mTOR can be regulated by the level of serum amino acids [30-32], especially leucine [33]. Therefore, similar results were obtained with the analysis of serum leucine levels. However, the relationship between OCH and serum leucine levels needs further investigation.The present study is not without limitations. These results were obtained in a rat model, and some studies might be needed in humans to confirm these results. In addition, we explored only 1 pathway, while many others might be more or less involved in PIR. Most importantly, the present study did not explore the mechanisms leading to PIR, which are not well established.
Conclusions
Surgical trauma may induce IR in peripheral skeletal muscle tissues. Preoperative OCH administration can reduce postoperative serum leucine concentration to inhibit the mTOR pathway and activate IRS-1/PI3K/Akt phosphorylation. Through these 2 pathways, it is possible that the postoperative insulin sensitivity is enhanced and IR is improved. Further studies are needed to better understand how PreOp changes in the basal phosphorylation of mTOR, and how Akt may contribute to pathophysiology of IR after surgery.
Authors: C J Sabers; M M Martin; G J Brunn; J M Williams; F J Dumont; G Wiederrecht; R T Abraham Journal: J Biol Chem Date: 1995-01-13 Impact factor: 5.157
Authors: Lei Yang; Di Yu; Ran Mo; Jiru Zhang; Hu Hua; Liang Hu; Yu Feng; Song Wang; Wei-Yan Zhang; Ning Yin; Xu-Ming Mo Journal: PLoS One Date: 2016-01-29 Impact factor: 3.240